ID: 1161556273

View in Genome Browser
Species Human (GRCh38)
Location 19:4944485-4944507
Sequence CGGGCTCATCCTGCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161556266_1161556273 -2 Left 1161556266 19:4944464-4944486 CCCGGGGCTCCAGGGGCCACGCG 0: 1
1: 0
2: 2
3: 23
4: 291
Right 1161556273 19:4944485-4944507 CGGGCTCATCCTGCTTTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 131
1161556262_1161556273 8 Left 1161556262 19:4944454-4944476 CCTGCAGCGTCCCGGGGCTCCAG 0: 1
1: 0
2: 5
3: 20
4: 287
Right 1161556273 19:4944485-4944507 CGGGCTCATCCTGCTTTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 131
1161556257_1161556273 21 Left 1161556257 19:4944441-4944463 CCGAGTCCAGGTACCTGCAGCGT 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1161556273 19:4944485-4944507 CGGGCTCATCCTGCTTTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 131
1161556259_1161556273 15 Left 1161556259 19:4944447-4944469 CCAGGTACCTGCAGCGTCCCGGG 0: 1
1: 0
2: 2
3: 9
4: 127
Right 1161556273 19:4944485-4944507 CGGGCTCATCCTGCTTTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 131
1161556267_1161556273 -3 Left 1161556267 19:4944465-4944487 CCGGGGCTCCAGGGGCCACGCGG 0: 1
1: 0
2: 3
3: 37
4: 296
Right 1161556273 19:4944485-4944507 CGGGCTCATCCTGCTTTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161556273 Original CRISPR CGGGCTCATCCTGCTTTTCT GGG Intronic
901778978 1:11580190-11580212 GGGGCTCTTCCTGCTTCACTCGG - Intergenic
904235843 1:29116504-29116526 CAGCCTGATCCTGCTCTTCTTGG - Intronic
905828075 1:41042115-41042137 CTGGCTCATCATGCCTTGCTGGG + Intronic
905828154 1:41042672-41042694 CTTGCTCATCATGCTTTGCTGGG + Intronic
906032451 1:42732509-42732531 TGGGATCATCCTCCTATTCTAGG - Intergenic
910767839 1:90800438-90800460 CGGGCTCTTCAGGATTTTCTAGG - Intergenic
911728207 1:101264707-101264729 GGGGCTCATCTCCCTTTTCTAGG - Intergenic
915252104 1:154597926-154597948 CAGCCACATCCTTCTTTTCTGGG - Exonic
916586061 1:166151517-166151539 CAGAAGCATCCTGCTTTTCTTGG + Intronic
924077552 1:240356458-240356480 TGGACTCTTCCTGCATTTCTAGG + Intronic
1063352964 10:5373570-5373592 CGGGCTGATGCTGCTGGTCTGGG + Intronic
1065044707 10:21736912-21736934 CTGGCTTATTCTCCTTTTCTAGG - Intronic
1066001214 10:31105680-31105702 CTGGATCATCCTGCCCTTCTAGG + Intergenic
1067828111 10:49593976-49593998 CGGGGTTATTCTACTTTTCTGGG + Intergenic
1068056560 10:52019043-52019065 GGGCCTCATCCTGCTTCTCATGG + Intronic
1068414572 10:56702140-56702162 AGGGCTCTTCCTGCTTCGCTTGG + Intergenic
1069352373 10:67544351-67544373 AGGGCTCATCCTGTTTTTTTTGG - Intronic
1071306719 10:84305670-84305692 CGGGCTCTTCCCTCTTCTCTTGG + Intergenic
1073766736 10:106690930-106690952 AGGTCTCATCCTACGTTTCTTGG + Intronic
1074452402 10:113569704-113569726 TGGGCTCAGCCTGCATTGCTGGG - Intronic
1078065986 11:8080080-8080102 GGGGCTCATCCTGCTGCCCTGGG - Intronic
1087192901 11:95274554-95274576 GGGGCTCTTCCTCCTTTGCTTGG + Intergenic
