ID: 1161535689

View in Genome Browser
Species Human (GRCh38)
Location 19:4817463-4817485
Sequence GGTGCACTCCACTGGGTAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161535675_1161535689 26 Left 1161535675 19:4817414-4817436 CCGGCTCCAGAATAGGCAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1161535689 19:4817463-4817485 GGTGCACTCCACTGGGTAGTTGG 0: 1
1: 0
2: 0
3: 3
4: 69
1161535683_1161535689 -9 Left 1161535683 19:4817449-4817471 CCTGCAGACCCCTCGGTGCACTC 0: 1
1: 0
2: 2
3: 12
4: 126
Right 1161535689 19:4817463-4817485 GGTGCACTCCACTGGGTAGTTGG 0: 1
1: 0
2: 0
3: 3
4: 69
1161535677_1161535689 20 Left 1161535677 19:4817420-4817442 CCAGAATAGGCAAGGGGAGAGAC 0: 1
1: 0
2: 0
3: 18
4: 206
Right 1161535689 19:4817463-4817485 GGTGCACTCCACTGGGTAGTTGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161535689 Original CRISPR GGTGCACTCCACTGGGTAGT TGG Exonic
905207790 1:36352815-36352837 GGTGGGCTCCAGAGGGTAGTGGG + Intronic
905614819 1:39388593-39388615 GAGGCCCTCCAGTGGGTAGTGGG + Exonic
905805909 1:40877512-40877534 GGTGGACACCACTGGAAAGTGGG + Intergenic
906542756 1:46600655-46600677 GTTCCACCCCACTGGGTAGGAGG + Intronic
921433066 1:215084731-215084753 TGTGCATTCCTCTGTGTAGTAGG + Intronic
922682264 1:227610488-227610510 GGTGAACTACACTGGGTATGTGG - Intronic
923791114 1:237112008-237112030 AGTGCACCCTAGTGGGTAGTTGG + Intronic
1062864391 10:838862-838884 GATGCACTTCAGTGGGTAGATGG + Intronic
1062908398 10:1195304-1195326 GGTGCAGTCCCATGGGGAGTGGG + Intronic
1064392352 10:14953014-14953036 GATTGACTCCACAGGGTAGTGGG + Intronic
1067456420 10:46422458-46422480 GGTGCACTGCTCTGTGGAGTGGG - Intergenic
1067630780 10:47962181-47962203 GGTGCACTGCTCTGTGGAGTGGG + Intergenic
1067975905 10:51025016-51025038 GGTCCAATCAACTGGGTAGCTGG - Intronic
1073424365 10:103447308-103447330 CGTGCCTTCCACTGGGAAGTTGG + Exonic
1077911662 11:6577256-6577278 GTTGGAATCCTCTGGGTAGTTGG - Intronic
1084208087 11:67607498-67607520 TGCGCTCTCCACTGGGTCGTGGG + Intronic
1086872282 11:92052853-92052875 GCTGTACTCCTCTGGGTTGTTGG - Intergenic
1087544423 11:99566151-99566173 GGTGCCCTCCTCTTGGTAATGGG + Intronic
1089760651 11:120720597-120720619 GGTGCACAGCCATGGGTAGTTGG + Intronic
1093512138 12:19942011-19942033 TGTGCACTCAACTGTGTGGTGGG + Intergenic
1101234557 12:102775534-102775556 GGTTCACTTCACTGGGTGGAGGG - Intergenic
1102033806 12:109759699-109759721 GGTGCTCCCCACTGTGTACTGGG - Intronic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1106982992 13:35312249-35312271 GATGCATTCCACTGAGTGGTGGG + Intronic
1114184544 14:20390525-20390547 GCAGCACACCACTGGGTAGGGGG + Intronic
1116474795 14:45327035-45327057 GGTCCAGTCCACTGGGAAATGGG - Intergenic
1118633337 14:67725701-67725723 GGTGCACTCTGCTGGGCACTAGG - Intronic
1130217565 15:81986689-81986711 GGTGGACCCCACTTGGTACTGGG - Intergenic
1137731702 16:50694544-50694566 GGGGCTCTGCACTGGGTAGGAGG - Intronic
1139113017 16:63915630-63915652 GGTGCACTGCACTGAGTACTGGG + Intergenic
