ID: 1161528072

View in Genome Browser
Species Human (GRCh38)
Location 19:4769682-4769704
Sequence CTGTTTCAGCACCGGGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161528066_1161528072 9 Left 1161528066 19:4769650-4769672 CCTCTCGGGAGGTCCGAGAAGAG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 116
1161528061_1161528072 27 Left 1161528061 19:4769632-4769654 CCAAATATCCGGACAGCGCCTCT 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 116
1161528067_1161528072 -4 Left 1161528067 19:4769663-4769685 CCGAGAAGAGAACCGCGATCTGT 0: 1
1: 0
2: 1
3: 3
4: 40
Right 1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 116
1161528065_1161528072 19 Left 1161528065 19:4769640-4769662 CCGGACAGCGCCTCTCGGGAGGT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161528072 Original CRISPR CTGTTTCAGCACCGGGGCTC AGG Intergenic
900626173 1:3609713-3609735 CTGCCTCTGCACCTGGGCTCGGG - Intronic
902631200 1:17705666-17705688 CTGTTTCTAAACCTGGGCTCAGG + Intergenic
910119396 1:83768830-83768852 CTGATTCAGTATCTGGGCTCTGG - Intergenic
912507084 1:110163745-110163767 CTCATTCTGCCCCGGGGCTCTGG + Intronic
915314893 1:155022940-155022962 CTGTGTCAGCACCGTGGCCCAGG - Intronic
918109917 1:181446429-181446451 CTGTTTCATTACAGGGGCTATGG + Intronic
918649698 1:186946068-186946090 CTGTCTAAGCGCGGGGGCTCTGG - Intronic
920094962 1:203480678-203480700 CTGATTCAGCCCTGGGGCTGAGG + Intronic
924674351 1:246160480-246160502 ATGTTTCAGCACCGAGGAACTGG - Intronic
1063405876 10:5794368-5794390 ATGATTAAGCACCAGGGCTCTGG + Intronic
1063646603 10:7889977-7889999 CTGTTTCAGAACTGTTGCTCTGG - Intronic
1064630677 10:17307767-17307789 CTGATTAAGCACCTGGGCTTTGG + Intergenic
1069829295 10:71272615-71272637 CTGAATCAGCAACTGGGCTCTGG + Intronic
1070739423 10:78892923-78892945 GTGTCTCAGCACCAGTGCTCAGG - Intergenic
1075666772 10:124236588-124236610 CTTTTTCAACACAGGGTCTCTGG - Intergenic
1079392060 11:20031084-20031106 CTGTTTCAGGACCAGGACACAGG + Intronic
1080032819 11:27679796-27679818 CTGTTTCACCAGCAGAGCTCTGG + Intronic
1083621642 11:64052172-64052194 CTGGTTTGGCACCGGGGCTCTGG - Intronic
1084585966 11:70062637-70062659 CTGTCTCAGCAAGGGGGTTCTGG + Intergenic
1090258094 11:125299811-125299833 CTGGCTCAGAACCGAGGCTCAGG - Intronic
1091937276 12:4443885-4443907 CCGTTTAAGCACACGGGCTCCGG + Intronic
1096778796 12:53980091-53980113 ATGTTTCAGCTCCGGAGGTCAGG + Intergenic
1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG + Intergenic
1107946319 13:45420188-45420210 CTGTTACAGAACCAGGGCCCAGG + Intergenic
1107978649 13:45713911-45713933 CTGCTGCAGGACCAGGGCTCCGG + Exonic
1110735920 13:78936575-78936597 CTCTTCCAGCACAGGGACTCAGG + Intergenic
1120388814 14:83879990-83880012 CTGTTTTAGCTCCTGGGCTCTGG + Intergenic
1120733716 14:88030380-88030402 CTGTTTCTGCAGAGGGGCCCAGG - Intergenic
1123020120 14:105394087-105394109 CTGTTTCAGAAACGGAGCTCTGG + Intronic
1124022801 15:25939498-25939520 CTGTTTCAGCGCCTGGGGTGAGG - Intergenic
1125480619 15:40077176-40077198 CTGTTTGAGCCCAGGAGCTCAGG + Intergenic
1127779321 15:62297547-62297569 GTCTTTCAGAACCTGGGCTCTGG + Intergenic
1127959112 15:63878014-63878036 CTGTTGCAGCCCCTGGGATCAGG - Intergenic
1129982087 15:79882450-79882472 CTGTTACAGCACTCGGGCTCAGG + Intronic
