ID: 1161558280

View in Genome Browser
Species Human (GRCh38)
Location 19:4956694-4956716
Sequence AACTGGAACTAGAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161558280_1161558288 24 Left 1161558280 19:4956694-4956716 CCCGCTTCCCTCTAGTTCCAGTT 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1161558288 19:4956741-4956763 GTTCCAGTGTATCTGCTGTCAGG 0: 2
1: 0
2: 1
3: 7
4: 137
1161558280_1161558285 -6 Left 1161558280 19:4956694-4956716 CCCGCTTCCCTCTAGTTCCAGTT 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1161558285 19:4956711-4956733 CCAGTTGTTCCTGAGTAAAGTGG 0: 2
1: 0
2: 0
3: 9
4: 155
1161558280_1161558290 30 Left 1161558280 19:4956694-4956716 CCCGCTTCCCTCTAGTTCCAGTT 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1161558290 19:4956747-4956769 GTGTATCTGCTGTCAGGAGCTGG 0: 2
1: 0
2: 0
3: 15
4: 162
1161558280_1161558286 -3 Left 1161558280 19:4956694-4956716 CCCGCTTCCCTCTAGTTCCAGTT 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1161558286 19:4956714-4956736 GTTGTTCCTGAGTAAAGTGGAGG 0: 2
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161558280 Original CRISPR AACTGGAACTAGAGGGAAGC GGG (reversed) Exonic
900648321 1:3718834-3718856 AAAGGGAACTGTAGGGAAGCGGG + Intronic
903260642 1:22129973-22129995 AACTGGATCCAGAGAGAAGTCGG - Intronic
904569726 1:31453964-31453986 TACTGAAACTAGAGGCAAGGGGG + Intergenic
904571838 1:31471806-31471828 TACTGAAACTAGAGGCAAGCGGG + Intergenic
906376164 1:45298609-45298631 AACTGTGACTAAAGGGAAGAGGG - Intronic
907388373 1:54140303-54140325 AACTGCAACTAGCTGAAAGCTGG + Intronic
908449794 1:64241259-64241281 AACTGAAACTTTAAGGAAGCAGG - Intronic
908881812 1:68741356-68741378 AACTGGAACAAGTGTGAGGCAGG + Intergenic
909124193 1:71644287-71644309 AGCGGGGACTAGAAGGAAGCAGG - Intronic
909154892 1:72061639-72061661 AGCTGGAACAAGAAGGAAGGGGG + Intronic
909659290 1:78064380-78064402 CACTGGCATTTGAGGGAAGCAGG - Intronic
910126507 1:83848547-83848569 AACTGGAGCTAGAGTGAGGTGGG - Intergenic
911285109 1:95981647-95981669 AACAGGAATTAGAAGAAAGCTGG - Intergenic
911520187 1:98920215-98920237 CACTGGAAGTATAGGGAAGGTGG + Intronic
912038891 1:105359330-105359352 TACCTGATCTAGAGGGAAGCTGG + Intergenic
915275197 1:154783692-154783714 GACTGGAAGGAGAGGGGAGCTGG + Intronic
916644731 1:166771650-166771672 AACAGAAACTAAAAGGAAGCAGG + Intergenic
916679440 1:167090536-167090558 AAGGGGAACTTGAGGGAAGTAGG - Exonic
919331824 1:196181797-196181819 AATGGGAAATAAAGGGAAGCTGG - Intergenic
919773314 1:201176847-201176869 ACCTGGAACTATGGGGAAGGAGG - Intergenic
921404087 1:214759959-214759981 AAATGCAGATAGAGGGAAGCAGG + Intergenic
921918346 1:220639122-220639144 AGCTGGAACTATAGGCATGCTGG - Intronic
1064444917 10:15384573-15384595 GACTGCAAATAGAGGAAAGCAGG + Intergenic
1066714828 10:38275571-38275593 AACTGAAAATAGAGAGAAGGGGG - Intergenic