1140664765 16:77217326-77217348 TGTGCTCTCCTCTGGGTAGTAGG - Intergenic
1143602974 17:7961196-7961218 GGTGCACACCTCTGGGAGGTAGG + Intergenic
1151618290 17:75229051-75229073 GGTGCACTTCACTGGGAGTTGGG + Intronic
1161535689 19:4817463-4817485 GGTGCACTCCACTGGGTAGTTGG + Exonic
1165066799 19:33234325-33234347 GGTGCAGTGCACGGGGGAGTGGG - Intergenic
926918704 2:17917982-17918004 GGTCAAATCCACTGGGCAGTTGG + Intronic
929551718 2:42897494-42897516 AGTGCACTCACCTGGGAAGTCGG + Intergenic
930021372 2:47004004-47004026 GGTGGACTTCACTGGGAAGGAGG + Intronic
937302493 2:120851857-120851879 GATGCCCCCCACTGGGTACTGGG + Intronic
937713177 2:125001611-125001633 TCTGCACTCCACTGGGGTGTTGG - Intergenic
938407175 2:131039129-131039151 GGTGCAGAGCACTGGGTGGTGGG + Intronic
938935961 2:136127711-136127733 GGGGTACTCCCCTGGGTGGTGGG - Intergenic
939710477 2:145511780-145511802 TGTGCACTTTACTGAGTAGTGGG - Intergenic
940052187 2:149476795-149476817 GGTGCACACCAGTGGGGAGGCGG - Intergenic
945721303 2:213421566-213421588 TGTGGACTCCACTGGGAATTGGG - Intronic
948809825 2:240468836-240468858 GCTGAACTCCACTGCTTAGTAGG + Intergenic
1168904558 20:1392825-1392847 GGTGCACTACACCGGTGAGTCGG - Exonic
1170121863 20:12920990-12921012 GGAGCACTCTACTGAGAAGTTGG - Intergenic
1171127046 20:22611401-22611423 GGTGAACTTCTCTGGGTAGGTGG + Intergenic
1172968402 20:38855727-38855749 GGGGCACCCCACTGGGTGGGTGG - Intronic
949165685 3:938250-938272 GGGGCCCTCCAATTGGTAGTGGG - Intergenic
953622305 3:44543597-44543619 GGTTCCCTCCACTGGGTTCTTGG + Intergenic
958627960 3:96650588-96650610 AGTACACTCCACTGGGTGGGAGG + Intergenic
968606360 4:1537560-1537582 GGTGCAGACCCCTGGGTAGGGGG + Intergenic
969406956 4:6999835-6999857 GGTGCACTCTACTGGACACTGGG - Intronic
969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG + Intronic
970133142 4:12893171-12893193 CATGCACTCCATTGGGCAGTGGG + Intergenic
984687037 4:182680635-182680657 GGGTCAATACACTGGGTAGTCGG - Exonic
985799573 5:1995718-1995740 GGTGCACTGCCCTGGGTTCTAGG - Intergenic
988681735 5:33490167-33490189 TCTGCACCCCACTGGGGAGTTGG - Intergenic
995052265 5:107719847-107719869 GGTGCATTGCACTGGGCGGTGGG - Intergenic
1003308919 6:4952082-4952104 GGTGCAGTCCATTGGGCAGGTGG - Intronic
1019733299 7:2638891-2638913 GGGGCCCGCCACTGGGAAGTGGG - Intronic
1020558016 7:9693624-9693646 GGTCCACTGCACTGGGTAAGCGG + Intergenic
1035696964 8:1605270-1605292 GGTCCACTCCCCTGAGTAGTAGG - Intronic
1045008039 8:97932945-97932967 GGTGCCCTCTCCTGGGGAGTTGG - Intronic
1045681625 8:104666903-104666925 GGTGCACTCCACTGGAAAAAGGG - Intronic
1047737124 8:127775805-127775827 GGTGCACTCACATGGGTGGTAGG + Intergenic
1050207510 9:3212682-3212704 GGTGCCCTCCCCGTGGTAGTGGG + Intergenic
1056493407 9:87130914-87130936 GGTGTAGTCCACTGTGTAGATGG - Intergenic
1188929545 X:36089521-36089543 GGTGCACTGAACTGGGTTGAAGG + Intronic
1197625605 X:128798836-128798858 GATGCACACCACTGGCTACTTGG - Intergenic
1199504678 X:148548233-148548255 GGTGAAACCCACTGGGTAGAGGG - Intronic