1131048879 15:89333680-89333702 CGGTTCCAGCTCCGGGGCGCTGG - Exonic
1131092333 15:89632220-89632242 CTGTTCCAGTACAGGGGCTTGGG - Intronic
1132677353 16:1126299-1126321 CGGTTCCAGCACCGGGGAGCTGG - Intergenic
1134217910 16:12330661-12330683 CTGGTTAAGAACCAGGGCTCTGG - Intronic
1136507747 16:30716425-30716447 CTGCTTCAGCACCGCCTCTCTGG + Exonic
1136514022 16:30756993-30757015 CTCTTTCAGCACCGGCCCCCTGG + Exonic
1143423312 17:6813040-6813062 CTGTTTCAGCTCCGTGAGTCTGG - Exonic
1143595298 17:7910416-7910438 CTGGTTCAGAACTGGGGCCCGGG - Exonic
1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG + Intronic
1147671778 17:42180717-42180739 CTGTTCCTGCACCGCGGCTTTGG + Intronic
1148201366 17:45752114-45752136 CTGGGCCAGCACCTGGGCTCTGG + Intergenic
1151946313 17:77321839-77321861 CTGTTTGAGCTCGGGGGCTCAGG + Intronic
1152279928 17:79379231-79379253 CTGTTTCACTCCCAGGGCTCAGG + Intronic
1154044919 18:10895516-10895538 CTGTTCCAGCTGGGGGGCTCTGG - Intronic
1155233098 18:23793412-23793434 CTGCTTCAGCCCCTGGGCTTTGG - Intronic
1160566421 18:79788881-79788903 CTGTCCAACCACCGGGGCTCCGG - Intergenic
1160569143 18:79804522-79804544 GTGTTTCTGCACCTTGGCTCAGG - Intergenic
1160739541 19:679690-679712 CTGTCTGAGCAGCGGGGCTGCGG + Intronic
1160778683 19:868306-868328 CTCTTGCAGCAGCCGGGCTCAGG + Intronic
1161381238 19:3966196-3966218 CTGTTAGAGCACCTGGGCTCTGG - Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1163991147 19:21000255-21000277 CCGTTTCAGCACAGCGGCTTTGG + Intergenic
1164389511 19:27805782-27805804 CTGCTTCAGCACGGGGCCTGTGG + Intergenic
1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG + Intergenic
1166304511 19:41929831-41929853 CGGTCTCAGCACCTGGGCGCTGG - Intronic
1168076695 19:53984255-53984277 CTGTTTCACCCCTGGGGATCTGG - Exonic
925018593 2:551385-551407 GTGTTTCAGCACCCGGGGTGGGG - Intergenic
925109150 2:1318908-1318930 CTCTGTCATCCCCGGGGCTCAGG + Intronic
925198602 2:1947978-1948000 CTCTTTGAGCACCCGGACTCCGG + Intronic
926361902 2:12096560-12096582 CTGTCTCAGCTATGGGGCTCTGG - Intergenic
927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG + Intergenic
934765015 2:96875760-96875782 CAGTTACAGCACTGGGGCCCAGG - Intergenic
938390047 2:130897827-130897849 CTGATTCAGCACTGGGGGTGAGG + Intronic
941139968 2:161767997-161768019 CTTTTTTAGCACCTGGGCTAGGG + Intronic
946826688 2:223686359-223686381 CTGTTTCAGCACCGTGGCAAGGG - Intergenic
948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG + Intergenic
948317330 2:237038303-237038325 CTGTTTAAGCATCGTGGCTTTGG - Intergenic
948628325 2:239284364-239284386 CTGGGTCAGCACAGTGGCTCAGG - Intronic
1169044445 20:2524735-2524757 CTGTTGCAGCGCCGGGGCTGGGG - Intergenic
1169361650 20:4954967-4954989 TTGTTTGAGCACGGTGGCTCAGG + Intronic
1175290290 20:57870814-57870836 CTGTTTCAGCCCCCTTGCTCTGG - Intergenic
1175832794 20:61976328-61976350 CTTTTTCATCACCAGGGGTCGGG - Exonic
1176381642 21:6116817-6116839 CGGTTTCGGCACAGGGGCTGTGG - Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179716431 21:43291082-43291104 CAGTGTCAGCACCCGGGCACGGG - Intergenic
1179741830 21:43421422-43421444 CGGTTTCGGCACAGGGGCTGTGG + Intronic
1181054248 22:20252657-20252679 CTGTGTCATCCCTGGGGCTCAGG - Intronic
1182420410 22:30246026-30246048 CTGTTCCAGCATGGGGGATCCGG - Intronic