1066783249 10:38975131-38975153 AACTGAAAATAGAGAGAAGGGGG + Intergenic
1069228391 10:65973734-65973756 AACAGGAGCAAGAGGGAAGTGGG + Intronic
1071718480 10:88120102-88120124 AGCAGGAACGAGGGGGAAGCAGG + Intergenic
1071718495 10:88120155-88120177 AGCAGGAACGAGGGGGAAGCAGG + Intergenic
1071935672 10:90527346-90527368 AATTGCAACTAGAGAGAAGGAGG - Intergenic
1072125427 10:92441509-92441531 AACTGAAACTTTAAGGAAGCAGG - Intergenic
1074161639 10:110840914-110840936 AACTGCAACTCGAGGGAAGGGGG - Intergenic
1075176144 10:120162943-120162965 AATTGGACCCAGAGGCAAGCTGG - Intergenic
1075680962 10:124330799-124330821 AACTGGGACTAGTAGGCAGCTGG - Intergenic
1075776217 10:124990658-124990680 AACTGGAATTAGGGGGATGGAGG - Intronic
1076330662 10:129662746-129662768 AAATGAAACCATAGGGAAGCAGG + Intronic
1076815730 10:132913894-132913916 AACTGGAACGAGGGGGCTGCTGG - Intronic
1077026512 11:442227-442249 ACCTGGTCCTAGGGGGAAGCAGG + Intergenic
1077199743 11:1300010-1300032 GAATGGAACTCGAGGGAAACAGG + Intronic
1077211013 11:1370974-1370996 ACCAGGGACTGGAGGGAAGCTGG + Intergenic
1077536068 11:3124871-3124893 AGCTGCATCTAGTGGGAAGCTGG - Intronic
1077559649 11:3251353-3251375 AACTGAAACTAGAGGCAAGAGGG - Intergenic
1077565542 11:3297156-3297178 AACTGAAACTAGAGGCAAGAGGG - Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078885299 11:15493996-15494018 AACAGGAAATTAAGGGAAGCTGG + Intergenic
1080105268 11:28505078-28505100 GACTGGACCTGGTGGGAAGCTGG + Intergenic
1080395705 11:31887894-31887916 AACTGGAATTAGCAGGATGCTGG + Intronic
1080813764 11:35733563-35733585 CACTCCAACTAGAGGGAAGTAGG - Intronic
1081061272 11:38481304-38481326 AACTGATACAGGAGGGAAGCAGG + Intergenic
1081298264 11:41418915-41418937 AAGTGAAAGTAGAGGAAAGCTGG + Intronic
1083459899 11:62804209-62804231 AACTGGAATTAGAGAGAAGCAGG + Intronic
1083567799 11:63734818-63734840 AAATGGAAATAGAAGGAATCAGG + Intronic
1087343120 11:96934471-96934493 CAAAGGAACTAGATGGAAGCAGG + Intergenic
1091111903 11:132977423-132977445 AGCTAAATCTAGAGGGAAGCTGG - Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1092594442 12:9986019-9986041 AGCTGGGCCTAGAGGGAAGGGGG + Intronic
1093423768 12:19004432-19004454 AAGTGGAACTAGGGCGAAGAGGG - Intergenic
1095528553 12:43157439-43157461 ATCTGGAAATGGAGGGAAGGTGG + Intergenic
1096312268 12:50531676-50531698 AAGTGGAAGTAGAGGCAGGCGGG + Intronic
1096778957 12:53981256-53981278 AACAGGTACTAGAGGGAGGTAGG - Intergenic
1096792113 12:54051833-54051855 GGCTGGAATGAGAGGGAAGCTGG - Intronic
1097440258 12:59599204-59599226 AAGCAGAACTAGAGGGAAGGAGG + Intronic
1097844958 12:64356724-64356746 TACTGAAACTAGAGGCAAGGGGG + Intronic
1097995468 12:65882990-65883012 AACTCCAACTAGGAGGAAGCAGG + Intronic
1098852210 12:75610422-75610444 AACTAAAACTAGAAGAAAGCTGG + Intergenic
