ID: 1161550183

View in Genome Browser
Species Human (GRCh38)
Location 19:4908563-4908585
Sequence CTCCAAGGACAGATGGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161550183_1161550189 20 Left 1161550183 19:4908563-4908585 CCTAGACCCATCTGTCCTTGGAG 0: 1
1: 0
2: 1
3: 33
4: 197
Right 1161550189 19:4908606-4908628 CAAATGTCATCTTCTCTGAGAGG 0: 1
1: 2
2: 43
3: 250
4: 934

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161550183 Original CRISPR CTCCAAGGACAGATGGGTCT AGG (reversed) Intronic
900111049 1:1005802-1005824 CCCCCAGGACAGCTGGGCCTGGG + Intergenic
900716567 1:4148838-4148860 CACCATGCACAGCTGGGTCTTGG - Intergenic
902268211 1:15284149-15284171 CACCAAGGAGAGAAGGCTCTAGG - Intronic
903459144 1:23508710-23508732 CCCCAAGGACAGAGGTGACTGGG - Exonic
909676886 1:78248717-78248739 ATCCAAAGACAGATGGCTATAGG - Intergenic
910123518 1:83816018-83816040 CTCCATGTACAGCTGGGGCTGGG - Intergenic
912765939 1:112410659-112410681 CTCTAAGGAAAGTTGGGTCTTGG + Intronic
913460103 1:119076430-119076452 GCCGAAGGACAGCTGGGTCTTGG + Exonic
913534693 1:119759868-119759890 CTCCAGGGCCAGAGGGGCCTTGG + Exonic
917283121 1:173397895-173397917 GTGAAAAGACAGATGGGTCTTGG + Intergenic
923620516 1:235575614-235575636 CTCCCAGGACAAATGAGACTGGG + Intronic
924718620 1:246602430-246602452 TTCCAAGGTCACATGGTTCTTGG + Intronic
1063786724 10:9393463-9393485 TTCCAAGCACAGAGGGGTGTGGG - Intergenic
1063946200 10:11178694-11178716 CTCCAAAGACTGATTAGTCTAGG - Intronic
1064245619 10:13665711-13665733 CTGGAAGGACAGGTGGGGCTGGG - Intronic
1065836631 10:29663976-29663998 CCCCAAGGACAGAGGGGTAGTGG - Intronic
1067177588 10:43960888-43960910 CTCCAAACACAGATGGTCCTGGG + Intergenic
1068368654 10:56085599-56085621 CTCCACTGACAGATGAGACTGGG + Intergenic
1069532606 10:69230306-69230328 CTCCAAGGCCAAATAGGCCTTGG + Intronic
1072540890 10:96397243-96397265 CTCCACGGACAGCCGGCTCTGGG - Exonic
1074248121 10:111714479-111714501 CCCCGAGGGCAGAGGGGTCTGGG + Intergenic
1076074538 10:127522768-127522790 CTCCAAGGACAGCCAGGTGTGGG - Intergenic
1076884529 10:133255650-133255672 CTCCAGGGACAGATGGGGTGGGG + Intergenic
1077308848 11:1879694-1879716 CTCCAGGGTCACCTGGGTCTAGG + Intronic
1077601120 11:3575651-3575673 GTGCCAGGACAGATGAGTCTGGG - Intergenic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1080689871 11:34547596-34547618 TTCCAAGGCCAGATAGATCTTGG - Intergenic
1081741357 11:45443248-45443270 CTCCATGCACTGATGGCTCTGGG + Intergenic
1084257038 11:67950225-67950247 GTGCCAGGACTGATGGGTCTGGG - Intergenic
1085885217 11:80513619-80513641 CTCCACGGACAGATGGACATTGG + Intergenic
1088191776 11:107235395-107235417 GGCCAAAGACAGATGGATCTTGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089625694 11:119749332-119749354 CTCCAAGGATGCAGGGGTCTAGG - Intergenic
