ID: 1161556237

View in Genome Browser
Species Human (GRCh38)
Location 19:4944384-4944406
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161556237_1161556251 9 Left 1161556237 19:4944384-4944406 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1161556251 19:4944416-4944438 TCCCCGTGGGCACCATGTGGCGG 0: 2
1: 0
2: 2
3: 7
4: 145
1161556237_1161556246 -4 Left 1161556237 19:4944384-4944406 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1161556246 19:4944403-4944425 CCCATCCCGGGGATCCCCGTGGG 0: 2
1: 0
2: 0
3: 4
4: 98
1161556237_1161556250 6 Left 1161556237 19:4944384-4944406 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1161556250 19:4944413-4944435 GGATCCCCGTGGGCACCATGTGG 0: 2
1: 0
2: 1
3: 5
4: 117
1161556237_1161556244 -5 Left 1161556237 19:4944384-4944406 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1161556244 19:4944402-4944424 ACCCATCCCGGGGATCCCCGTGG 0: 2
1: 0
2: 0
3: 4
4: 121
1161556237_1161556256 22 Left 1161556237 19:4944384-4944406 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1161556256 19:4944429-4944451 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161556237 Original CRISPR TGGGTCCGTAGTGGTTGGAC GGG (reversed) Exonic
903263588 1:22143550-22143572 TGGGTCCGCCGCGGTCGGACCGG - Intronic
905459637 1:38114177-38114199 TGGGCCCTTGGTGGTTGGCCAGG + Intergenic
910885493 1:91959244-91959266 TTGGTCTGTAGTGATTGGAGTGG + Intronic
911199462 1:95030104-95030126 TGGGTCAGAAGTGTTTGGACAGG + Intronic
920248929 1:204609347-204609369 TGGGCACGTGGTGGTGGGACAGG + Intergenic
1069314211 10:67077468-67077490 AGGGTCCAGAATGGTTGGACTGG - Intronic
1069686937 10:70324512-70324534 TGGGTCAGCTGTGGTTGGCCAGG - Intronic
1070808617 10:79286022-79286044 TGGGGCCGTTTTGGCTGGACAGG + Intronic
1072825051 10:98598478-98598500 TGGGTCCATAGAGGTTGACCTGG + Intronic
1072864373 10:99042438-99042460 GGGGACCGTAGTGGTTGGTATGG - Intronic
1073125700 10:101147412-101147434 TGGCTCCGTATTGGTTGGAGGGG - Intergenic
1073869769 10:107849890-107849912 TGGATCAGTAGAGGTTGGCCAGG - Intergenic
1084006844 11:66327420-66327442 TGGGTGAGTGGTGGTGGGACAGG + Intergenic
1084422223 11:69066167-69066189 TGGGAACGTGGTGGTTTGACTGG + Intronic
1091714724 12:2768715-2768737 TGGGCACGTAGTGGTAGGACTGG - Intergenic
1093561827 12:20551868-20551890 TGGGTCCGTAGTGGTTGGACGGG - Intronic
1101705682 12:107218624-107218646 TGGGTGAGTAGTGGCTGTACTGG + Intergenic
1102078360 12:110078036-110078058 TGGTTCCCTAGTGGTTGGGTAGG - Intergenic
1104843668 12:131836163-131836185 TGGGTCAGTAGGGTTTGGAAAGG + Intronic
1111125184 13:83906141-83906163 TGGGAGGGCAGTGGTTGGACAGG - Intergenic
1122291116 14:100680981-100681003 TGTGTCCCTAATGGTGGGACAGG - Intergenic
1137750516 16:50858097-50858119 TGGGTCAGTGGTGGTGGGAAGGG + Intergenic
1142184028 16:88686007-88686029 TGGGGCTGTAGTGGTTGGGACGG + Intronic
1143964869 17:10749950-10749972 AGGGTCTGTAGGGGTTGGAAGGG + Intergenic
1146072729 17:29698911-29698933 TGGGCCAGTAGTGTTTGGAGTGG - Intronic
