ID: 1161525132

View in Genome Browser
Species Human (GRCh38)
Location 19:4749763-4749785
Sequence CTGTAGAAAAGGACAGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161525127_1161525132 18 Left 1161525127 19:4749722-4749744 CCCACAAAAGCCAAAAAACAAAA No data
Right 1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG No data
1161525126_1161525132 19 Left 1161525126 19:4749721-4749743 CCCCACAAAAGCCAAAAAACAAA No data
Right 1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG No data
1161525129_1161525132 8 Left 1161525129 19:4749732-4749754 CCAAAAAACAAAAGACAAAAAAA 0: 2
1: 66
2: 508
3: 15880
4: 26344
Right 1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG No data
1161525128_1161525132 17 Left 1161525128 19:4749723-4749745 CCACAAAAGCCAAAAAACAAAAG No data
Right 1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161525132 Original CRISPR CTGTAGAAAAGGACAGGACA CGG Intergenic
No off target data available for this crispr