1090097623 11:123758830-123758852 TTTCAAGGACTGATGGTTCTAGG + Intergenic
1091695898 12:2627861-2627883 CTCCTAGGACACATGGGTCACGG - Intronic
1092427270 12:8385009-8385031 GTGCCAGGACAGATGGGTCTGGG - Intergenic
1092777880 12:11959913-11959935 TTCCAAGCAGAGATGGGTCATGG - Intergenic
1093142411 12:15524567-15524589 CCTCAGGTACAGATGGGTCTGGG + Intronic
1093562902 12:20563638-20563660 CTCCAAAGACAGTTTGGTTTTGG + Intronic
1094411413 12:30171347-30171369 ATCCAATGACTGATGGGTGTTGG + Intergenic
1097703835 12:62847262-62847284 TTCCAAAGACAAATGGGTCTTGG - Intronic
1098557945 12:71840011-71840033 CTCCAAGGCCAGCTAGGCCTCGG + Intronic
1099674850 12:85745561-85745583 GAACAAGGACAGAAGGGTCTTGG - Intergenic
1101376278 12:104173933-104173955 CACAAAAGACAGATAGGTCTTGG + Intergenic
1102580892 12:113886853-113886875 GCCCAAGGACAGACGGGTCTGGG + Intronic
1103607252 12:122096547-122096569 CTCCCAGGACAGGTGTGTCTAGG + Intronic
1104953941 12:132454744-132454766 CTCCAAGGACACAGGGGTTGGGG - Intergenic
1105445963 13:20457194-20457216 TACCAAGGAAAGATGGGACTTGG - Intronic
1105743767 13:23356933-23356955 ATCCATGGACAGTGGGGTCTAGG + Intronic
1108317573 13:49252209-49252231 GTCCTAGGACACATGGGTATGGG - Intronic
1109227430 13:59713801-59713823 GTCCAAAGACATATGGATCTTGG - Intronic
1112228569 13:97565498-97565520 CTTTCAGGACAGATGGGTTTGGG - Intergenic
1112458526 13:99583259-99583281 CTCCAAGACCAGAGGGGTTTGGG + Intergenic
1113038866 13:106082726-106082748 CTCAAAGGTCAATTGGGTCTGGG - Intergenic
1113357214 13:109592287-109592309 TTCCAAGAACACATAGGTCTTGG + Intergenic
1119682699 14:76604806-76604828 CTCCCAGTTCAGATGGGGCTTGG + Intergenic
1121363749 14:93287681-93287703 CTCCAAGGAAAGAGGTGTCTCGG - Intronic
1122119528 14:99544690-99544712 CTCGGAGGAGAGATGGGTCAAGG - Intronic
1122415277 14:101546649-101546671 CTCGAAGGACAGGTAGGGCTTGG + Intergenic
1122540936 14:102497347-102497369 GTCAAAGGACAGAAGGGCCTGGG - Intronic
1123066099 14:105620215-105620237 CTCCAGGGAAAGCTGGGTCGAGG - Intergenic
1123070243 14:105639268-105639290 CTCCAGGGAAAGCTGGGTCGAGG - Intergenic
1123074833 14:105662927-105662949 CTCCAGGGAAAGCTGGGTCGAGG - Intergenic
1123089480 14:105736052-105736074 CTCCAGGGAAAGCTGGGTCGAGG - Intergenic
1123095268 14:105764212-105764234 CTCCAGGGAAAGCTGGGTCGAGG - Intergenic
1128741807 15:70088978-70089000 CTGCAAGGGCAGAGGGGCCTTGG + Intronic
1130053019 15:80499546-80499568 CTTCAAGGACAATGGGGTCTAGG - Intronic
1131985832 15:98042184-98042206 CAGGAAGGACAGATGGGTATGGG - Intergenic
1133370978 16:5245362-5245384 GTGCCAGGACAGATGGGTCTGGG + Intergenic
1134423127 16:14112832-14112854 CTCCATGGACAGAAGTGTCAGGG + Intronic
1136245671 16:28974609-28974631 CTCCAGGGACCGCAGGGTCTGGG + Intronic
1141457649 16:84154518-84154540 CTCCCAGGGCAGAGGGGTCACGG - Intronic