1161017706 19:1991442-1991464 TGGGTTCGTAGTGGTTTTAGGGG + Intronic
1161556237 19:4944384-4944406 TGGGTCCGTAGTGGTTGGACGGG - Exonic
1163505538 19:17703876-17703898 TGGGCCTGGAGTGGTTGGATGGG + Intergenic
1163764134 19:19153041-19153063 TGGGTCCCTGGGGGGTGGACGGG + Intronic
1165816834 19:38647769-38647791 TGGGGCCGTACTGGTACGACTGG - Exonic
925139604 2:1540754-1540776 TGCCACCGCAGTGGTTGGACAGG + Intronic
925347776 2:3182950-3182972 TGGGTGGGTGGTGGTTGGATGGG - Intergenic
931005465 2:57846345-57846367 TGGGCCCATAGGGGTTGGCCTGG - Intergenic
935916291 2:107954496-107954518 TGGGGCTGTAGTGGTGGGGCAGG + Intergenic
943765712 2:191659484-191659506 TGGGTTGCTAGTGGTTGGCCTGG + Intergenic
1170736946 20:19021054-19021076 TCTGTCCATGGTGGTTGGACTGG - Intergenic
1171161779 20:22931960-22931982 TGGGTTCTCTGTGGTTGGACTGG + Intergenic
1173139954 20:40473130-40473152 TAGGGCCTTAGTGTTTGGACAGG + Intergenic
1177017400 21:15809468-15809490 TGGGTCAGTAGGGGTTGGGGGGG - Intronic
1178492317 21:33060584-33060606 TGGATCCCCAGTGCTTGGACAGG - Intergenic
1179158870 21:38875473-38875495 TGGGTGCATGGTGCTTGGACTGG + Intergenic
1179422165 21:41245333-41245355 TGTGCCCGTAGTGGTTGGGGTGG + Intronic
1181849182 22:25737623-25737645 TGGGTCCCCAGTGGGTGGTCTGG - Intergenic
1182737792 22:32543406-32543428 TAGGTCCGTTGTGGTAGAACAGG - Intronic
1184897930 22:47422953-47422975 TTGGTCCGCAGTGGCTGGCCAGG - Intergenic
950225126 3:11227232-11227254 TGGAACCGTAGTGGTTGGGAAGG + Intronic
950430404 3:12947651-12947673 TGGGCCCCTGGTGGTGGGACAGG + Intronic
959111008 3:102123279-102123301 TGGGTCCATAGGGGTGGGCCTGG + Intronic
967134060 3:186497915-186497937 TGAGTCTGTGGTGGTTGGCCTGG - Intergenic
968963604 4:3758221-3758243 TGGGTCAGTAGAGGATGCACTGG + Intergenic
970546745 4:17137713-17137735 TGGGTCAGTAGGGGATGGCCTGG - Intergenic
970979248 4:22077552-22077574 TGGGTGTGTGGTGGTTGGCCTGG - Intergenic
979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG + Exonic
986411865 5:7488898-7488920 TGGGTCCCTCGGGGTTGCACAGG - Intronic
986896518 5:12377214-12377236 TGGGTCAGCAAGGGTTGGACTGG + Intergenic
990887212 5:60608138-60608160 TGGGGACGTAGCGGTTGAACTGG + Intronic
1001264896 5:170267039-170267061 TGGGTTCTTCGTGGTTGGTCTGG + Exonic
1005350310 6:24927624-24927646 GGTGGCGGTAGTGGTTGGACTGG - Intronic
1006320218 6:33315574-33315596 TGGTTCCCTGGTGGTTGGCCAGG + Exonic
1013780004 6:113718640-113718662 AGGGTCTGTAGTGGTGGGGCTGG + Intergenic
1031401516 7:121329826-121329848 TGGGTCCTTAGGGGTTGGTGGGG + Intronic
1032117047 7:129126457-129126479 TGGGCCCGTAGTGGGCGGGCCGG - Intergenic
1045251341 8:100485601-100485623 TGGATCCGCAGTGGTAGGAATGG + Intergenic
1062137690 9:134938366-134938388 TGGGTCCGTAGGCCTTTGACAGG - Intergenic
1203783384 EBV:113826-113848 TGGGTACGTAGTCGTTGTTCAGG + Intergenic
1187434831 X:19258499-19258521 TTGGTCCTAAGTAGTTGGACTGG + Intergenic
1187543903 X:20228416-20228438 ATGGTCCCTAGTGGTTGGAATGG + Intronic
1192382969 X:70636542-70636564 TGAGTCTGTAGGGGTTGGCCTGG - Intronic