ID: 1161526491

View in Genome Browser
Species Human (GRCh38)
Location 19:4759355-4759377
Sequence GCTTCTTATGCCCCAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161526491_1161526492 7 Left 1161526491 19:4759355-4759377 CCTGCTTCTGGGGCATAAGAAGC No data
Right 1161526492 19:4759385-4759407 GCAAATAAAGCGTTTCGCTCAGG No data
1161526491_1161526493 20 Left 1161526491 19:4759355-4759377 CCTGCTTCTGGGGCATAAGAAGC No data
Right 1161526493 19:4759398-4759420 TTCGCTCAGGCTCTGCACGTAGG No data
1161526491_1161526494 21 Left 1161526491 19:4759355-4759377 CCTGCTTCTGGGGCATAAGAAGC No data
Right 1161526494 19:4759399-4759421 TCGCTCAGGCTCTGCACGTAGGG No data
1161526491_1161526495 26 Left 1161526491 19:4759355-4759377 CCTGCTTCTGGGGCATAAGAAGC No data
Right 1161526495 19:4759404-4759426 CAGGCTCTGCACGTAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161526491 Original CRISPR GCTTCTTATGCCCCAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr