ID: 1161531392

View in Genome Browser
Species Human (GRCh38)
Location 19:4792120-4792142
Sequence CAGGTGGCCGGCTGCGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161531392_1161531403 8 Left 1161531392 19:4792120-4792142 CCGCCTCCGCAGCCGGCCACCTG 0: 1
1: 0
2: 4
3: 20
4: 326
Right 1161531403 19:4792151-4792173 GCGGAGCCTGCTGCGCCGCGGGG 0: 3
1: 2
2: 1
3: 18
4: 192
1161531392_1161531401 6 Left 1161531392 19:4792120-4792142 CCGCCTCCGCAGCCGGCCACCTG 0: 1
1: 0
2: 4
3: 20
4: 326
Right 1161531401 19:4792149-4792171 GTGCGGAGCCTGCTGCGCCGCGG 0: 3
1: 2
2: 1
3: 14
4: 142
1161531392_1161531405 14 Left 1161531392 19:4792120-4792142 CCGCCTCCGCAGCCGGCCACCTG 0: 1
1: 0
2: 4
3: 20
4: 326
Right 1161531405 19:4792157-4792179 CCTGCTGCGCCGCGGGGCCTCGG 0: 5
1: 1
2: 2
3: 15
4: 241
1161531392_1161531402 7 Left 1161531392 19:4792120-4792142 CCGCCTCCGCAGCCGGCCACCTG 0: 1
1: 0
2: 4
3: 20
4: 326
Right 1161531402 19:4792150-4792172 TGCGGAGCCTGCTGCGCCGCGGG 0: 3
1: 2
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161531392 Original CRISPR CAGGTGGCCGGCTGCGGAGG CGG (reversed) Exonic
900032647 1:382069-382091 CAGGTGGGCGTCTGCGGCCGGGG + Intergenic
900053405 1:611131-611153 CAGGTGGGCGTCTGCGGCCGGGG + Intergenic
901207800 1:7507378-7507400 CAGGCTGCAGGCTGGGGAGGGGG + Intronic
904556532 1:31368512-31368534 CAGGTGGCTGGCAGCAGAGCTGG - Intronic
906089280 1:43164609-43164631 CAGGTGCCCGGGTGAGGAGCAGG - Intronic
907284052 1:53369045-53369067 CAGGTGGCAGGCTCAGGAAGGGG - Intergenic
907909151 1:58811840-58811862 CAGGAGGCTGGATGGGGAGGTGG + Intergenic
908360836 1:63367477-63367499 GAGGCGGCCGGCTTAGGAGGCGG - Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
910449551 1:87331619-87331641 CTGGAGGCGGGCGGCGGAGGAGG + Intronic
910473136 1:87576907-87576929 GAGGTGGGCGGATGCCGAGGTGG - Intergenic
912627161 1:111215061-111215083 CAGATGGTCGGCGGCGGCGGGGG - Intronic
913661539 1:121009901-121009923 CTGGTGGGCGGCTCCGGACGCGG - Intergenic
915322197 1:155062207-155062229 CAGGAGGCCGGCTTAGGTGGGGG - Intronic
919972132 1:202587875-202587897 CAGGAGGCAGGCTGCGGGGTAGG + Exonic
920034660 1:203058188-203058210 CAGCTAGCTGGCTGAGGAGGAGG + Intronic
920379390 1:205526917-205526939 CAGGGATCCGGCTGCTGAGGTGG + Intronic
920912560 1:210232574-210232596 CAGGGGGCGGGCTGGGGTGGGGG + Intergenic
921051934 1:211517157-211517179 CAGGAGGGCTGCTGCAGAGGAGG + Intergenic
924436883 1:244049454-244049476 GAGGGGGCCGGCGGGGGAGGGGG + Intronic
924540039 1:244971329-244971351 GCGGTGGCCGCCTGCAGAGGCGG + Intronic
1063202198 10:3794590-3794612 CAGGTGGCTGGTAGAGGAGGAGG + Intergenic
1064982025 10:21174371-21174393 CAGGTGGGCGGCGGCTGGGGAGG + Intergenic
1066434087 10:35380740-35380762 CAGGCGGCTGGCTGCGGACTGGG - Intronic
1067487818 10:46668498-46668520 CAGAAGGCTGGCTGGGGAGGAGG - Intergenic
1070559197 10:77553072-77553094 CGGGTGGCGGGGTGGGGAGGCGG + Intronic
1071183978 10:83019479-83019501 CAGGAGGCCAGCTAAGGAGGAGG - Intergenic
1072197797 10:93131563-93131585 CAGGTGGGCGGCTGCAGACAGGG - Intergenic
1072731574 10:97850212-97850234 CAGGTGGGCGGCGGCGGTGGCGG - Intergenic
1073100461 10:101003817-101003839 CAGGTGCCCGCCTGGGGAGCTGG - Exonic
1073297719 10:102451026-102451048 CAGGTGAGCAGCTGCGGCGGCGG + Exonic
