ID: 1161556237

View in Genome Browser
Species Human (GRCh38)
Location 19:4944384-4944406
Sequence TGGGTCCGTAGTGGTTGGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161556237_1161556251 9 Left 1161556237 19:4944384-4944406 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1161556251 19:4944416-4944438 TCCCCGTGGGCACCATGTGGCGG 0: 2
1: 0
2: 2
3: 7
4: 145
1161556237_1161556250 6 Left 1161556237 19:4944384-4944406 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1161556250 19:4944413-4944435 GGATCCCCGTGGGCACCATGTGG 0: 2
1: 0
2: 1
3: 5
4: 117
1161556237_1161556246 -4 Left 1161556237 19:4944384-4944406 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1161556246 19:4944403-4944425 CCCATCCCGGGGATCCCCGTGGG 0: 2
1: 0
2: 0
3: 4
4: 98
1161556237_1161556256 22 Left 1161556237 19:4944384-4944406 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1161556256 19:4944429-4944451 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55
1161556237_1161556244 -5 Left 1161556237 19:4944384-4944406 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1161556244 19:4944402-4944424 ACCCATCCCGGGGATCCCCGTGG 0: 2
1: 0
2: 0
3: 4
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161556237 Original CRISPR TGGGTCCGTAGTGGTTGGAC GGG (reversed) Exonic