1088068483 11:105752201-105752223 CGGCCTCATCTTGCCTTTCTTGG - Intronic
1088911305 11:114194429-114194451 CGGGCTCAAGCTGGTGTTCTAGG + Intronic
1089092516 11:115889793-115889815 TAGGCTGAGCCTGCTTTTCTTGG - Intergenic
1091758203 12:3069668-3069690 CAGGGGCATTCTGCTTTTCTTGG + Intergenic
1095990734 12:48032788-48032810 CTGGCTCCTCCTGCTTGCCTGGG - Intergenic
1096816747 12:54206470-54206492 TGGCCTCATCCTGTTTGTCTGGG - Intergenic
1099433943 12:82620862-82620884 GGGGCTTTTCCTGCTTTGCTTGG - Intergenic
1104440584 12:128790269-128790291 GGGGCTCATCCTGCGTTTCTGGG + Intergenic
1104606758 12:130195121-130195143 CGGGCTCCTCCTGTTTTCCGGGG - Intergenic
1112248686 13:97757920-97757942 CAGGCACTTCCTGCTTTGCTAGG + Intergenic
1112362811 13:98732353-98732375 CAGGCTCTTCTTGCTATTCTAGG + Intronic
1113319001 13:109213870-109213892 CCGGCTCAGCCTGCTCTGCTGGG - Intergenic
1113936163 13:113996213-113996235 CGTGGCCATCCTGCTTCTCTAGG - Intronic
1117356237 14:54926260-54926282 AGGGCACACCCTGCTTTTCCTGG + Intergenic
1119405986 14:74399976-74399998 CGGGCTCATACTGCTCTTTCTGG + Intergenic
1120681437 14:87485413-87485435 TGGTCTCACCCTGCTTTTCATGG + Intergenic
1122593871 14:102875043-102875065 CAGGCTAATGCTGCTTTTTTTGG + Intronic
1123677912 15:22730326-22730348 AGGGCTTATCCAGTTTTTCTGGG + Intergenic
1124330112 15:28804593-28804615 AGGGCTTATCCAGTTTTTCTGGG + Intergenic
1125159726 15:36628856-36628878 AGGGCCCATCCTGGTATTCTAGG - Intronic
1125503758 15:40254938-40254960 TGGGCTGAACCTGCTTTCCTGGG - Intronic
1126568802 15:50128129-50128151 AGTGTTCCTCCTGCTTTTCTGGG - Intronic
1128997151 15:72305652-72305674 CTGGCTCTTCCTACTTTTCTTGG + Intronic
1134183286 16:12064305-12064327 AGAGCTCTTCCTGCTCTTCTGGG + Intronic
1134286511 16:12866762-12866784 CGGACTAATGCAGCTTTTCTTGG + Intergenic
1137014731 16:35363690-35363712 GCGGCTCTTCCTTCTTTTCTGGG + Intergenic
1138210782 16:55161619-55161641 GGGGCTCTTCCTGCTTTGCTTGG + Intergenic
1141628602 16:85274917-85274939 CCGGCCCCTCCTGCTGTTCTTGG + Intergenic
1141922307 16:87144187-87144209 CTGGCTCATTCTGCCTTTTTGGG + Intronic
1143972998 17:10809253-10809275 GGGGCTCATCCCCCTTTGCTGGG + Intergenic
1144531575 17:16044324-16044346 CTGGCTCATCCTTTTTTCCTTGG + Intronic
1144876596 17:18400351-18400373 CGGGCTCACCCTGCGCTTGTGGG + Intergenic
1144954997 17:19014676-19014698 CGGGTTAATCATGCTTTCCTCGG + Intronic
1146904497 17:36609224-36609246 CTGGCTCCTGCTGCTTTCCTGGG - Intergenic
1150084586 17:62267201-62267223 CGGGCTCACCCTGCGCCTCTGGG - Intergenic
1150482417 17:65520747-65520769 CGGGCTAAGCCAGATTTTCTTGG - Intergenic
1151292915 17:73163473-73163495 CTGGCTCTTCCTTCTTTTCCTGG + Intergenic
1157416037 18:47503875-47503897 CCTCCTCCTCCTGCTTTTCTAGG + Intergenic
1157981610 18:52388063-52388085 AGGGCTCAGCCTGCATTGCTAGG + Intronic
1158120456 18:54042813-54042835 TGGGGTCCTCCTGCTTCTCTGGG + Intergenic
1161556273 19:4944485-4944507 CGGGCTCATCCTGCTTTTCTGGG + Intronic