1185021578 22:48379780-48379802 CTGCTCCAGCTCTGGGGCTCTGG - Intergenic
949957107 3:9278205-9278227 CTGTTTGATCACCAGGCCTCAGG + Intronic
950374199 3:12556949-12556971 TTGGTTCCGCACCGGGGATCGGG - Intronic
950449406 3:13057283-13057305 CTGTTTTAGGTCAGGGGCTCAGG - Intronic
951044582 3:18023993-18024015 CTGTGTCAGCAACAGTGCTCTGG + Intronic
952096138 3:29956778-29956800 TTGTTTCAGAAACGTGGCTCTGG - Intronic
953284645 3:41594827-41594849 CTGTTTCAGCTGCGCTGCTCTGG - Intronic
956718394 3:72098218-72098240 CTGCCTCAGCACCATGGCTCAGG - Intergenic
959200685 3:103242843-103242865 CTGTTTCTGCTCCGGGGGTCTGG - Intergenic
960036190 3:113105174-113105196 CAGCTTCAGCCCAGGGGCTCTGG - Intergenic
961641056 3:128365072-128365094 CTGATTCAGCACAGGGGCCACGG - Intronic
962804138 3:138915272-138915294 CTGATTCATCACCGGGACTTAGG + Intergenic
965596795 3:170418822-170418844 CTCTTTAAGCCCCGCGGCTCCGG - Intergenic
972701769 4:41501047-41501069 ATATTTCAGCATGGGGGCTCCGG + Intronic
973655580 4:53044418-53044440 CTGTCTCAGCACCTGGTTTCTGG + Intronic
976401748 4:84615007-84615029 CTGTTTCAGAAGCTGGGCTTTGG + Intronic
980133386 4:128837164-128837186 CTGTTTCTGCACCTGAGCTAGGG + Intronic
981869967 4:149474281-149474303 CTGGTTGAGCACAGTGGCTCAGG + Intergenic
982104332 4:151998444-151998466 GTTTTTCAGCACCGGGGTTCAGG - Intergenic
989443670 5:41503490-41503512 CTGTTTCAGTACCTGACCTCCGG + Intronic
992003426 5:72456303-72456325 CTGTTTCATCAGTGGGGCTACGG - Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
998092863 5:139381200-139381222 CTGTTTGAGCAGCGGGGGACAGG - Intronic
998219767 5:140267434-140267456 CTCTTTCAGCCCCCAGGCTCTGG + Intronic
999365893 5:151023174-151023196 CTGTTTCAGATGCGGTGCTCTGG + Intronic
1000729739 5:164818697-164818719 CTCTCTCAGCACTGCGGCTCTGG + Intergenic
1003466613 6:6385851-6385873 CTATTTCAGAGCTGGGGCTCTGG + Intergenic
1005212435 6:23482202-23482224 GTGTTTCAGCATACGGGCTCTGG + Intergenic
1012290533 6:97450369-97450391 CTGTGTCAGCTCCAGGGCCCAGG - Intergenic
1017759442 6:157556708-157556730 CTGTTCCAGCCCCGGGGCCTCGG - Intronic
1018206929 6:161445142-161445164 CTGTGTCAGCGCCGCGGCTTTGG - Intronic
1020912044 7:14143081-14143103 ATGTTTCAGCATGAGGGCTCTGG - Intergenic
1022053502 7:26703911-26703933 GTGCTTCAGAACCTGGGCTCTGG - Intronic
1022237675 7:28477559-28477581 CTTTTTCTGCCCCAGGGCTCAGG - Intronic
1022319818 7:29278048-29278070 GTGGTTCAGCACTTGGGCTCTGG - Intronic
1029243285 7:99179946-99179968 GGGTTTGAGCACCGGGGGTCAGG - Intronic
1029696120 7:102214440-102214462 CTGATTCAACTCCTGGGCTCAGG - Intronic
1035596163 8:859635-859657 CTGTCTCAGCACCAGGCCTCTGG + Intergenic
1035603542 8:913909-913931 ATGTCTCAGTCCCGGGGCTCCGG - Intergenic
1039111268 8:34042955-34042977 CTGTTTCTGCTCAGGGTCTCAGG + Intergenic
1048888014 8:138924282-138924304 CTGGTTCTGCACCTGGGCCCTGG + Intergenic
1049036106 8:140077513-140077535 CTGCCTCAGCCCTGGGGCTCAGG - Intronic
1055719459 9:79155510-79155532 CTGTTTCACCACCTGGGGGCAGG + Intergenic
1061570454 9:131474887-131474909 CTGCTGGAGCTCCGGGGCTCGGG - Exonic
1061606190 9:131712620-131712642 CAGTTACAGAACCTGGGCTCAGG + Intronic
1186286822 X:8053365-8053387 CTCCTTCTGCACCTGGGCTCGGG + Intergenic
1189592405 X:42529139-42529161 CTGATTCTGCACTGGGGGTCTGG - Intergenic
1191690472 X:63933512-63933534 TTGTCTCAGCACCGGTGTTCGGG + Intergenic