ID: 1161551592

View in Genome Browser
Species Human (GRCh38)
Location 19:4915914-4915936
Sequence GGGGTTCTCAAACGGATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161551585_1161551592 12 Left 1161551585 19:4915879-4915901 CCTTACGTGCGCTGTGTTGGAGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1161551592 19:4915914-4915936 GGGGTTCTCAAACGGATTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161551592 Original CRISPR GGGGTTCTCAAACGGATTTC AGG Intronic
901302360 1:8209062-8209084 GGGGTTCTCAAAGACATCTCTGG + Intergenic
901881244 1:12195039-12195061 GTGGTTTTCAAACTGAATTCTGG + Intronic
902149711 1:14433488-14433510 GGGGTTTTGAAAGGGAATTCGGG + Intergenic
902828568 1:18994873-18994895 GGGGTTCTCAAATAGATGTCTGG + Intergenic
906019538 1:42615235-42615257 GGGGTTTTCAAACTGGTTGCTGG + Intronic
908332455 1:63084257-63084279 GGGGAACCCAAACTGATTTCAGG + Intergenic
913116978 1:115706342-115706364 GGGGTTCTCTAAGGGATTCTGGG - Intronic
913325145 1:117621560-117621582 GGGGTTCCAACATGGATTTCTGG - Intronic
916823193 1:168419891-168419913 AGGGTACTGAAAAGGATTTCAGG - Intergenic
919955747 1:202413515-202413537 GTGGTTATCAAACTGATCTCAGG + Intronic
1062792432 10:317195-317217 GGGGTTCTGGAATGGATTACTGG + Intronic
1069156430 10:65035807-65035829 GGGGTAATCAAAAGGTTTTCAGG - Intergenic
1081067472 11:38563624-38563646 GGGGTTATCAAGAGGATTGCAGG - Intergenic
1087813650 11:102634816-102634838 GGGGTTCTCAAAAAACTTTCAGG + Intergenic
1093818845 12:23586037-23586059 GGGATGTTCAAGCGGATTTCTGG - Intronic
1095183124 12:39169084-39169106 GTTGTTCTCAATCAGATTTCAGG + Intergenic
1101474948 12:105036866-105036888 GGGGTACTCAAACTGATATCAGG - Intronic
1112204103 13:97306906-97306928 TGGATTCTCAAAAGGATTTCAGG + Intronic
1115005598 14:28480101-28480123 GGGGCTCTCAAATGGATCTGAGG - Intergenic
1118354646 14:65002869-65002891 GGGGTTTTCAAACTGATTGCTGG + Intronic
1123481753 15:20638821-20638843 GGGTTCCTCAAGCGGATTACTGG - Intergenic
1123636260 15:22361544-22361566 GGGTTCCTCAAGCGGATTACTGG + Intergenic
1124583066 15:30979344-30979366 GGTGGTCTCAAACTGACTTCAGG - Intronic
1126992038 15:54389281-54389303 GTGGTTCTCAAATTGGTTTCTGG + Intronic
1131183209 15:90254582-90254604 TGGCTTCCCAAAGGGATTTCAGG - Intronic
1137733270 16:50705597-50705619 TGGTTTCTGAAACAGATTTCTGG - Intronic
1147672520 17:42184735-42184757 GGGGGTCTCAAAAGGCTTCCTGG - Intronic
1148271825 17:46267294-46267316 GGGGTTCCCAAACTGTTTTTTGG + Intergenic
1161551592 19:4915914-4915936 GGGGTTCTCAAACGGATTTCAGG + Intronic
1164907139 19:31976726-31976748 TGGGTTCTCACATGGATTTGGGG - Intergenic
934055976 2:88252176-88252198 GGGGTCCTGACAGGGATTTCAGG + Intergenic
937198855 2:120183772-120183794 GGGGTGCTCAGAGGGATATCTGG - Intergenic
942627117 2:177913010-177913032 TGGGTTCTAAAACGGATTTATGG + Intronic
1169263782 20:4155537-4155559 GGGGTTATCACACGGTTTGCTGG + Intronic
1170157507 20:13282040-13282062 GGCTTGTTCAAACGGATTTCTGG - Intronic
1172428718 20:34873340-34873362 GGGGTTTTCAAAAGGGTTTGGGG - Intronic
1177083814 21:16676843-16676865 GGGTTTCTCAAACTCAGTTCTGG + Intergenic
949124472 3:429926-429948 GGGGTTCTGAAACAAATCTCTGG + Intergenic
956844518 3:73170066-73170088 GGGGTCCTCACAAGGATTGCGGG + Intergenic
957956503 3:87195463-87195485 GGGGGTCTCAAACGGAGATGAGG + Intergenic
958720633 3:97838518-97838540 ATGTTTCTCAAACAGATTTCTGG - Intronic
959784781 3:110282894-110282916 GGGGTTCACAAAAGATTTTCTGG + Intergenic
965484549 3:169262671-169262693 TGGGTCCTCAAACTCATTTCTGG + Intronic
967078140 3:186023845-186023867 GGAGATTTCAAAAGGATTTCAGG + Intergenic
968148832 3:196321291-196321313 GGGGTTCTCAAACTCGTTTCTGG + Intronic
971961986 4:33500710-33500732 GGGGTTCTCAAGCAACTTTCAGG - Intergenic
994337438 5:98584531-98584553 GGGGTTTTCAAAATAATTTCGGG - Intergenic
998460432 5:142305912-142305934 GCTGTTCTCAAACTGATCTCAGG - Intergenic
998874732 5:146587679-146587701 GTGGTTCACAAAATGATTTCAGG + Intronic
999509124 5:152229328-152229350 GGGGTACTCAAGGGGAATTCTGG + Intergenic
999701863 5:154235504-154235526 GGAGTTCTCAAACTGTTCTCTGG + Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1018465758 6:164043252-164043274 GGGGTTATCAAACAGAATGCTGG + Intergenic
1021252703 7:18350974-18350996 GGGGTTATAAAATGTATTTCAGG - Intronic
1023270885 7:38461290-38461312 GGTGTTGTCACACTGATTTCTGG + Exonic
1032927317 7:136622243-136622265 GAGGTTTTCAAACAGTTTTCAGG - Intergenic
1040095638 8:43439845-43439867 GGGGGTCCCAAACAGGTTTCTGG - Intergenic
1040397658 8:47014822-47014844 AGAGTTCCCAAACGGTTTTCGGG + Intergenic
1041995665 8:64054303-64054325 ATGGTTCTCAAACGTATTTAGGG - Intergenic
1045716829 8:105056606-105056628 GAGGTTCTCAAGGGGGTTTCAGG - Intronic
1186447109 X:9640400-9640422 CTGCTCCTCAAACGGATTTCAGG - Intronic
1187386430 X:18852777-18852799 AGTGTTCTCAAACTGATTTATGG - Intergenic
1189416285 X:40817078-40817100 GGGGACCTCACACGCATTTCAGG - Intergenic
1190815194 X:53923605-53923627 GGGGTTCTGTAACATATTTCTGG + Intergenic
1202578861 Y:26357665-26357687 GTGGTTATCAAACTGATCTCAGG - Intergenic