1074121688 10:110498098-110498120 CCGCTGGCCGGCGGCGGCGGCGG + Exonic
1075206403 10:120453167-120453189 CAGGTGGCGGGGTGGGGTGGCGG + Intergenic
1076184286 10:128434405-128434427 CAGGTGACGGGCTGAGGTGGTGG - Intergenic
1076701305 10:132274763-132274785 GAGGTGGCCGACTGCCGAGGAGG - Intronic
1076853586 10:133104724-133104746 CGGGGGGGCGGCTGGGGAGGCGG - Intronic
1080515460 11:33015831-33015853 CACGTGACCGGCAGCGGGGGCGG + Intergenic
1083144781 11:60750117-60750139 TAGCTGGCTGGCTGGGGAGGAGG - Intergenic
1083596220 11:63919308-63919330 GAGGGGGCCAGCTGGGGAGGGGG - Intergenic
1083694871 11:64436144-64436166 CAGGAAGCGGGCAGCGGAGGGGG + Intergenic
1083839699 11:65297200-65297222 TAGGAGGCCGGCAGCGGACGGGG + Exonic
1083920525 11:65779751-65779773 CAGCTGGCCGGCAGCTGAGGAGG - Exonic
1083983125 11:66190899-66190921 CAGGTCACAGGCTGAGGAGGCGG + Intronic
1084008830 11:66336631-66336653 CAGGAGGCCGTGTGTGGAGGTGG - Intronic
1084331584 11:68433592-68433614 CAGGTGGGCGGCTCTGGGGGAGG - Exonic
1084429174 11:69101868-69101890 CAGGTGGCCGGCTGGCCTGGTGG - Intergenic
1084774045 11:71363966-71363988 GAGGAGGCAGGCTGGGGAGGTGG + Intergenic
1085784274 11:79437645-79437667 CTGGAGGCCGGCGGGGGAGGCGG + Intronic
1088544497 11:110946028-110946050 CAGGTGGCAGGTTGGGGTGGAGG + Intergenic
1088895763 11:114077216-114077238 CAGGCTGCAGGCTGGGGAGGGGG - Intronic
1089359489 11:117876572-117876594 CAGGTAGGCGGCTGGGGAGGTGG - Exonic
1089690618 11:120184745-120184767 CACGTGTCCGGGTGGGGAGGAGG + Intronic
1090260057 11:125312982-125313004 CAGGGGGGAGGCTGCAGAGGAGG + Intronic
1090664398 11:128905291-128905313 CAGCTCTGCGGCTGCGGAGGAGG - Intronic
1090890510 11:130918747-130918769 CGGGTGGTCAGCTGTGGAGGGGG + Intergenic
1091124667 11:133083397-133083419 CGGGTCGCTGGCTGCGGAGAGGG + Intronic
1091201986 11:133788018-133788040 CAGGTGGACGGCTGCGTCTGGGG - Intergenic
1091866175 12:3839154-3839176 CAGGCGGCAGGCGGCGGCGGCGG - Intronic
1092241354 12:6838156-6838178 CAGCGGGAGGGCTGCGGAGGCGG - Intronic
1092534402 12:9374819-9374841 CAGGAGGCAGGCTGCTGGGGAGG - Intergenic
1096485855 12:51980635-51980657 CAGGTGGCTGGCTGAAGAGTTGG + Intronic
1099413379 12:82358914-82358936 CAGGTGCGTGGCGGCGGAGGCGG + Intronic
1103611022 12:122124274-122124296 CAGGGGGACGGCTGAGGTGGGGG - Intronic
1103698293 12:122834766-122834788 GAGGTGTCCGGTTGCGGAGCCGG + Intronic
1103763736 12:123268174-123268196 CAGGCGGGCAGCTGCCGAGGAGG - Intronic
1105777408 13:23676583-23676605 CAGGTGTCCTCCTGCAGAGGAGG + Intergenic
1107955690 13:45508985-45509007 CAGGTGGGAGCCTGTGGAGGTGG - Intronic
1114035073 14:18616721-18616743 GAGGTGGCAGGTTGCTGAGGTGG - Intergenic
1114123572 14:19698295-19698317 GAGGTGGCAGGTTGCTGAGGTGG + Intergenic
1114269197 14:21090945-21090967 CAGGTCGCAGGCTGCGGAGACGG + Exonic
1115399160 14:32938868-32938890 CAGGCGACCGGCGGCGGCGGCGG - Intronic
1115851234 14:37591948-37591970 CCGGGGGCCGGCGGCGGGGGCGG - Exonic
1116655974 14:47654423-47654445 CAGTTGGCCAGCAGAGGAGGTGG - Intronic
1117119603 14:52553182-52553204 CTCGCGGCCGGCTGCGGGGGCGG - Exonic
1119620938 14:76131361-76131383 GAGGGGGCGGGCTGGGGAGGGGG + Intergenic
1122094742 14:99362731-99362753 CAGCTGGCAGGGTGCGCAGGGGG + Intergenic
