ID: 1161552829

View in Genome Browser
Species Human (GRCh38)
Location 19:4923611-4923633
Sequence CAGCTGCCCCTCTGCGCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161552826_1161552829 16 Left 1161552826 19:4923572-4923594 CCGCTCTGGCAGATATCGCTGCT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1161552829 19:4923611-4923633 CAGCTGCCCCTCTGCGCACGTGG 0: 1
1: 1
2: 1
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161552829 Original CRISPR CAGCTGCCCCTCTGCGCACG TGG Intronic
900166386 1:1245746-1245768 CGGCTGCCTCTCAGCCCACGCGG - Intronic
900225985 1:1533904-1533926 CAGCTGCCTCTCTCCCCACTAGG + Exonic
900621617 1:3590226-3590248 CATCTGCCACTCTGCCCACCGGG + Intronic
900880789 1:5379925-5379947 CAGCAGCTCCTCTGAGCACGTGG + Intergenic
901229545 1:7634187-7634209 CACCTGCTCTCCTGCGCACGTGG - Intronic
901317278 1:8317745-8317767 CGGCTGCCCCACTGCGCACATGG + Intergenic
901490554 1:9594385-9594407 CAGCTGCCCCTGTGGGCCCTGGG + Intronic
901660111 1:10794011-10794033 CAGCGCCCCCTCCGGGCACGTGG + Intronic
902271662 1:15309386-15309408 CCTCTGCCCCTCTGCTCATGGGG + Intronic
902349996 1:15847508-15847530 CAGCTGCGCGCCTGCGCACCGGG + Intergenic
903674447 1:25055341-25055363 CAGCAGTCCCTCCCCGCACGCGG + Intergenic
904199862 1:28812556-28812578 CAGCAGCCCCACGGCGCACACGG - Exonic
905231591 1:36517838-36517860 CAGCCTCCCCTCTGTGAACGGGG + Intergenic
906325422 1:44842842-44842864 CAGCTCCCCCTCTACTCACCTGG + Exonic
907267343 1:53270996-53271018 GAGCTGCCCCTCTGCCCTTGGGG + Intronic
907310212 1:53534781-53534803 CAGCTGCCCCTCTGTGTGCCTGG + Intronic
909336519 1:74480949-74480971 CAGCAGCCCCTATGACCACGAGG - Exonic
920040932 1:203096734-203096756 CAGCTGCCTCTCTGAGCTCTGGG - Intronic
923045289 1:230351027-230351049 CAGCTCCCGCTCTGTGCACGTGG + Exonic
1063109303 10:3020733-3020755 CAGCTGCTCCTCTGGGAACCAGG + Intergenic
1063111748 10:3044189-3044211 CAGCTGCCCTCATGCTCACGGGG - Intergenic
1064354326 10:14604091-14604113 CCGCTGCCCTCCCGCGCACGGGG + Intronic
1064425001 10:15222762-15222784 CAGCCGCTCCTCTGCTCACATGG + Intronic
1067093964 10:43286227-43286249 CAGCTGCCCCACTGCCCTCAAGG - Intergenic
1067419430 10:46133760-46133782 CAGCTGCCCCAGTGCCCACCTGG + Intergenic
1067467315 10:46510757-46510779 CAGCGGCTCCTCTGAGCACCCGG - Intergenic
1067504781 10:46840357-46840379 CAGCTGCCCCAGTGCCCACCTGG + Intergenic
1067619871 10:47873848-47873870 CAGCGGCTCCTCTGAGCACCCGG + Intergenic
1067821953 10:49538671-49538693 CAGCTGACCCTGCGCGCAGGGGG + Intronic
1070153532 10:73819626-73819648 TAGCTGCCCCGCTCCGCACTGGG - Exonic
