ID: 1161532877

View in Genome Browser
Species Human (GRCh38)
Location 19:4800715-4800737
Sequence CGCCGCCCCCATGGAATTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161532867_1161532877 5 Left 1161532867 19:4800687-4800709 CCCTATGGCTTTGCCAGACCCCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1161532877 19:4800715-4800737 CGCCGCCCCCATGGAATTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1161532868_1161532877 4 Left 1161532868 19:4800688-4800710 CCTATGGCTTTGCCAGACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1161532877 19:4800715-4800737 CGCCGCCCCCATGGAATTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1161532866_1161532877 6 Left 1161532866 19:4800686-4800708 CCCCTATGGCTTTGCCAGACCCC 0: 1
1: 0
2: 1
3: 14
4: 148
Right 1161532877 19:4800715-4800737 CGCCGCCCCCATGGAATTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1161532871_1161532877 -8 Left 1161532871 19:4800700-4800722 CCAGACCCCGGGTGCCGCCGCCC 0: 1
1: 0
2: 2
3: 28
4: 337
Right 1161532877 19:4800715-4800737 CGCCGCCCCCATGGAATTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161532877 Original CRISPR CGCCGCCCCCATGGAATTGC AGG Exonic
902084840 1:13850951-13850973 CTCCGCCCCTATGGTTTTGCAGG - Intergenic
902716924 1:18279486-18279508 CGCCACCCCCATAGAACAGCAGG + Intronic
904353484 1:29923937-29923959 CTCAGCCCCCATGGAATTAAAGG - Intergenic
905137147 1:35808407-35808429 CGCCGCCGCCATGGAGGCGCTGG + Exonic
910423854 1:87099984-87100006 CCCTGCCCCCATGGCTTTGCAGG + Intronic
912502272 1:110130339-110130361 CCCCGCCCCCAGGGAGCTGCGGG - Intergenic
913352372 1:117875636-117875658 CCCCACCCCCATGGCTTTGCTGG - Intronic
917967044 1:180185443-180185465 CGCAGCCCTCATGGAAGGGCCGG - Intronic
922179105 1:223219670-223219692 CACTGCCCCCATGGCTTTGCTGG - Intergenic
923372574 1:233328019-233328041 AGCTGCCCCCATGGCTTTGCGGG + Exonic
924902129 1:248412146-248412168 CTCCGCCCTTATGGAATTGCTGG - Intergenic
1062904385 10:1169957-1169979 CGACACCCCCATGGAAATGCCGG - Intergenic
1074008995 10:109457274-109457296 CACGACCCCCATGGAATCGCTGG + Intergenic
1076990739 11:272235-272257 CGCCTCCCCCATGAAGCTGCTGG - Intergenic
1081011095 11:37812795-37812817 AGCCGCCCCTATGGAGTTGGCGG - Intergenic
1086964938 11:93017938-93017960 CACTGCCCCCATGGTTTTGCTGG + Intergenic
1091285224 11:134405135-134405157 TGCCACCCCCGTGGAGTTGCTGG - Intronic
1091963024 12:4714745-4714767 CCCCTCTCCCATGGATTTGCGGG + Intronic
1095544081 12:43344739-43344761 CTCCACCCCCATGGCTTTGCAGG + Intergenic
1104464042 12:128976247-128976269 CAGCGCCCCCAGGGGATTGCAGG - Intronic
1105650478 13:22371953-22371975 CTCCGCCCCTATGGCTTTGCAGG + Intergenic
1108885719 13:55178757-55178779 CTCTGCCCCTATGGCATTGCAGG - Intergenic