1122672867 14:103385526-103385548 CATGGAGCGGGCTGCGGAGGAGG - Exonic
1123145278 14:106123871-106123893 CAGGTGCACAGCTGGGGAGGAGG - Intergenic
1125665434 15:41426707-41426729 CAGGAGGCCGGCGGGGGGGGGGG - Intronic
1126376326 15:48000543-48000565 CAGGAAGCCTGCTGGGGAGGAGG - Intergenic
1126698066 15:51342083-51342105 CAGGTGGGCGGCTGGGGGTGTGG + Intronic
1126823592 15:52528704-52528726 CAGCTGTCAGGCTGGGGAGGGGG - Intronic
1127905232 15:63371464-63371486 CAGGTGGCTGGCTGTGGCTGTGG - Intronic
1128074352 15:64816910-64816932 CAGGTGGCTGTCTGAGTAGGAGG + Intronic
1129107088 15:73317962-73317984 CAGGACGCCGGCTGGGAAGGAGG + Intergenic
1129742521 15:77996371-77996393 CTGGGGGGCGGCTGCTGAGGAGG - Exonic
1132514576 16:360181-360203 CAGGTGGGCGGGGGCGCAGGTGG - Intergenic
1132519460 16:380839-380861 CAGGTGCCCGGCAGCTGATGCGG - Intronic
1132900446 16:2251369-2251391 CGGGCGGCCGGCGGCGGAGACGG - Exonic
1133056039 16:3145906-3145928 CCGGGGGCCGGCTGCAGAGAGGG - Exonic
1133732616 16:8589902-8589924 GCGGTGGCCGGCTGGGGACGGGG - Intergenic
1136536891 16:30904723-30904745 CAGGAGGCAGGCTGCTGAGCTGG + Intergenic
1137774587 16:51044538-51044560 CAGGTGGCAGGATGCAGAGAGGG + Intergenic
1138144240 16:54594927-54594949 GAGGTGGCGGGGTGCGGCGGCGG - Intergenic
1138417042 16:56877658-56877680 CAGGCGGCCAGCTGGGCAGGGGG - Intronic
1139420037 16:66844458-66844480 CAGGTGCACGGCTGCGGGGACGG + Exonic
1139594098 16:67948192-67948214 CAGGTCCCCAGCTGCCGAGGAGG - Intronic
1139872756 16:70120622-70120644 CAGGTGGTCATCTGTGGAGGTGG + Exonic
1140190464 16:72811603-72811625 CAGGTGCCACGCTGTGGAGGTGG + Exonic
1140363021 16:74360708-74360730 CAGGTGGTCGTCTGTGGAGGTGG - Intergenic
1141667675 16:85474343-85474365 AACGTGGCAGGATGCGGAGGAGG - Intergenic
1141960679 16:87405581-87405603 GAGCAGGCCTGCTGCGGAGGTGG - Intergenic
1142549927 17:732388-732410 CGGGTGGGCGGGGGCGGAGGCGG - Intergenic
1143200713 17:5111497-5111519 CAGGTGCCCGCCCGGGGAGGGGG + Intronic
1143483404 17:7239475-7239497 CAGGCGGCCGGCGGCGCGGGGGG - Exonic
1143719459 17:8799408-8799430 CAGGTGGCCCGCGGAGGCGGTGG - Intergenic
1143917291 17:10303195-10303217 CAAGAGGCAGGCTGAGGAGGCGG - Exonic
1144729238 17:17517205-17517227 CAGGAGGCTGGATGCGGGGGCGG - Intronic
1145254588 17:21315715-21315737 CAGGTGGTGGGCTCCGGAGAAGG + Intergenic
1145322010 17:21772250-21772272 CAGGTGGTGGGCTCCGGAGAAGG - Intergenic
1147891476 17:43720585-43720607 CAGGAGGAAGGCTCCGGAGGTGG + Intergenic
1148352374 17:46950313-46950335 GAGGCGGCTGGCTGAGGAGGTGG + Intronic
1148816044 17:50329030-50329052 GAAGTGGCTGGCTGTGGAGGAGG - Intergenic
1148936232 17:51166407-51166429 CCGGGAGCCGGCGGCGGAGGAGG - Intronic
1152618498 17:81348927-81348949 CAGGTGGCCACCTGCAGTGGAGG + Intergenic
1152947293 17:83205116-83205138 CAGGTGGGCGTCTGCGGCCGGGG - Intergenic
1153329980 18:3863746-3863768 CAGGCAGCTGGCTGCAGAGGTGG - Intronic
1153596449 18:6729913-6729935 CGGGTGGCTGGCTGCGGCGCGGG - Intronic
1154253650 18:12765200-12765222 CAGGTGCCAGTGTGCGGAGGCGG + Intergenic
1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG + Intronic
1161011787 19:1962924-1962946 CAGATGGCCGTCAGCAGAGGAGG + Intronic
1161439046 19:4280109-4280131 GGGGTGGGCGGCTGCGGAGGGGG - Exonic
1161531392 19:4792120-4792142 CAGGTGGCCGGCTGCGGAGGCGG - Exonic
