ID: 1161525888

View in Genome Browser
Species Human (GRCh38)
Location 19:4754961-4754983
Sequence CCTACCAACCAAGAGTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161525888_1161525896 1 Left 1161525888 19:4754961-4754983 CCAGATAACTCTTGGTTGGTAGG No data
Right 1161525896 19:4754985-4755007 GTGGGGTCCTGTACGCTATCGGG No data
1161525888_1161525895 0 Left 1161525888 19:4754961-4754983 CCAGATAACTCTTGGTTGGTAGG No data
Right 1161525895 19:4754984-4755006 GGTGGGGTCCTGTACGCTATCGG No data
1161525888_1161525898 12 Left 1161525888 19:4754961-4754983 CCAGATAACTCTTGGTTGGTAGG No data
Right 1161525898 19:4754996-4755018 TACGCTATCGGGTGCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161525888 Original CRISPR CCTACCAACCAAGAGTTATC TGG (reversed) Intergenic
No off target data available for this crispr