ID: 1161550697

View in Genome Browser
Species Human (GRCh38)
Location 19:4910451-4910473
Sequence TCTGAAGTTCCGGCCCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 29}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161550688_1161550697 14 Left 1161550688 19:4910414-4910436 CCCTCTCAGTGGCACTTGGTTGA 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1161550697 19:4910451-4910473 TCTGAAGTTCCGGCCCGCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 29
1161550689_1161550697 13 Left 1161550689 19:4910415-4910437 CCTCTCAGTGGCACTTGGTTGAG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1161550697 19:4910451-4910473 TCTGAAGTTCCGGCCCGCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161550697 Original CRISPR TCTGAAGTTCCGGCCCGCGC TGG Intronic
904775148 1:32901605-32901627 TCTGAGGAGCCGCCCCGCGCGGG + Intergenic
912695635 1:111840044-111840066 TCTGACGATCAGGCCCTCGCTGG - Intronic
1084526653 11:69702438-69702460 TGTGAGGTCTCGGCCCGCGCAGG - Intronic
1142074383 16:88108880-88108902 TCTGAAGTCCCGACCGGGGCTGG - Intronic
1142140175 16:88469237-88469259 TCTGAAGTGCCGGCCGGGCCAGG + Intronic
1143443919 17:6996225-6996247 GCTGCAGCTGCGGCCCGCGCGGG + Exonic
1143450888 17:7036168-7036190 ACTGAAGACCTGGCCCGCGCTGG - Exonic
1145355420 17:22142162-22142184 GCTGTAGTTCAGGCCTGCGCAGG - Intergenic
1146214946 17:30971421-30971443 GCTGCAGTTCCGGGCGGCGCCGG - Exonic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1161550697 19:4910451-4910473 TCTGAAGTTCCGGCCCGCGCTGG + Intronic
1165879156 19:39030896-39030918 TCTGAAGTTCAGGCCAGCCATGG - Intronic
1167495837 19:49818354-49818376 TCCGAGGGCCCGGCCCGCGCCGG + Exonic
930027455 2:47037858-47037880 TCTGAAGTGCCAGCCCCTGCTGG + Intronic
937245180 2:120487961-120487983 CCTGAGGTGCCGGCCAGCGCGGG - Intergenic
1175383619 20:58580337-58580359 CCTGCAGTCCCGGCCCCCGCTGG - Intergenic
1176099723 20:63359411-63359433 TCTGACGTACCAGCCCGGGCCGG + Intronic
955406541 3:58629334-58629356 TCTGAAGTCCAGGCCCTGGCAGG + Intergenic
957041191 3:75336818-75336840 TCTGAAGTCCCTGCCCTCTCTGG - Intergenic
961045995 3:123708473-123708495 TCTGAAGTCCCTGCCCTCTCTGG - Intronic
985209649 4:187578891-187578913 TCTGAAGGTCCTGCCTGCTCTGG - Intergenic
996874591 5:128226934-128226956 TCTGAAGTTCGAGACCGCCCTGG - Intergenic
999748716 5:154610654-154610676 TGCGAAGGTCCGGCCCGCGGCGG - Intergenic
1006618016 6:35342835-35342857 CCTGATGCTCCGGCCCGCTCCGG + Intronic
1007576151 6:42926381-42926403 TCTGGATTTCCTGCCAGCGCTGG - Intergenic
1021724200 7:23533782-23533804 TCACAAGTTCCAGCCCACGCTGG - Intergenic
1033354081 7:140585506-140585528 TCTGGAGTTCCGGCCAGCACTGG - Intronic
1039265098 8:35815707-35815729 TGTGAAGTTCCGGCGGGGGCAGG + Intergenic
1049469045 8:142767204-142767226 TGGGAAGTTCCGGCCAGGGCAGG + Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1057205089 9:93167014-93167036 TCTGAAGTTGCTGCCGGTGCTGG + Intergenic
1192260685 X:69504586-69504608 CCTGGAGTTCCGGCTCGGGCGGG - Intergenic