1161628819 19:5341047-5341069 CACGTGGGCGGCTGGGGTGGTGG + Intergenic
1161723271 19:5915144-5915166 CAGGTGGGTGGCTGCGCGGGGGG + Exonic
1162034672 19:7932548-7932570 CAGGGTGCCGGCTGCGGCGGGGG + Intronic
1162386636 19:10364099-10364121 CAGGCAGCCGCCTGCAGAGGTGG + Intronic
1165477138 19:36037491-36037513 CAGGTGTCTGGCTGCAGAAGAGG - Intronic
1166112925 19:40634079-40634101 CAGGGGTCAGGCTGCGGTGGGGG + Intergenic
1166211071 19:41306799-41306821 GAGGTGGAAGGCTGGGGAGGTGG - Exonic
1166390785 19:42407731-42407753 CGGGTGGCAGGCTGAGCAGGCGG + Exonic
1166395072 19:42433643-42433665 CATGTGGCAGGCTGTGGAGAGGG + Intronic
1166478598 19:43151009-43151031 TAGGTGGGCGGCTGCTCAGGAGG + Intronic
1167278685 19:48553943-48553965 CAGGTGCCTGGCTGGGGTGGGGG - Intronic
1167557472 19:50205305-50205327 CAGGTGGGCGGCGGCGGCGGCGG - Intronic
925171707 2:1754226-1754248 GGGGAGGCCGGCTGGGGAGGTGG - Intergenic
925714324 2:6771006-6771028 CAGGTGGATGGCTGCGCCGGGGG - Intergenic
926218958 2:10922649-10922671 CAGGTGAGGGGCTACGGAGGAGG - Intergenic
927437320 2:23078008-23078030 CAGGTGGCAGGCTGCAGAACTGG - Intergenic
927721948 2:25388765-25388787 CAGGTTGCCGGCAGCAGCGGGGG - Intronic
927887589 2:26728188-26728210 CAGGCGGGCGGCGGCGGAGGGGG + Exonic
928312410 2:30221797-30221819 CAGAAGGCAGGCTGCGAAGGTGG + Intergenic
929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG + Intronic
930096701 2:47571103-47571125 CAGGTGTCCGACTGCGGTGCGGG + Intergenic
932570138 2:72934193-72934215 CAGCTGGGAGGCTGCGGTGGCGG - Exonic
933660815 2:84925888-84925910 CTGGTGGCCAGCTGTGGAGGTGG + Intergenic
933770591 2:85741690-85741712 GAGGTGGCAGGGTGAGGAGGAGG - Intergenic
937877390 2:126835972-126835994 CCGGTGGCAGGCTGCTGAGTGGG - Intergenic
937988981 2:127651835-127651857 CAGGTTGCTTGCTGGGGAGGTGG - Exonic
938276179 2:130026132-130026154 GAGGTGGCAGGCTGCAGAGGTGG + Intergenic
938303016 2:130229383-130229405 CAGGTGGGCGGCGCCGCAGGAGG + Intergenic
938312444 2:130301929-130301951 GCGTTGGCAGGCTGCGGAGGTGG + Intergenic
938362800 2:130704589-130704611 GAGGTGGCAGGTTGCAGAGGTGG - Intergenic
938389464 2:130893568-130893590 CAGGTGCCGGGATGCTGAGGTGG + Intronic
938439188 2:131311202-131311224 GAGGTGGCAGGTTGCAGAGGTGG - Intronic
941906051 2:170716709-170716731 CAGGTGGGCGGCGGGGGCGGTGG - Exonic
942278055 2:174336804-174336826 CAGGTGGGAGGCGGCGGCGGCGG - Exonic
943060533 2:183038113-183038135 GAGGCGGCCGGCGGCGGCGGCGG - Exonic
947566679 2:231198633-231198655 CCGGGTGACGGCTGCGGAGGTGG + Exonic
948910262 2:240999130-240999152 CAAGTGGCTGGCGGCGGCGGCGG - Intronic
948991730 2:241559070-241559092 CAGGACGCCAGCGGCGGAGGTGG + Intronic
1168903216 20:1383520-1383542 AATGAGGCCAGCTGCGGAGGAGG + Intronic
1168965331 20:1894964-1894986 CAGGTGGGCAGCGGCGGGGGCGG + Intronic
1169207789 20:3749761-3749783 GTGGTGGCCGACTGCGGCGGAGG + Exonic
1172269364 20:33645022-33645044 CAGGCAGCAGGCTGTGGAGGAGG + Exonic
1173760282 20:45553778-45553800 CAGGGTGGCAGCTGCGGAGGTGG + Intronic
1173831229 20:46089870-46089892 CAGGTGGGCCGACGCGGAGGCGG - Exonic
1173885752 20:46457609-46457631 CAGGAGGCCGGCTGCGGGGGAGG - Intergenic
1174295025 20:49539709-49539731 CAGGTAGCCGGCTCTGGGGGCGG + Exonic