1100788180 12:98101138-98101160 AACAGGAAATATAGGGGAGCTGG + Intergenic
1103131840 12:118475735-118475757 TAGGGGAAGTAGAGGGAAGCTGG + Intergenic
1103651267 12:122434375-122434397 ATTTGGAACTAGAGGAAAGGTGG + Intergenic
1104274133 12:127309239-127309261 AACTGGAGCTGAAGGGAAGTGGG + Intergenic
1104681456 12:130754861-130754883 AGCAGGAACCAGAGGGAAGCAGG + Intergenic
1104884232 12:132095848-132095870 TACTGAAACTAGAGGCAAGGGGG - Intronic
1105414729 13:20200396-20200418 AACTTAAATTATAGGGAAGCTGG + Intergenic
1105694563 13:22875035-22875057 AACTGGAACTCTAAGGAAACAGG + Intergenic
1106222066 13:27754629-27754651 TACTGAAACTAGAGGCAAGGGGG - Intergenic
1107125416 13:36840513-36840535 TACTGATACTAGAGGGAGGCAGG - Intergenic
1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG + Intergenic
1108008144 13:45973862-45973884 AAATGTAAGGAGAGGGAAGCAGG + Intronic
1108475023 13:50807412-50807434 AACTGGTGCTTGAGAGAAGCAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111997320 13:95177561-95177583 AAATGGATCTTCAGGGAAGCAGG + Intronic
1111998144 13:95184991-95185013 AAATGGATCTTCAGGGAAGCAGG + Intronic
1112006180 13:95255671-95255693 AACAGGTAGTAGAGTGAAGCGGG - Intronic
1113196546 13:107814499-107814521 AACAGCAACTACAGGAAAGCTGG + Intronic
1113744334 13:112732407-112732429 AGCTGGAGAGAGAGGGAAGCAGG - Intronic
1113818230 13:113190605-113190627 AAATGGCACTAGACGGAAACTGG + Intronic
1114223228 14:20715552-20715574 TACTGAAACTAGAGGCAAGGAGG + Intergenic
1114224636 14:20726227-20726249 TACTGAAACTAGAGGCAAGGAGG + Intergenic
1114711251 14:24780729-24780751 GACTGGAGATAGAGGGAAACAGG + Intergenic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118375014 14:65169278-65169300 AACTGGAAGCAGAGGTCAGCTGG + Intergenic
1119437155 14:74605075-74605097 CACTGGAACTAGAGGGTAAGAGG + Intronic
1119727698 14:76932065-76932087 GACTGAAGCTAGAGGGCAGCTGG - Intergenic
1120128907 14:80781662-80781684 GAAAGGAACTAGAGGGAAGTAGG + Intronic
1120418430 14:84250419-84250441 AACTGGATCCAGAGGGAATGGGG + Intergenic
1122736919 14:103848277-103848299 AGCTGGACCTCGAGGGATGCTGG - Intergenic
1122777539 14:104127918-104127940 AACTGGAACTAAAGGAAGGCTGG - Intergenic
1123774558 15:23565949-23565971 GACTGGAGCTACAGGGAAGGGGG - Exonic
1125286271 15:38095889-38095911 GATTGGAGCTAGAGGGAAGAGGG - Intergenic
1125609367 15:40960368-40960390 CACTGGAGATAGAGGCAAGCAGG + Intergenic
1126269706 15:46800223-46800245 ATCTGGAACTTTGGGGAAGCTGG + Intergenic
1128402937 15:67303268-67303290 GCCTGGAACTAGTGGGAAGAGGG + Intronic
1128552995 15:68610169-68610191 CACTGGAACCAGAGGGCTGCAGG - Intronic
1129105016 15:73301163-73301185 TACTGGAATAAGAGGGAAGGAGG - Intronic
1129313966 15:74729931-74729953 CACTAGAACTAGAGGCAGGCAGG - Intergenic
1132993097 16:2807526-2807548 AACTGGAAGGAGAGTGGAGCTGG + Intergenic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133429724 16:5726038-5726060 AAAAGGAAGTAGAGAGAAGCAGG - Intergenic