1076379243 10:130014007-130014029 CAGCTGCCCCACTGGGGACCAGG + Intergenic
1076615276 10:131750692-131750714 AATCTGCCCCTCAGCGCACTGGG + Intergenic
1077043930 11:536055-536077 CGGCTGCCCTTCCGCGCAGGTGG + Intronic
1077106141 11:843389-843411 CAGACGCGCCTCTGAGCACGGGG + Intronic
1077233015 11:1466949-1466971 CAGCTGCACCTCTGCCCCCATGG + Intergenic
1077379052 11:2219740-2219762 CAGCTGCCCTGCAGAGCACGAGG - Intergenic
1078870366 11:15338448-15338470 CATGTGCCCTTCTGAGCACGGGG + Intergenic
1080706605 11:34701350-34701372 CAGCTGCACCTGGGAGCACGGGG - Intergenic
1085643739 11:78209502-78209524 CAGCTCGCCCTCTCCGCCCGAGG + Exonic
1086106828 11:83156585-83156607 CAGCTGCCCCTCTGGGAACTGGG - Intergenic
1088736486 11:112732018-112732040 AATCTGCCCCTCTGTGCATGTGG + Intergenic
1091097790 11:132840380-132840402 CAGCTGCCCCTTTGCTGAGGTGG + Intronic
1093183146 12:15989132-15989154 CAGCTGCCCCTGGGAGCACAGGG + Intronic
1095236275 12:39799946-39799968 CAGCTGCTCCACTGCACATGGGG - Intronic
1095584484 12:43835753-43835775 CAGCTGCCGCTCTGCAGAGGCGG + Intergenic
1098671338 12:73234743-73234765 CAGCTTCCACTCTGGGCACTGGG + Intergenic
1101002763 12:100373113-100373135 CTGCTGGCCCTCTGCACACTAGG - Intronic
1102937568 12:116910865-116910887 GCGCTGCCCCTGTACGCACGTGG - Intergenic
1103486827 12:121288688-121288710 GTGTTGCCCCTCTGCCCACGTGG - Intronic
1105550322 13:21388774-21388796 CAACAGCCCCACTGTGCACGCGG + Intronic
1106006862 13:25778748-25778770 CACCTGCCCCTCTGCGATCTGGG + Intronic
1106308481 13:28533242-28533264 CAGCTGCCTCTCTGGGTAAGAGG + Intergenic
1108648381 13:52452100-52452122 CCTGTGCCCCTCTGCCCACGTGG - Intergenic
1117548231 14:56810051-56810073 CCGATGCCCCTCTGCGAACGTGG - Intronic
1118470486 14:66070425-66070447 CAGCTGTGCCTCTGGCCACGGGG + Intergenic
1118971583 14:70642179-70642201 CCGCTGCCCCTCTCCGGCCGCGG - Exonic
1122502178 14:102208084-102208106 CATCTGCCCCTCTGCTCTGGCGG - Intronic
1122895177 14:104753213-104753235 GAGCTGCCCCTTCGCGGACGTGG + Exonic
1123108301 14:105853110-105853132 CAGCTGCTCCTCTTAGCAGGAGG - Intergenic
1130892392 15:88144320-88144342 CAGCTTCCCCTCTGTCCAGGGGG - Intronic
1132559583 16:587312-587334 CAGCTGCCCCTCGGTCCACAAGG + Intergenic
1132657019 16:1045681-1045703 CAGCTGCTCCCCTGAGCAAGAGG - Intergenic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1136377402 16:29873458-29873480 CAGCTGCACTACTGTGCACGGGG + Intronic
1138430566 16:56965936-56965958 CAGCTCCACCTCTGCCCCCGGGG + Intronic
1139380421 16:66527179-66527201 CAGCTTGCCCTCTGAGCAGGTGG - Intronic