1174357819 20:50010093-50010115 GAGGGGGCCGGCAGCGGCGGCGG + Intergenic
1174579725 20:51563009-51563031 GAGCTGGCTGGCCGCGGAGGAGG - Intergenic
1175179128 20:57132620-57132642 CGGGTGGCAGGTTGGGGAGGTGG + Intergenic
1175727791 20:61331590-61331612 CAGGTGGCCGGGGCAGGAGGTGG - Intronic
1176088188 20:63307478-63307500 CTGGGGGCCGGCTGGGGCGGTGG - Exonic
1176266608 20:64212521-64212543 CAGGGGGCGGCCTGCAGAGGAGG + Intronic
1176310188 21:5145234-5145256 GAGGTGGCTGCGTGCGGAGGTGG - Intronic
1176662664 21:9653757-9653779 CAGGTGGGGGTCTGAGGAGGAGG - Intergenic
1178545648 21:33491351-33491373 CTGGGAGCCGGCTGCGAAGGTGG + Exonic
1178610210 21:34073416-34073438 CGGGTGCGGGGCTGCGGAGGGGG + Intronic
1179511558 21:41877207-41877229 CAGGTGGCGGGCAGGGGATGGGG - Intronic
1179800184 21:43808085-43808107 CAGGTGGGCCTCTGCAGAGGGGG - Intergenic
1179846868 21:44116802-44116824 GAGGTGGCTGCGTGCGGAGGTGG + Intronic
1179877941 21:44280889-44280911 TAGCTGGTGGGCTGCGGAGGGGG + Intergenic
1180103571 21:45601816-45601838 CAAGTGGCCGGCTGGGGAGGGGG - Intergenic
1180130671 21:45825022-45825044 CAGGTGGGCAGCTGCAGAGAAGG + Intronic
1180459193 22:15543767-15543789 GAGGTGGCAGGTTGCTGAGGTGG - Intergenic
1180801155 22:18632555-18632577 CAGATGCCAGGCTGCAGAGGTGG + Intergenic
1180852385 22:19028114-19028136 CAGATGCCAGGCTGCAGAGGTGG + Intergenic
1180996538 22:19968537-19968559 AATGTGGCCTGCTGCGGAAGGGG + Exonic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181220565 22:21362706-21362728 CAGATGCCAGGCTGCAGAGGTGG - Intergenic
1181570940 22:23767583-23767605 CGGCTGGGCGGCTGCGGGGGTGG + Exonic
1182257761 22:29050537-29050559 CAGGTGGCCCGCGGGGGCGGAGG + Exonic
1183042440 22:35192434-35192456 CAAGTGTCCGGCTGCAGAAGAGG - Intergenic
1183408330 22:37641030-37641052 CAGGTGCCCTGCTGCGGGGAAGG + Intronic
1183441364 22:37824923-37824945 CAGGTAGCCGGCAGCGAAGGTGG - Exonic
1184200378 22:42964589-42964611 CAGGTGGCTGGCATAGGAGGTGG + Intronic
1184254981 22:43281504-43281526 CAGGAGGGTGGCTGAGGAGGAGG - Intronic
1184342125 22:43891821-43891843 CAGGTAGCCGGCGCCGGAGAAGG + Exonic
1184742991 22:46439888-46439910 CAGGTGGCCTGCTCAGAAGGTGG - Intronic
1185338463 22:50281236-50281258 CAGCTGCCCGGATGAGGAGGTGG + Intronic
950497673 3:13343702-13343724 CAGGTGGCCAGCTCAGGATGTGG - Intronic
950744319 3:15074591-15074613 CCGGAGGCAGGCTGAGGAGGAGG - Exonic
951217829 3:20040857-20040879 CAGGAGGCGGGAGGCGGAGGTGG - Intronic
953535794 3:43775727-43775749 CAGCTGGCCTGGTGGGGAGGTGG + Intergenic
953801996 3:46031496-46031518 CAGGAGGAAGGCTGAGGAGGGGG + Intergenic
953908876 3:46882164-46882186 CGCGTCGGCGGCTGCGGAGGGGG + Intronic
953912192 3:46898838-46898860 CACGTAGCCGGCAGCGGCGGTGG - Exonic
954583311 3:51715236-51715258 CAGGGGGCCGGCTGAGGGTGAGG - Exonic
955769246 3:62372549-62372571 CGGGCGGGCGGCGGCGGAGGCGG - Exonic
960120918 3:113948014-113948036 CAGGTGGGCGGCTGCGGCGAGGG + Exonic
961402980 3:126660193-126660215 CAGGTGGCCAGCTCAGGACGTGG + Intergenic
961973197 3:130991880-130991902 AAGGTGGTCGGCTGAGAAGGAGG + Intronic
964118878 3:153162326-153162348 GTGGCGGCGGGCTGCGGAGGTGG - Exonic
964620711 3:158717727-158717749 CAGGAGGCTGGCTGAGGGGGCGG + Intronic
966767745 3:183478296-183478318 CAGGAGGAGGGCTGCGGAAGTGG - Intergenic