1134299356 16:12975750-12975772 GACTGGAAAAAGAGGGAAGATGG + Intronic
1134834917 16:17353200-17353222 AGCTAGAGTTAGAGGGAAGCAGG - Intronic
1136393667 16:29981216-29981238 AACTGGTATAAGAGGGAAACAGG - Intronic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1143595339 17:7910597-7910619 AACTGGAGCTAGGGGGAAAGAGG - Intronic
1143610385 17:8014580-8014602 AACTAGCAGTAGAAGGAAGCTGG - Exonic
1143893005 17:10116612-10116634 AAGTGGACTTAGAGGGCAGCTGG + Intronic
1145107224 17:20128710-20128732 AAGTAGAACTTGGGGGAAGCTGG - Intronic
1145992133 17:29085647-29085669 AACTGGAAATAGAAGGAAAATGG + Exonic
1146561070 17:33871160-33871182 CACAGGAACTAGAAGGAATCTGG - Intronic
1146942837 17:36855604-36855626 ACCTGGAACCAGAGAGAAGAGGG + Intergenic
1147421171 17:40322834-40322856 ACCTGGAGCTGGAGGGAAGGGGG - Intronic
1149360463 17:55889617-55889639 AAGAGGAAGAAGAGGGAAGCTGG - Intergenic
1149510551 17:57237545-57237567 AGCTGGACCTTCAGGGAAGCAGG - Intergenic
1151685812 17:75646084-75646106 CACTGGCACAATAGGGAAGCTGG - Intronic
1151734150 17:75928350-75928372 AAATGGAACTAAAGGTAAGCAGG + Intronic
1153169794 18:2302980-2303002 TACTGAAACTGGAGGCAAGCGGG - Intergenic
1154157684 18:11956752-11956774 TACTGAAACTAGAGGCAAGGGGG - Intergenic
1155561345 18:27080687-27080709 CACTGGAACTAGGGGCAAGTAGG + Intronic
1156524669 18:37755699-37755721 AACTGGGAATGGAGGAAAGCTGG - Intergenic
1157752046 18:50187866-50187888 AACTGTCACTAGAGGGGGGCAGG + Intronic
1161558280 19:4956694-4956716 AACTGGAACTAGAGGGAAGCGGG - Exonic
1163350987 19:16777035-16777057 AAAGGGAACTGGAGGGAAGAGGG + Intronic
1164699119 19:30269878-30269900 AACTGGAACCAGCTAGAAGCGGG - Intronic
1165186615 19:34027930-34027952 AACTGAAACTTTAAGGAAGCAGG + Intergenic
1165325384 19:35111629-35111651 GGCAGGAACTACAGGGAAGCAGG - Intergenic
1165925220 19:39321911-39321933 AACTGGAGCAAGAAGGAGGCAGG - Intergenic
1167555732 19:50194220-50194242 AACTGGATGTAGAGGTAAGAAGG + Intronic
1168483755 19:56743168-56743190 CACTGGAACTCGAGAGAAGGAGG + Intergenic
925391023 2:3494191-3494213 GACTGGAACTAGGTGGAAGCAGG - Intergenic
925442640 2:3901530-3901552 AAGTGGTACTAGAGGAAAACAGG - Intergenic
926258923 2:11238483-11238505 ATCTGGAACTAGAACAAAGCAGG + Intronic
926771258 2:16378042-16378064 GATTGGAGCTAGAGAGAAGCTGG - Intergenic
927083228 2:19650833-19650855 AATTGGAGCTAGAGGGAACTGGG - Intergenic
927437772 2:23084890-23084912 AACTGGAAGTTGAGTGAAGAGGG + Intergenic
930063227 2:47308205-47308227 AACTGCTACTAGAAGGAAGCTGG - Intergenic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
932368213 2:71166619-71166641 AACTGGGCCTAGAGGGAAGGGGG - Intergenic
932583074 2:73005133-73005155 AAGTGGAAGGAGAGGGAAACAGG + Intronic
932850291 2:75178056-75178078 TTCTGGATCTAGAGGGAAGGTGG - Intronic