1142576318 17:910729-910751 AATCAAGGACAGATGGGACTGGG - Exonic
1144653738 17:17022436-17022458 CTCAGAGGACAGATGTGTCTGGG - Intergenic
1146612617 17:34320838-34320860 CCCCAAGGAGAGATGGGTCAGGG + Exonic
1147146805 17:38490261-38490283 CTCCAAGGCCACAGGGGTCGTGG - Intronic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147391541 17:40112370-40112392 CTCCAAGGTCATAGGGGTCATGG - Intergenic
1147614452 17:41819953-41819975 CTCCCAGCACAGCTGGGTCCTGG - Intronic
1147770868 17:42867089-42867111 CCCCAAGGGCAGAGGGGTCAGGG - Intergenic
1148551528 17:48553267-48553289 GGCCATGGACAGATGAGTCTCGG - Exonic
1149594424 17:57855821-57855843 CTCAAAGGAAAGCTGGGCCTGGG - Intergenic
1149813858 17:59704417-59704439 CTTAAAGGACAGAAAGGTCTAGG + Intronic
1149867033 17:60156806-60156828 CTCACAGCACAGATGGGCCTGGG - Intronic
1150128333 17:62652954-62652976 CTCCAAGAGCAGGTGGATCTGGG + Intronic
1151931395 17:77234167-77234189 CTGCAAGGCCTTATGGGTCTTGG + Intergenic
1152751205 17:82063203-82063225 CTCCCAGGACATCTGGGGCTGGG + Intronic
1155847643 18:30729652-30729674 GTCAAAGGACAGATGCTTCTAGG + Intergenic
1156041200 18:32824922-32824944 CTCCAAGGAGTCATGGGTCTTGG + Intergenic
1157098367 18:44707933-44707955 CAGCAAGGAGAGATTGGTCTAGG + Intronic
1157292051 18:46416708-46416730 CAGCTGGGACAGATGGGTCTAGG + Intronic
1159564697 18:70035411-70035433 GTCTAAGGTCAGATGGTTCTAGG - Intronic
1160390685 18:78529176-78529198 CTCCCAGAACAGAGGGATCTGGG + Intergenic
1161550183 19:4908563-4908585 CTCCAAGGACAGATGGGTCTAGG - Intronic
1161784775 19:6317410-6317432 GTCCAAGGACAGATGGGACAGGG + Intronic
1163158528 19:15451846-15451868 CTCCAAGGACGCGGGGGTCTTGG - Exonic
1164724586 19:30457638-30457660 CTCCAAGGACAGCATGGTCAGGG - Intronic
1164972583 19:32545177-32545199 CTCCATGGGCAGCTGGGTCCAGG + Intergenic
1165155609 19:33785398-33785420 GTCCTAGGTAAGATGGGTCTGGG + Intergenic
1167460990 19:49624694-49624716 CTCAAAGGACAGAGGAGGCTGGG - Intronic
1168284844 19:55325880-55325902 CTCTAGAGATAGATGGGTCTCGG + Intronic
925151982 2:1621137-1621159 CTCCAAGGACAGGTGGGAGGAGG + Intergenic
925437876 2:3856978-3857000 CTCAAAGCACACATGGGGCTTGG - Intergenic
929332808 2:40704354-40704376 CTCTAGGGACAGATGAGTTTTGG + Intergenic
929880867 2:45836567-45836589 CTCCCATGCCAGGTGGGTCTGGG + Intronic
929920536 2:46168284-46168306 CTTCAAGTGCAGGTGGGTCTGGG - Intronic
934090434 2:88546139-88546161 GTCCAAGCTCAGGTGGGTCTTGG + Intergenic
940484984 2:154287115-154287137 CTCAAAGGTCAGATGTGTCAAGG - Intronic
942085080 2:172436155-172436177 GTGCAAAGAGAGATGGGTCTGGG + Intronic
945539909 2:211072561-211072583 CTCCAATGACTGATTGGTGTGGG + Intergenic
947261336 2:228226420-228226442 CTCCAATGACAAATGGATCTAGG + Intergenic
948852824 2:240716739-240716761 CTCCATGGCCACATGGGTCCTGG - Exonic