1139959084 16:70707459-70707481 CATCTGTCCCTCTGTGCAAGAGG + Intronic
1141645536 16:85365400-85365422 CAGCTGCCCCTTTGTCCACAGGG - Intergenic
1141698490 16:85631877-85631899 CCGCTGCGCCTCTGTGCACAGGG + Intronic
1141919425 16:87126088-87126110 CAGCTGCCCCTCTGCCGAGGAGG + Intronic
1142347923 16:89565765-89565787 CAGCTGCCCCTCAGGGCCGGCGG - Exonic
1142643579 17:1298783-1298805 CAGCTCCGCCTCTGCGCTCGGGG - Exonic
1142669110 17:1479390-1479412 CAGCTGCCCCTCCACACCCGAGG + Intronic
1143770347 17:9164544-9164566 CTGGTGCCCTTCTGAGCACGGGG + Intronic
1147615420 17:41824538-41824560 CAGGTGCCACTCTGGGCACTTGG - Intergenic
1151178142 17:72305954-72305976 CAGCTGCCCCTCTGGAAACGGGG - Intergenic
1151450311 17:74194709-74194731 CAGCAGCCCCTCAGCACAGGTGG - Intergenic
1151636592 17:75353282-75353304 CAGTTGGCCCTCTGCGTAAGTGG + Intronic
1151746533 17:76014615-76014637 CACCTGCCCCTGTCCCCACGGGG - Intronic
1151977830 17:77492438-77492460 CAGCTGCCCCTCTTCCCTCCAGG + Intronic
1152197046 17:78924397-78924419 CACCTGCCCCTCTGGGCCTGTGG + Intronic
1158346900 18:56524965-56524987 CAGCTGCCCCTCTTGGCAGAGGG + Intergenic
1158932547 18:62335517-62335539 CACCTGCCCCTCTGCACCCAAGG + Intronic
1160937676 19:1604931-1604953 CAGCTGCGCCTGAGCCCACGTGG - Intronic
1160986859 19:1843158-1843180 CAGCTGCGGCTCTGGGCCCGGGG - Intronic
1160986880 19:1843218-1843240 CAGCTGCGGCTCTGGGCCCGGGG - Intronic
1161032615 19:2065191-2065213 CAGGTGCCCATGTGCGCACACGG - Intergenic
1161552829 19:4923611-4923633 CAGCTGCCCCTCTGCGCACGTGG + Intronic
1161572456 19:5038074-5038096 AAGCTGCCCCTCCGCGCCCCGGG - Intronic
1162461235 19:10815607-10815629 CAGCTCCTCCTCTGTGCACTGGG - Intronic
1163783235 19:19261374-19261396 CCGCTACCCCTCTCCGCACTTGG + Intronic
1165882248 19:39052538-39052560 CAGCTGAACCTATGCACACGGGG + Intergenic
1167146240 19:47681985-47682007 CAGCAGCCCCTCTCCGCAGAGGG + Exonic
1168710434 19:58497051-58497073 CAGCTGCCTCACAGCCCACGTGG + Intronic
927940711 2:27101402-27101424 CAGCTTCCCCTCTGGGCCCGGGG + Exonic
927940730 2:27101453-27101475 CAGCTTCCCCTCTGGGCCCGGGG + Exonic
927940748 2:27101504-27101526 CAGCTTCCCCTCTGGGCCCAGGG + Exonic
927943318 2:27119065-27119087 CAGCGCCCCCGCTGCGCCCGCGG + Exonic
930429129 2:51251505-51251527 CAGCTGCCCCTCTGCTCAGGGGG - Intergenic
932852346 2:75199607-75199629 CAGCTGCCGCGCTGCGCACCGGG - Exonic
934923648 2:98366529-98366551 CAGCAGCCCCTCCCCGCAAGGGG + Intronic
934991160 2:98922535-98922557 CAGCTGGCCCACTGGGCACAGGG - Intronic
935561980 2:104568764-104568786 TAGCTCCCCCTCTGAGCACCTGG - Intergenic
937737930 2:125313916-125313938 CAGCTGCCACTGTGGGCACCAGG - Intergenic