967859662 3:194141500-194141522 CAGGCTGCCGGCTGCACAGGCGG - Intergenic
967891616 3:194368048-194368070 CAGGTGCCCGCCTGAGAAGGGGG - Intronic
967930430 3:194686784-194686806 CAGCTGGGCGGCGGCGGCGGCGG - Exonic
968593983 4:1473077-1473099 CAGGTGGCAGGGTGGGCAGGTGG - Intergenic
968599041 4:1500567-1500589 CGGGTGGCGGGCTGGGCAGGTGG - Intergenic
968650828 4:1759665-1759687 CAGCTGTCGGGCTGCGGAGATGG - Intergenic
968704050 4:2069892-2069914 CAGGGGACCGGCTGTGGAGCTGG - Intergenic
968917320 4:3502242-3502264 CATGTGGCCAGCCCCGGAGGTGG - Intergenic
969763617 4:9210872-9210894 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969764220 4:9215620-9215642 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969764826 4:9220367-9220389 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969765433 4:9225111-9225133 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969766046 4:9229856-9229878 CAGGAGACCTGCTGCGGTGGGGG + Intergenic
969766659 4:9234600-9234622 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969767270 4:9239345-9239367 CAGGAGACCTGCTGCGGTGGGGG + Intronic
969767875 4:9244094-9244116 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969768477 4:9248845-9248867 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969769084 4:9253593-9253615 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969769698 4:9258339-9258361 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969770303 4:9263087-9263109 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969770920 4:9267834-9267856 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969771530 4:9272579-9272601 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969771898 4:9325380-9325402 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969772514 4:9330126-9330148 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969773131 4:9334873-9334895 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969773746 4:9339618-9339640 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969774361 4:9344363-9344385 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969774976 4:9349108-9349130 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969775591 4:9353853-9353875 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969776206 4:9358598-9358620 CAGGAGACCTGCTGCGGTGGGGG + Intronic
969776820 4:9363344-9363366 CAGGAGACCTGCTGCGGTGGGGG + Exonic
969777435 4:9368089-9368111 CAGGAGACCTGCTGCGGTGGGGG + Intergenic
971757439 4:30721345-30721367 CAGGCGGCCGGCCCCGGAGGAGG + Exonic
973945318 4:55949080-55949102 CAGAGGGCCAGCTGCGGCGGTGG + Intronic
976754680 4:88485268-88485290 CTGGTGGCCTCCTGCTGAGGTGG - Intronic
982232596 4:153222840-153222862 CAGAAGGGCGGCTGCGGGGGAGG + Intronic
985412674 4:189702424-189702446 CAGGTGGGGGTCTGAGGAGGAGG + Intergenic
985646622 5:1088039-1088061 CAGGCAGCGGGCTGGGGAGGGGG - Intronic
985680319 5:1252715-1252737 CAGGTGGGAGGCAGGGGAGGAGG + Intergenic
985994853 5:3592255-3592277 CAGGGGGCAGGCTGTGGGGGTGG - Intergenic
986074943 5:4326843-4326865 CAGGTGGAGGGCAGCAGAGGTGG - Intergenic
986074951 5:4326873-4326895 CAGGTGGAGGGCAGCAGAGGTGG - Intergenic
987132427 5:14871882-14871904 CCGGGGGCGGGCTGGGGAGGGGG + Intergenic