948908972 2:240993629-240993651 CTCACTGGGCAGATGGGTCTGGG - Intergenic
1170084051 20:12509551-12509573 CACTAAGGACAGATGGGTTCAGG + Intergenic
1173029708 20:39343448-39343470 CTCCCACGACAGATGGCTGTGGG - Intergenic
1173222825 20:41143452-41143474 GTCCTAGGAGAGATGGGTGTGGG + Intronic
1173236348 20:41249546-41249568 CTCCACAGACTGATGGGCCTGGG - Intronic
1174129447 20:48332128-48332150 CTCCCATGAAAGGTGGGTCTAGG - Intergenic
1174452451 20:50628693-50628715 CTCCCAGGACAGCAGGGCCTGGG + Intronic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175916045 20:62426452-62426474 CTCCAAGGCCAGGTGGGCCCCGG - Intronic
1179766650 21:43578748-43578770 CTCCCAGGTTAGATGGGGCTAGG + Intronic
1180067089 21:45417956-45417978 CTCCCAGGAAAGACGTGTCTGGG - Intronic
1182119347 22:27776674-27776696 CTTCAAGGCGAGATGGGGCTAGG - Intronic
1183571449 22:38656432-38656454 CTCCACTGACACATTGGTCTGGG - Intronic
1184669127 22:46003617-46003639 CTCCCAGAGCAGAGGGGTCTGGG - Intergenic
950615839 3:14157571-14157593 CTCCTGGGAAAGAGGGGTCTCGG - Intronic
950750527 3:15124496-15124518 GTGCCAGGACAGATGGGTCTGGG + Intergenic
950824888 3:15808115-15808137 CTTCGGAGACAGATGGGTCTGGG - Intronic
951750348 3:26028107-26028129 CTCTGAGGACAGAAGGGACTAGG - Intergenic
952644933 3:35644588-35644610 CTCAAAGCACAGATATGTCTCGG - Intronic
954098986 3:48355136-48355158 TTCCATGGACAGAGGTGTCTAGG - Intergenic
957002526 3:74902693-74902715 CTGCTAGACCAGATGGGTCTGGG + Intergenic
957071981 3:75574704-75574726 GTGCCAGGACAGATGGGTCTGGG - Intergenic
957296126 3:78335190-78335212 CTGCAAAGACAGATGGGTAATGG - Intergenic
957765164 3:84614886-84614908 TTCCAAGCACAGCTGGATCTGGG - Intergenic
958780351 3:98533351-98533373 GTTCAAGGACAGATGGGAATTGG - Intronic
961282166 3:125772383-125772405 GTGCCAGGACAGATGGGTCTGGG + Intergenic
961650625 3:128415136-128415158 CTCCCTGGACAGCTGTGTCTTGG + Intergenic
964878673 3:161399252-161399274 CTCGAAGGTCAGATGGTTGTAGG - Intergenic
968961082 4:3744036-3744058 CCCCTAGGCCAGAGGGGTCTAGG - Intergenic
969015571 4:4102026-4102048 GTGCCAGGACAGATGGGTCTGGG - Intergenic
969738397 4:9006336-9006358 GTCCCAGGACAGATGGGTCTGGG + Intergenic
969797584 4:9537879-9537901 GTGCCAGGACAGATGGGTCTGGG + Intergenic
970155560 4:13138157-13138179 CTTCAAGGACAGAGAGATCTGGG + Intergenic
970480172 4:16464607-16464629 CTGCAAGGACTCATGGGACTTGG - Intergenic
971455134 4:26836989-26837011 CTTCAAGGCAATATGGGTCTGGG - Intergenic
972479875 4:39486983-39487005 CTCCAAGTACAGATTGCTTTTGG + Intergenic
972629440 4:40830447-40830469 CTCCAAGGTAAGGTGGGTCAGGG - Exonic
975981737 4:80168986-80169008 CTCCAAATACAGATGGGTTAGGG - Intergenic
976656918 4:87498272-87498294 TTCCAAGAACAGCTTGGTCTGGG + Intronic
977113796 4:92995022-92995044 CTCCAAGGACAGTTGTGTGTTGG - Intronic