938092419 2:128442173-128442195 CAGCTCCCACTCTGCGCCCCTGG - Intergenic
938473760 2:131589595-131589617 CACCTCCCCATCTGCCCACGTGG - Intergenic
938736845 2:134193519-134193541 CAGCTGCCCTTGTGCCCAGGCGG + Intronic
942868167 2:180700138-180700160 CAGCTGCTCCTATGCTCAGGAGG + Intergenic
947461322 2:230306793-230306815 CAGGTGCCCCTTTGGGCAAGGGG + Intronic
947611252 2:231526360-231526382 CCGCTGGCCCTCTGTGCACCAGG - Intronic
947843068 2:233221025-233221047 CAGCAGCCCCTCTTCCCATGGGG - Intronic
948823237 2:240560782-240560804 CAGCTGCTCCTCCGCGCCCGCGG - Exonic
948931224 2:241133587-241133609 CAGATGCCCCTGCGCTCACGGGG - Intronic
1171444534 20:25194672-25194694 CAGATGCCCCAGTGCGCAGGTGG + Intergenic
1172056103 20:32155315-32155337 CAGCTGGCCCTCTGCCCTCATGG - Intronic
1172444302 20:34985045-34985067 GGGCTGCCCCTCTGCCCACAGGG + Exonic
1173894664 20:46541757-46541779 CAGCTGCCCCGCTGGCCGCGGGG - Exonic
1174449969 20:50613776-50613798 CACCTGCCCCTCTTCTCACATGG - Intronic
1175331955 20:58171253-58171275 CAGCTGCCCCTCAGCGCCACGGG + Intergenic
1175395846 20:58661036-58661058 CAGCTCCCCGCCTGGGCACGGGG + Intronic
1175458301 20:59131613-59131635 CAGGTGTCCCTCTGAGCACCGGG + Intergenic
1175603399 20:60293143-60293165 CAGCTCCCCCTCTGTGTATGAGG + Intergenic
1176104167 20:63377888-63377910 CAGCTGCCCCCCTGCACACCGGG + Intronic
1180967142 22:19796380-19796402 CAGATGCCCCGCTGCACACGTGG - Intronic
1181721751 22:24780645-24780667 CAACTGCCCCTCTGCTGACTTGG + Intergenic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183831218 22:40419184-40419206 CAGCGGCCCGGCTGAGCACGGGG - Exonic
1184512920 22:44943530-44943552 CAGCTGCCCGTGTCCCCACGAGG - Intronic
1184841061 22:47052644-47052666 CCGCTGCCCCTCAGAGCAGGAGG - Intronic
1184931194 22:47682465-47682487 CAGTTGCCCCTCAGGGCAGGGGG - Intergenic
953564786 3:44022127-44022149 CCGCTGCCCCTGTGCGCTCCGGG + Intergenic
953692810 3:45134087-45134109 CAGCTTCCCCACTGAGCAAGGGG + Intronic
954097233 3:48338350-48338372 CAACTGCCCCTGTCCTCACGGGG + Intergenic
961008688 3:123422126-123422148 CAAGTGCCCCTCTGCCCAGGAGG - Intronic
961516739 3:127442702-127442724 CAGCTGCCCCTCTAGGCCCTGGG + Intergenic
962753310 3:138450464-138450486 CAGCTGCACCTCTGGGAACCAGG + Intronic
967649974 3:191973926-191973948 CAGCTGCCACTCCACGCAGGAGG + Intergenic
968726658 4:2251024-2251046 GAGCTGCACCACTGCGCACCCGG + Intronic
969089485 4:4682922-4682944 CAGCTGCCCCTCTGCTCACGAGG - Intergenic
969566590 4:7982256-7982278 CAGCTGGCCCTGTGCACATGGGG + Intronic