1112568159 13:100569025-100569047 CTCCGCCCCTATGGCTTTGCAGG + Intronic
1112882409 13:104123646-104123668 CTCCGCCCCTATGGCTTTGCAGG - Intergenic
1116756770 14:48958035-48958057 AGCTGCCCCCATGGCTTTGCTGG - Intergenic
1117305364 14:54468560-54468582 CCCTGCCCCCATGGCTTTGCTGG - Intergenic
1123049442 14:105533643-105533665 CGTCGCCCCCACGGGATTGTAGG - Intergenic
1123125229 14:105941358-105941380 GGCCGCCCCCAGGGCATTCCTGG + Intergenic
1135698036 16:24607416-24607438 CGCCACCACCATGGCACTGCAGG - Intergenic
1143213079 17:5203732-5203754 CGGCCCCCCCATGGCTTTGCTGG - Intergenic
1151113657 17:71707679-71707701 CTGCGCCCTCCTGGAATTGCAGG + Intergenic
1153138211 18:1941780-1941802 CCCTGCCCCCATGGCTTTGCTGG - Intergenic
1161532877 19:4800715-4800737 CGCCGCCCCCATGGAATTGCAGG + Exonic
1165349702 19:35269092-35269114 CGCCCCCCCCATGGACATGCTGG + Exonic
1166677173 19:44747494-44747516 CCCCGCCCCCAGGGAAATCCGGG + Intergenic
1167415031 19:49365541-49365563 CTCTGCCCCCATGGACTTCCGGG + Exonic
1168614484 19:57826766-57826788 GGCCGCCGCCATGGGAGTGCAGG - Intronic
931204015 2:60129638-60129660 CGCTGGCCCTATGGAAGTGCTGG - Intergenic
934464224 2:94244645-94244667 CTCAGCCCTCATGGAATTGTTGG + Intergenic
936788615 2:116124367-116124389 CGCCGCCCCTGTGGCTTTGCAGG - Intergenic
936837160 2:116722664-116722686 CTCCGCCCCTATGGCTTTGCAGG + Intergenic
939137568 2:138315321-138315343 CTCTGCCCCCATGGCTTTGCAGG + Intergenic
940372485 2:152918488-152918510 CCCTGCCCCCATGGCTTTGCTGG - Intergenic
942367029 2:175238919-175238941 CTCTGCCCCCATGGCTTTGCAGG + Intergenic
946404001 2:219483364-219483386 TGCCACCCCCATGGACTGGCAGG + Exonic
947800859 2:232927987-232928009 CGCCGACCCTATGGAGCTGCTGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1171345153 20:24460245-24460267 TGCCACCCCCATGAAGTTGCGGG + Intergenic
1171935845 20:31274355-31274377 CTCTGCCCCCATGGACTTCCGGG + Intergenic
1173801567 20:45897757-45897779 CTCATCCCCCATGAAATTGCAGG - Exonic
1178506538 21:33167451-33167473 CGGTGGTCCCATGGAATTGCAGG - Intronic
1183984843 22:41563647-41563669 CGCCACCCTCAAGGAATGGCTGG + Intronic
953981017 3:47412993-47413015 CTCCTCCTCCCTGGAATTGCTGG + Exonic
962296926 3:134198880-134198902 CACCGCCCCCATGCCATTACTGG - Intronic
963778513 3:149464102-149464124 CGCAGCCGCCATGGGAGTGCAGG - Intergenic
968349002 3:198036693-198036715 CGCCTTCCCCATGAAATTGACGG + Intronic
968958556 4:3731081-3731103 CCTGGCCCCCAGGGAATTGCAGG - Intergenic
969339153 4:6529548-6529570 CTGTGCCCCCATGGAAGTGCTGG + Intronic
969993000 4:11283600-11283622 CTTTGCCCCCGTGGAATTGCAGG + Intergenic
971248772 4:24954229-24954251 CCCTGCCCCCATGGCTTTGCTGG + Intronic
978451020 4:108833995-108834017 GGCCGCTCTCATGGAATTGTAGG + Intronic
985826710 5:2197345-2197367 CTCGGCTCCCATGGAATGGCAGG - Intergenic