988143055 5:27267417-27267439 CAGGTCACCAGCTGCAGAGGGGG - Intergenic
989338650 5:40349064-40349086 CAGGTGGGTGGCAGCTGAGGTGG - Intergenic
990458520 5:56012278-56012300 AAGGTGGCAGGCTGCGGAGGTGG + Intergenic
991189530 5:63853270-63853292 CAAGTGGGCGGGTGGGGAGGAGG + Intergenic
993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG + Exonic
997013422 5:129904709-129904731 TAGGCGGCCGGCTGCGGCCGCGG + Exonic
998386491 5:141760149-141760171 CAGGTGGCAGGGGGCTGAGGAGG + Intergenic
998819233 5:146043082-146043104 CAGATGGCCAGCTTCTGAGGAGG - Intronic
999733467 5:154493594-154493616 CGGGAACCCGGCTGCGGAGGAGG - Intergenic
1000318858 5:160118593-160118615 CAGGTGGGCGCCTGCGGGGCAGG - Intronic
1002741173 5:181436799-181436821 CAGGTGGGCGTCTGCGGCCGGGG - Intergenic
1002854673 6:1026409-1026431 CAGGTGTCCCGCTGAGGAAGTGG - Intergenic
1003098051 6:3157461-3157483 CATGGTGCCGGCTGCGGAGCGGG + Exonic
1003242781 6:4358941-4358963 AAGGTGGCAGGCTGCGGTGGGGG + Intergenic
1004193910 6:13487439-13487461 CAGGAGGCCGGCTAAGGATGCGG + Exonic
1005838204 6:29723602-29723624 CAGGGAGCCGCCTCCGGAGGAGG + Intronic
1006239502 6:32665109-32665131 CAGGGCGGCGGCTGCGGGGGCGG - Intronic
1006654031 6:35575193-35575215 AAGGAGGCTGGCTGAGGAGGGGG + Exonic
1006910984 6:37563450-37563472 TTGGAGGCCGGCTGAGGAGGAGG - Intergenic
1007584258 6:42979048-42979070 CCCGTGGCCGGCGGCGGAGCTGG - Exonic
1007615893 6:43179662-43179684 CAGGGGGCCAGCTGGGGAGATGG + Exonic
1009197189 6:60701254-60701276 CTGGTGGCTGGCTGCGAAGAGGG + Intergenic
1012314333 6:97767201-97767223 CAGGGGGCAGGGTGGGGAGGGGG - Intergenic
1013589082 6:111605227-111605249 CTGGAGGGCGGCTGCGGAGAGGG + Intronic
1013667960 6:112367120-112367142 CAGGTGGCCGGCGGCAGAGGCGG + Intergenic
1017103274 6:150866331-150866353 CCGGCGGCCGGCTGCGCACGTGG - Intronic
1018986387 6:168640358-168640380 CATGGGGCAGGCTGCGGCGGGGG + Intronic
1019137802 6:169922195-169922217 CTGGTGTCCGGCTTAGGAGGTGG + Intergenic
1019246288 6:170712496-170712518 CAGGTGGGCGTCTGCGGCCGGGG - Intergenic
1019279675 7:193417-193439 CGCGTCGCCGGCGGCGGAGGAGG - Exonic
1019442980 7:1056675-1056697 GAGGAGGCCGGCTGCGGGAGTGG - Intronic
1020006212 7:4784953-4784975 CAGGCGGCCGGCAGAGGAGGTGG - Exonic
1023545716 7:41316005-41316027 CATGGGGCAGGCTGGGGAGGGGG + Intergenic
1023821644 7:43983936-43983958 CAGGGGGCAGGCTGGGGAGAGGG + Intergenic
1024048671 7:45602353-45602375 CAGGCTGCAGGCAGCGGAGGAGG - Intronic
1024471649 7:49773409-49773431 TCTGCGGCCGGCTGCGGAGGTGG + Intergenic
1026833325 7:73623130-73623152 CAGCTGGGCGGCTGCGGTTGGGG + Intronic
1028762355 7:94509960-94509982 CAGGTGGCGGCCTGGGGAGCTGG + Exonic
1029736848 7:102469815-102469837 CTGCTGGCCGGCTGCGAGGGCGG + Exonic
1029749904 7:102537355-102537377 CAGGGGGCAGGCTGGGGAGAGGG + Intergenic
1029767854 7:102636461-102636483 CAGGGGGCAGGCTGGGGAGAGGG + Intronic
1032091920 7:128915413-128915435 CAGGTGCCCGGGAGCAGAGGCGG - Intergenic
1032174400 7:129611905-129611927 CAGGGTGCCGGCTGCGGGGCGGG - Intronic
1032488293 7:132305017-132305039 CAGGGGTCCTGCTGCGCAGGAGG - Intronic
1033299937 7:140176670-140176692 CGGGCGGCCGGCGGCGGCGGCGG + Intronic
1033570916 7:142627450-142627472 CAGGGGGCCCGCTGGGGCGGAGG - Intergenic
