ID: 1161526680

View in Genome Browser
Species Human (GRCh38)
Location 19:4760227-4760249
Sequence CTAGGGTTCCCCACCACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161526680_1161526687 5 Left 1161526680 19:4760227-4760249 CCAGTGGTGGTGGGGAACCCTAG No data
Right 1161526687 19:4760255-4760277 AGCCTGGGTAAACCTAGATTTGG No data
1161526680_1161526691 8 Left 1161526680 19:4760227-4760249 CCAGTGGTGGTGGGGAACCCTAG No data
Right 1161526691 19:4760258-4760280 CTGGGTAAACCTAGATTTGGGGG No data
1161526680_1161526693 14 Left 1161526680 19:4760227-4760249 CCAGTGGTGGTGGGGAACCCTAG No data
Right 1161526693 19:4760264-4760286 AAACCTAGATTTGGGGGCGCGGG No data
1161526680_1161526688 6 Left 1161526680 19:4760227-4760249 CCAGTGGTGGTGGGGAACCCTAG No data
Right 1161526688 19:4760256-4760278 GCCTGGGTAAACCTAGATTTGGG No data
1161526680_1161526690 7 Left 1161526680 19:4760227-4760249 CCAGTGGTGGTGGGGAACCCTAG No data
Right 1161526690 19:4760257-4760279 CCTGGGTAAACCTAGATTTGGGG No data
1161526680_1161526694 15 Left 1161526680 19:4760227-4760249 CCAGTGGTGGTGGGGAACCCTAG No data
Right 1161526694 19:4760265-4760287 AACCTAGATTTGGGGGCGCGGGG No data
1161526680_1161526692 13 Left 1161526680 19:4760227-4760249 CCAGTGGTGGTGGGGAACCCTAG No data
Right 1161526692 19:4760263-4760285 TAAACCTAGATTTGGGGGCGCGG No data
1161526680_1161526682 -10 Left 1161526680 19:4760227-4760249 CCAGTGGTGGTGGGGAACCCTAG No data
Right 1161526682 19:4760240-4760262 GGAACCCTAGCCTCCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161526680 Original CRISPR CTAGGGTTCCCCACCACCAC TGG (reversed) Intergenic