987701615 5:21407103-21407125 CATGGTCCCCATGGAATTGCGGG - Intergenic
989719331 5:44505327-44505349 CCCCACCCCCATGGCTTTGCTGG - Intergenic
991535974 5:67669620-67669642 CTCTGCCCCCATGGCTTTGCAGG - Intergenic
995132804 5:108647991-108648013 CTCTGCCCCCATGGCTTTGCAGG - Intergenic
996196402 5:120611952-120611974 CTCCGCCCCCATGGCTGTGCAGG - Intronic
996526810 5:124488905-124488927 CTCTGTCCCCATGGATTTGCAGG + Intergenic
997585049 5:135039139-135039161 CCCACCACCCATGGAATTGCTGG - Intronic
997817534 5:137033438-137033460 CCCAGCCCCCAAGGAAATGCAGG + Intronic
1000492084 5:161926297-161926319 CTCCGCCCACGTGGATTTGCAGG - Intergenic
1020470174 7:8526091-8526113 CTCTGCCCCCATGGCTTTGCAGG - Intronic
1020611242 7:10400977-10400999 CTCCACCCCCATGGCTTTGCAGG + Intergenic
1022723016 7:32957564-32957586 CGCCGCCCCGATGGCGTTCCGGG + Exonic
1023687698 7:42753318-42753340 GGCTGCCCCCAAGGAGTTGCAGG - Intergenic
1024500902 7:50104614-50104636 CTCCTCCCCCATGGTATTGTGGG - Intronic
1030085306 7:105810723-105810745 CGCCGCCCCCATGCCATCCCCGG - Intronic
1031407573 7:121405075-121405097 CGTTGCCACCATGGAATTCCTGG - Intergenic
1031534187 7:122913726-122913748 CGCCTCACCGATTGAATTGCAGG + Intergenic
1039168509 8:34714392-34714414 CGCCACCCTCATGGTTTTGCAGG + Intergenic
1039309287 8:36298034-36298056 CTCCGCCCCCATTGCTTTGCAGG - Intergenic
1041968696 8:63711954-63711976 CTCTGCCCCCATGGCTTTGCAGG - Intergenic
1043495621 8:80797182-80797204 CTCTGCCCCCATGGCATTCCTGG + Intronic
1044303987 8:90616908-90616930 CTCCACCCCCATGGCTTTGCAGG - Intergenic
1046176522 8:110582469-110582491 CTCCGCCCCTATGGCCTTGCAGG + Intergenic
1049549892 8:143252370-143252392 CCATGCCCCCATGGCATTGCTGG + Intronic
1051898249 9:22010602-22010624 TGCCACCACCATGGAAGTGCTGG + Intronic
1052193473 9:25684151-25684173 CTCTGCCCCCATGGCACTGCAGG - Intergenic
1052969375 9:34367696-34367718 CTCCACCCCTATGGCATTGCAGG + Exonic
1055273641 9:74589731-74589753 CGCCTCCCCCAGGGACTTTCTGG + Intronic
1056840955 9:89997623-89997645 ATCTGCCCCCTTGGAATTGCAGG - Intergenic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1059452115 9:114377017-114377039 GGCAACCCCCATGGAATTCCAGG - Exonic
1188528132 X:31107932-31107954 CCCTGCCCCCATGGCTTTGCTGG - Intronic
1191586568 X:62833770-62833792 CCCAGCCCCCATGGCTTTGCTGG + Intergenic
1191742285 X:64448837-64448859 CACCACCCCCATGGTTTTGCAGG + Intergenic
1192270493 X:69575014-69575036 CTCTGCCCCCATGGCTTTGCAGG + Intergenic
1193772588 X:85605471-85605493 CTCCACCCCCATGGCTTTGCTGG + Intergenic
1195823611 X:108973074-108973096 CGCCGCCCCTGTGGCTTTGCAGG - Intergenic
1197223212 X:123932750-123932772 CTCCACCCCCATGGCTTTGCAGG - Intergenic
1199243527 X:145575581-145575603 CGCCACCCCTGTGGATTTGCAGG - Intergenic