1162490109 19:10986708-10986730 CGGGCCCATACTGCACTTCTGGG + Intronic
1163713277 19:18859759-18859781 CGGGCTCTTCATGCTCATCTTGG - Intronic
1167202362 19:48074788-48074810 GGGGCTGCTCCTGCTTTTCCAGG + Exonic
926647497 2:15305271-15305293 GGGGCTCTTCCCGCTTTGCTTGG + Intronic
929560937 2:42955967-42955989 CAGCCTCATCCTCCTCTTCTGGG + Intergenic
937991799 2:127666805-127666827 GGGGCTCATCCCCCTTTGCTTGG - Intronic
938376955 2:130814301-130814323 TGAGCACATCCTGCTTTGCTGGG + Intergenic
940186407 2:150989309-150989331 AGGTCTCATCTTTCTTTTCTTGG - Intergenic
944689709 2:202148559-202148581 TGGGGTCATCCTGCTCTTCTTGG - Intronic
946435127 2:219646346-219646368 GGAGCTCATGCAGCTTTTCTAGG + Intergenic
947033058 2:225820150-225820172 GGGGCTCTTCCCGCTTTTCTCGG + Intergenic
1171435369 20:25118042-25118064 CAGCCTCATCCTGCTTTCCCTGG - Intergenic
1172225417 20:33302244-33302266 TGGGCCCACCCAGCTTTTCTGGG + Intronic
1175219907 20:57410727-57410749 TGGGCTCAGCCTGCATGTCTGGG - Intergenic
1178944188 21:36932641-36932663 CGAGCTCAGTTTGCTTTTCTGGG - Intronic
1179577836 21:42318691-42318713 CGGGCTCTGCCTGATGTTCTGGG - Intergenic
1181012242 22:20048245-20048267 GGGGCTTTTCCTGCTTTGCTTGG + Intronic
1182041627 22:27242729-27242751 TGGTTTCATCCTCCTTTTCTTGG + Intergenic
1182418270 22:30235465-30235487 CGAGATCATCCTGGATTTCTGGG - Intergenic
1184012311 22:41758404-41758426 AGGGCTCCTGCTGCTTATCTGGG - Exonic
949493909 3:4613733-4613755 CAGGATCATCCTTCTTTTCATGG + Intronic
951379831 3:21969384-21969406 GGGGCTCATCCCTCTTTGCTCGG + Intronic
952488571 3:33841759-33841781 AGGGCTTATCCAGTTTTTCTGGG + Intronic
955277062 3:57556654-57556676 CCGGCTCTTCCTGCTCTTCTTGG - Exonic
956283550 3:67584806-67584828 GGGGCTCTTCCTGCTTTGCCCGG - Intronic
958182037 3:90072418-90072440 GGGGCACGTCCTGCTTTTCTGGG - Intergenic
958672041 3:97218494-97218516 GGGGCTCTTCCTACTTTGCTAGG - Intronic
960454336 3:117852114-117852136 TTGGCTCATCCTGATTTTCAAGG - Intergenic
962769787 3:138601585-138601607 CAGGCTGATCCTGCTTTTGAAGG - Intergenic
962953956 3:140247290-140247312 CAAGCTCATCCAGGTTTTCTTGG + Intronic
964848451 3:161068789-161068811 TGGGCTCATCCTGTCTTTCTAGG + Exonic
969185690 4:5472531-5472553 GGGGCCCATCCTCCTATTCTTGG + Intronic
969277759 4:6148521-6148543 CGGGCGCATCCTCCTTTTCAAGG + Intronic
970453060 4:16191122-16191144 GGGGCTCATGCTGCTGGTCTGGG - Intronic
972969483 4:44555308-44555330 CTGGCTCACCCTGCTGATCTTGG + Intergenic
973929213 4:55772974-55772996 TTGGCTTATCCTGTTTTTCTGGG - Intergenic
975120779 4:70726167-70726189 CGGGTACATTCTGCTTTTCCAGG - Intronic
977942362 4:102873036-102873058 GGGGCTCTTCCTCCTTTGCTCGG - Intronic
979073808 4:116244743-116244765 GGGGCTTTTCCTCCTTTTCTGGG + Intergenic
983550262 4:169010267-169010289 CGAGCTCTTCCTCCTTTTCACGG - Intronic
984207786 4:176806870-176806892 TGGGCTCATCCTCCTCTTCCTGG - Intergenic
985573817 5:664578-664600 CGGGGCCTTCCTGCTTTCCTGGG - Exonic