982120379 4:152137553-152137575 CTCCATGAACAGAGGGGACTTGG + Intergenic
985520417 5:371607-371629 GGCCCAGGACAGGTGGGTCTAGG - Intronic
985834547 5:2260968-2260990 CTCCAAAGACAGATGGGAGCAGG + Intergenic
988311295 5:29561364-29561386 CTCAATAGACAGATGGGTCTTGG + Intergenic
988786052 5:34566209-34566231 CTGGAAGGTGAGATGGGTCTGGG - Intergenic
988985886 5:36618531-36618553 GTCTGAGCACAGATGGGTCTCGG + Intronic
989581170 5:43034446-43034468 CTCCAAAGACACATTGGACTCGG - Intergenic
990939346 5:61186553-61186575 CTCCAAGCACAGATGGCTTCAGG - Intergenic
996529370 5:124511692-124511714 CTCCAAGGATAAATAGGACTGGG - Intergenic
997316762 5:132942955-132942977 CTTCAAGTACACCTGGGTCTTGG + Intronic
997447627 5:133952943-133952965 CAGCTAGTACAGATGGGTCTGGG + Intergenic
998908275 5:146930277-146930299 CAACAAGGACAGATGTGTCAAGG + Intronic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
1000386212 5:160676919-160676941 CTACAAGGACAGATGAGTGATGG + Intronic
1001223632 5:169925299-169925321 ACCCTAGGACAGATGGGTCCTGG + Intronic
1003733118 6:8848406-8848428 CTCCAAAAACAGGTGGATCTTGG - Intergenic
1004442722 6:15669470-15669492 CTCCAGGCACAGTTGGTTCTTGG - Intergenic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1007180828 6:39927939-39927961 CTCCAAGGACCGATAGGTCAGGG - Intronic
1007609323 6:43139080-43139102 CTCCAGGGAGAGGTGGGTGTGGG + Intronic
1009759581 6:67986812-67986834 CTCCAAGAAAAGATTGGTCAGGG - Intergenic
1010208805 6:73346768-73346790 TTTAAAAGACAGATGGGTCTGGG + Intergenic
1010471107 6:76229683-76229705 TTCAAAAGACAGATGGGTTTTGG - Intergenic
1012567613 6:100679125-100679147 CTCAAAGGACAAAAAGGTCTTGG - Intronic
1014673087 6:124330974-124330996 TTCCATGGACAGATGGGTGTGGG - Intronic
1014895576 6:126895681-126895703 TTCAAAAGACAGATGGATCTTGG + Intergenic
1015390348 6:132674653-132674675 CTCCAAGGACTGAGTGCTCTAGG + Intergenic
1018479664 6:164177181-164177203 CTGAAAGGACAGATGGCTTTAGG - Intergenic
1019258579 7:67105-67127 CTCCAAGGACAATTGGTTCTTGG + Intergenic
1020431262 7:8118758-8118780 CTCTGGGGACAGGTGGGTCTTGG - Intronic
1022352555 7:29579545-29579567 CTCCAACTTTAGATGGGTCTGGG + Intergenic
1023168948 7:37371888-37371910 CTCCAGGGAGAGATGGGTTGGGG + Intronic
1023966746 7:44966839-44966861 CTGCAGGGACAGAGGGGACTTGG + Intronic
1025208531 7:57007780-57007802 CTGCAAGGACACATGTGTCAAGG - Intergenic
1026448473 7:70506297-70506319 CTACAAGGACAGACGTCTCTAGG + Intronic
1027185748 7:75969623-75969645 CTCAAAGGACAGATGCTTCCAGG - Intronic
1029074234 7:97923659-97923681 GTGCCAGGACAGATGGGTCTGGG - Intergenic
1029258193 7:99283683-99283705 CTCCAAGGCCAGATCCCTCTGGG + Intergenic
1029666146 7:101996477-101996499 CTCCATGGTCACATGGGGCTTGG - Intronic
1029961130 7:104690143-104690165 TGCCAAAGACAGATGGATCTTGG + Intronic
1031484049 7:122307213-122307235 GTCCCACGACAGATGGGTCGCGG + Intronic