978045033 4:104114885-104114907 CAGCTGCCCCTCTCATCACCAGG - Intergenic
985791476 5:1930786-1930808 CAGCTGCCCCTCCACGCTCCGGG - Intergenic
987193204 5:15500249-15500271 CGGCTGCCCCTGCGCGCCCGCGG - Exonic
989166568 5:38438365-38438387 CAGCTGCCCCCATGGGCACAAGG - Exonic
989655769 5:43745841-43745863 CAGCTGCCCCTCTGGGAAGTGGG - Intergenic
1007094499 6:39205041-39205063 CAGCTGCCCCCCTGCCCTGGGGG - Intronic
1014137780 6:117908046-117908068 CCGCGGCCTCTCTGCGCCCGCGG - Intronic
1014623198 6:123694893-123694915 CACCTGCCCCTCTGCCAACATGG - Intergenic
1017368202 6:153670040-153670062 CAGTCACCCCTCTGCCCACGTGG - Intergenic
1017794842 6:157834695-157834717 CAAGTGCCCATCTGAGCACGTGG + Intronic
1019179306 6:170176777-170176799 CAGCTGCCCCGCTGCGTGCCCGG - Intergenic
1019435317 7:1019601-1019623 CAGCCTCCCCTCTGCCCACAGGG - Intronic
1020074478 7:5248693-5248715 CCCCTGCCCCTCTGGCCACGCGG + Intergenic
1022515305 7:30971403-30971425 CCTCTGCCCCTTTGCTCACGTGG + Intronic
1023993729 7:45146148-45146170 CAGCTGTGCCTCTGCACCCGGGG + Intergenic
1024019989 7:45359935-45359957 CAGCTGCTCCTCTGGCCACAGGG - Intergenic
1024981478 7:55161094-55161116 CACCTGCTCCTCTGCACACCTGG + Intronic
1025204623 7:56985114-56985136 CCCCTGCCCCTCTGGCCACGCGG - Intergenic
1025667314 7:63591821-63591843 CCCCTGCCCCTCTGGCCACGCGG + Intergenic
1028433718 7:90777677-90777699 CAGCTGCCCCTATGTGCACTAGG - Intronic
1029592142 7:101514436-101514458 CAGCTGCCTCTCTGGGCCCTGGG + Intronic
1035278639 7:157763570-157763592 CAGCTGCCCCCCTGGCCATGGGG + Intronic
1035967511 8:4209768-4209790 GAGCTGCCACTCTGGGCACATGG - Intronic
1040692953 8:49962020-49962042 CAGCTTCCCCTCTGCTCCCAGGG + Intronic
1041045213 8:53881286-53881308 GCGATGCCCCTCTTCGCACGCGG - Intronic
1041110394 8:54477555-54477577 CAGCTGCCCCCCAGCTCCCGTGG - Intergenic
1046775478 8:118159251-118159273 CAGCTTCCACTGTGCGCACTGGG - Intergenic
1049273685 8:141709207-141709229 CCACTGCCCCTCTGTGCACTTGG - Intergenic
1049423549 8:142527215-142527237 CAGCTTCCCCTCTGTGCCCAGGG - Intronic
1049936526 9:505268-505290 CACCTGCCCCTCTGGGGCCGAGG - Intronic
1056382704 9:86069692-86069714 CAGCTAACCCTCTGCCCATGTGG - Intronic
1056976154 9:91256661-91256683 CAGCTGTCCCTGTGCTCAAGCGG + Intronic
1059311103 9:113389618-113389640 CAGCTGCCCCCTGGAGCACGAGG - Exonic
1061038421 9:128126154-128126176 CAGCTTCCCCTCTGAACACAGGG - Intronic
1062049974 9:134442232-134442254 CTGCTGCACATCTGCGCACATGG + Intergenic
1062448917 9:136607420-136607442 CAGCTGCCCCTGGGCGTCCGCGG - Intergenic
1200213499 X:154357196-154357218 AAGCTGCCCCTCTGGGCAGGAGG + Intronic