987032544 5:13989109-13989131 ACGGCTCTTTCTGCTTTTCTTGG - Intergenic
989568697 5:42925387-42925409 CAGGCTCCTCTTTCTTTTCTGGG + Intergenic
993362185 5:86991190-86991212 GGGGCTCTTCCCGCTTTGCTCGG + Intergenic
997722961 5:136095175-136095197 CTGGCTCTTCCTGCTTGTCCCGG - Intergenic
999271211 5:150297374-150297396 CGGGCTCATCCTGACTTTAATGG - Exonic
1000642432 5:163718533-163718555 CAGGCTCATCATGCTTCCCTAGG + Intergenic
1002177441 5:177409267-177409289 AGGGCACAGCCTGCATTTCTGGG - Intronic
1004104398 6:12652551-12652573 CGGGCTCACCCAGGTGTTCTGGG - Intergenic
1006601537 6:35229909-35229931 CCAGCCCAGCCTGCTTTTCTGGG - Intronic
1006726335 6:36201656-36201678 CAAACTCATCTTGCTTTTCTTGG - Exonic
1008960297 6:57259573-57259595 AGGGATCATCCTGCATTGCTGGG + Intergenic
1010472400 6:76244243-76244265 GGGGCTCCTCCTGCTTTGGTCGG + Intergenic
1012399714 6:98833808-98833830 CGGGCTGAGCCTGCCTCTCTCGG + Intergenic
1015377620 6:132528292-132528314 CTGGATCCTCCTGTTTTTCTGGG + Intergenic
1018564663 6:165138565-165138587 GGAGCTCTTCCTGCTTCTCTTGG + Intergenic
1018729076 6:166635660-166635682 CGGGCTCTTCCTCCTCTTCTGGG - Intronic
1019986024 7:4656529-4656551 TGGGATCACCTTGCTTTTCTTGG - Intergenic
1021679783 7:23118503-23118525 CTGGCTCATTCTTCTTTCCTAGG - Intronic
1022529251 7:31056924-31056946 GGCGCTCATCCAGGTTTTCTGGG + Intronic
1032252518 7:130270430-130270452 ATGGCTCATCCTACCTTTCTGGG - Intronic
1034936391 7:155203314-155203336 GTGGCTCCTCCTGCTTTTGTGGG + Intergenic
1035335088 7:158122804-158122826 CGGGCTCACCCCACCTTTCTGGG - Intronic
1035643313 8:1200041-1200063 CGTCCTCATCCTCCTGTTCTCGG - Intergenic
1035829872 8:2683969-2683991 CGGGCTCTTCACTCTTTTCTTGG - Intergenic
1036110269 8:5891701-5891723 AGGGCTCATCTTAGTTTTCTTGG - Intergenic
1037421430 8:18707428-18707450 AGGGCTTATCCTACTTATCTTGG + Intronic
1037452023 8:19025091-19025113 GGCCCTCATCCTGCTTTTCAGGG - Intronic
1040486924 8:47882309-47882331 CAGGCTCATCCAGCTTCTCCTGG + Intronic
1046810336 8:118526345-118526367 GGGGCTATTCCTGGTTTTCTTGG - Intronic
1047785906 8:128153655-128153677 GGGGCTCAACCTGTATTTCTTGG - Intergenic
1048215521 8:132490741-132490763 CCTGCTCATGCTGCTTCTCTGGG + Intergenic
1051243056 9:15080526-15080548 TGGGCTGTTCCTGCTTCTCTTGG + Intergenic
1052396640 9:27946909-27946931 TGGGCTTATCCTACTTTTATTGG + Intergenic
1055721041 9:79175133-79175155 TGAGATCATCCTGCTTTTCTGGG - Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1057793917 9:98142577-98142599 TTGGCTCATCTGGCTTTTCTTGG - Intronic
1060417540 9:123443074-123443096 TGGGATTATCCTGCTTTTATAGG + Intronic
1185556748 X:1027345-1027367 CGGGTTCATCTTGCTTTTCCAGG + Intergenic
1188617869 X:32180772-32180794 GGGGCTCTTCCTGCTTCACTGGG - Intronic
1190541900 X:51485698-51485720 CCGGCTCATTCTTCTTTCCTAGG + Intergenic
1191643658 X:63454880-63454902 CGGGCTCTTACCACTTTTCTCGG - Intergenic
1194691774 X:96994758-96994780 GGGGCTCTTCCTGCTTCTTTTGG - Intronic