1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG + Intergenic
1032197267 7:129796583-129796605 CTCCCAGGACAGAAGGGACAGGG - Intergenic
1033069138 7:138186062-138186084 TTCCTGGGACAGATGGGTCTGGG - Intergenic
1034143755 7:148849923-148849945 CTCCAAGGAGAAATTTGTCTAGG - Intronic
1036243476 8:7097629-7097651 GTGCCAGGACAGATGGGTCTGGG + Intergenic
1036257337 8:7216438-7216460 GTGCCAGGACAGATGGGTCTGGG - Intergenic
1036309384 8:7675034-7675056 GTGCCAGGACAGATGGGTCTGGG - Intergenic
1036360155 8:8071085-8071107 GTGCCAGGACAGATGGGTCTGGG + Intergenic
1036890812 8:12595884-12595906 GTGCCAGGACAGATGGGTCTGGG - Intergenic
1036898356 8:12653800-12653822 GTGCCAGGACAGATGGGTCTGGG - Intergenic
1037815163 8:22108182-22108204 CTCCACGGACAGCAGTGTCTCGG + Exonic
1037823376 8:22146676-22146698 CCCCAAGGTCAGCTGGGGCTGGG - Intergenic
1037832436 8:22197442-22197464 CTCCGAGGAGAGGTGGGGCTAGG - Intronic
1037953469 8:23034850-23034872 TGCCAAAGACAGATGGATCTTGG + Intronic
1039665037 8:39517017-39517039 CTCCAAACACAGATGGGACTTGG - Intergenic
1040871184 8:52101208-52101230 CTCCAGGCAGAGATGGGGCTGGG + Intergenic
1041128195 8:54666838-54666860 CTCTGAGAACAGATGGGGCTTGG - Intergenic
1047671493 8:127152052-127152074 CTCCTGGGACAGATGGGTGATGG - Intergenic
1047809101 8:128388623-128388645 CTTCAAGGACAGAGGTATCTTGG + Intergenic
1049306422 8:141906623-141906645 CGGCAAGGAGAGATGGCTCTAGG + Intergenic
1049359503 8:142205618-142205640 CTCCATGGCCACATGGCTCTGGG + Intergenic
1049377285 8:142295286-142295308 CTCCAGAGACAGATGGCACTTGG + Intronic
1049521262 8:143092603-143092625 CTCCGAGCACACCTGGGTCTGGG - Intergenic
1050427984 9:5531933-5531955 CTTCAAGGACAGATTGGATTTGG + Intronic
1051351909 9:16205155-16205177 CTCAAAGGCCAGATGGGGCCTGG + Intronic
1057039852 9:91840132-91840154 CTCCCAGGACAGCGGGGCCTCGG - Intronic
1057618763 9:96617891-96617913 CGCCGAGGACGGATGGGGCTGGG - Intronic
1058765526 9:108179311-108179333 ATTCAAGGACAGATAGGTATGGG - Intergenic
1060549946 9:124480191-124480213 CTCCTGGGAGAGATGGGTCTGGG - Intergenic
1062031094 9:134362332-134362354 CCCCAGGGAGAGATGGGACTTGG - Intronic
1062364904 9:136203885-136203907 CTGCAAGGACAGGTGGGTTCTGG - Intronic
1062587584 9:137256207-137256229 CGCCCAGGACACATGGGTCAAGG - Intronic
1062737295 9:138144438-138144460 CTCCAGGGACAGCAGGGTGTAGG + Intergenic
1186311392 X:8323338-8323360 CCCCAAAGTCAGATGAGTCTGGG - Intergenic
1187829411 X:23365661-23365683 AACCAATGACAGATGGGACTTGG - Intronic
1189847703 X:45151750-45151772 CCCCAAGGACTTCTGGGTCTGGG + Exonic
1198036735 X:132808416-132808438 CTCCCATGACACATGGGGCTGGG - Intronic
1198398828 X:136250913-136250935 CCCCAAGGGCAGATGGGGCACGG + Intronic
1201359315 Y:13129035-13129057 CTGCAAGAAGAGATGGGGCTTGG + Intergenic