1035284882 7:157799749-157799771 GAGGGGGCCGGCTCGGGAGGTGG - Intronic
1035501784 8:95193-95215 CAGGTGGGCGTCTGCGGCCGGGG + Intergenic
1035606044 8:930290-930312 CTGGTGGCCGGCAGAGCAGGTGG - Intergenic
1036273759 8:7332602-7332624 CAGGAGACCTGCTGCGGTGGGGG + Intergenic
1036274340 8:7337330-7337352 CAGGAGACCTGCTGCGGTGGGGG + Intergenic
1036347587 8:7977748-7977770 CAGGAGACCTGCTGCGGTGGGGG - Intergenic
1036781606 8:11651651-11651673 CACGTGGCGGGGTGTGGAGGCGG - Intergenic
1036842335 8:12133772-12133794 CAGGAGACCTGCTGCGGTGGGGG - Intergenic
1036842895 8:12138523-12138545 CAGGAGACCTGCTGCGGTGGGGG - Exonic
1036863611 8:12375309-12375331 CAGGAGACCTGCTGCGGTGGGGG - Intergenic
1036864175 8:12380027-12380049 CAGGAGACCTGCTGCGGTGGGGG - Intergenic
1037876574 8:22551666-22551688 CTGGTGGCCCCCTGCCGAGGAGG - Intronic
1037887452 8:22602336-22602358 CAGGTGGTGGGCTGGGGTGGGGG + Intronic
1038151064 8:24942521-24942543 CAGGTGGCCGCGCCCGGAGGAGG - Intergenic
1038230176 8:25692235-25692257 CAGGTGGCAGGCTACGTAGAAGG + Intergenic
1039454297 8:37697299-37697321 CAGGGCCGCGGCTGCGGAGGCGG - Exonic
1039996859 8:42541686-42541708 CACGCTGCCGGCTCCGGAGGCGG - Intronic
1040564911 8:48556421-48556443 CAGGGGGTCGGCCGCGGAGGCGG - Intergenic
1040816659 8:51515133-51515155 CAGGTGGATGCCTGCTGAGGAGG + Intronic
1041181358 8:55252475-55252497 CGGGTAGCTGGCTGGGGAGGAGG + Intronic
1043566781 8:81558004-81558026 CAGGAGGCCAGCTGGGGAAGAGG + Intergenic
1047521999 8:125602101-125602123 CAGGAGGCCTGCTGCTGAAGGGG + Intergenic
1048244138 8:132775389-132775411 GGGCTGGCCGGCGGCGGAGGCGG + Exonic
1049621294 8:143599466-143599488 CAAGTGCCTGGCTCCGGAGGAGG + Exonic
1049682053 8:143923649-143923671 CCGGCGGGCGGCTGAGGAGGCGG - Exonic
1049725297 8:144142924-144142946 CAGGCAGCTGGCTGGGGAGGCGG + Intergenic
1050263232 9:3863006-3863028 CAGTTGGCCAACTGCAGAGGGGG + Intronic
1053273260 9:36764881-36764903 CAGGTGGCAGGTGGCGCAGGTGG + Intergenic
1059903859 9:118959673-118959695 CAGGTGGCATGCTGTGGTGGGGG - Intergenic
1060207048 9:121688280-121688302 CAGGAGGCCCTCTGTGGAGGTGG + Intronic
1060917101 9:127397879-127397901 GAGGCGGGCGGCTGCTGAGGAGG - Intronic
1061262735 9:129488855-129488877 CAGGCGGCCGGCTTCGAAGCCGG - Intergenic
1061591480 9:131600499-131600521 CAGGAGGCAGGCTGGGCAGGTGG + Intronic
1062128483 9:134879838-134879860 CAGGTGGCAGGGTGCGGTGGTGG + Intergenic
1062288083 9:135782337-135782359 GAGGTGGACGGCAGGGGAGGTGG - Intronic
1062411876 9:136429866-136429888 GAGGGGGCCGGCCCCGGAGGAGG + Intronic
1062686255 9:137814973-137814995 CAGGTTGGAGGCTGCTGAGGAGG + Intronic
1062716685 9:138014022-138014044 CGGGTGGCCGGCTGAAGAGCTGG - Intronic
1203607052 Un_KI270748v1:67879-67901 CAGGTGGGCGTCTGCGGCCGGGG - Intergenic
1203669917 Un_KI270755v1:562-584 CAGGTGGGGGTCTGAGGAGGAGG - Intergenic
1189234446 X:39476742-39476764 GAAGAAGCCGGCTGCGGAGGGGG + Intergenic
1190152069 X:47957205-47957227 GAGGTGGCCCGCTTGGGAGGAGG - Intronic
1192220984 X:69197200-69197222 CAGGTGGCTGGCGGGGGAGCTGG - Intergenic
1197772091 X:130095662-130095684 CCTGTGGCCAGCTGCGGAGAAGG + Intronic
1200057283 X:153468292-153468314 CAGGCCGCAGGCTGAGGAGGGGG + Intronic
1200138708 X:153886778-153886800 CAGGTGGGCGGCAGGGTAGGAGG + Intronic