933287717 2:80402250-80402272 AAATGGAAGTACAGGGAAGGTGG - Intronic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
936718869 2:115224508-115224530 ACCTGGAGCTGGAGGGAAGGTGG + Intronic
937685042 2:124686522-124686544 ATCTGGAACAAAGGGGAAGCTGG - Intronic
937881954 2:126875084-126875106 TACTGAAACTAGAGGCAAGGGGG - Intergenic
939411784 2:141836556-141836578 AACTGTCACTTGATGGAAGCTGG + Intronic
941036566 2:160575349-160575371 AACTGGAGATAGTGGGAAGGTGG - Intergenic
941528930 2:166640539-166640561 ACCTGGAAAGAGAGGAAAGCTGG - Intergenic
942006620 2:171708275-171708297 AACTTCAACTAGAGGGACTCAGG - Intronic
945483200 2:210365793-210365815 TACTGAAACTAGAGGCAAGGGGG + Intergenic
946011278 2:216565620-216565642 TACTGAAACTAGAGGCAAGGGGG + Intronic
1170627470 20:18040677-18040699 AACTGGAACTGGGGAGAACCTGG + Intronic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1175816839 20:61887361-61887383 GACTGCCACTAGAGGGCAGCTGG - Intronic
1176923133 21:14713443-14713465 AACAGTAACTAGAAGAAAGCTGG + Intergenic
1180018573 21:45104143-45104165 AAGTGGAAGGAGAGGGTAGCAGG - Intronic
1181610823 22:24010651-24010673 AACTTGACTTAGAGGGAACCAGG - Intergenic
950191545 3:10980174-10980196 AACTGGAAGTAGAGAGAGGAGGG + Intergenic
952821503 3:37490243-37490265 TACTGAAACTAGAGGCAAGGGGG + Intronic
953702267 3:45206084-45206106 AGCTGGAACTACAGGCATGCAGG + Intergenic
954180912 3:48880708-48880730 AGCTGGGACTACAGGCAAGCCGG + Intronic
954230253 3:49211302-49211324 AATTAGAACTAAATGGAAGCCGG - Intronic
954277268 3:49550727-49550749 AACTGGACTTATGGGGAAGCAGG + Intergenic
954520966 3:51225989-51226011 AACTGGAGCAAGAGGGATTCAGG - Intronic
955390727 3:58520595-58520617 AACTGCAACTTGAGGGAAGAGGG - Intronic
955439953 3:58944752-58944774 AACTGGATCCAGAATGAAGCAGG - Intronic
955470792 3:59283865-59283887 AAAAGGAACCAGAGGCAAGCTGG - Intergenic
957219922 3:77369143-77369165 TCCTGGGACTAGAGTGAAGCAGG + Intronic
959117776 3:102197793-102197815 ACCTGGAACCAGGTGGAAGCTGG - Intronic
959320807 3:104872639-104872661 AACTGGTAGCAGTGGGAAGCTGG - Intergenic
959348976 3:105236491-105236513 AAGAAGAACTAGAGGAAAGCTGG + Intergenic
961554591 3:127689355-127689377 ACCTGGAAGTGGAGGGAAGCTGG + Exonic
961647288 3:128399441-128399463 AAAAGGAATTAGGGGGAAGCAGG - Intronic
966299658 3:178463633-178463655 ACATGGAAGTAGAAGGAAGCTGG - Intronic
966770592 3:183500327-183500349 AACAAGAACTAGAAGGAATCAGG + Intronic
966937651 3:184723510-184723532 AACTGGAAAAAGATAGAAGCTGG - Intergenic
970785804 4:19794514-19794536 AACTGGACATAGAGAGAAGAAGG - Intergenic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
971319701 4:25595497-25595519 AACTGGAATTAAAGGAAAGAGGG - Intergenic
973846500 4:54918171-54918193 AACTGGAACCTGAGAGAAGGAGG + Intergenic
974611036 4:64215934-64215956 ACCTTAAACTAGAGGGAAGGTGG - Intergenic
975577365 4:75876401-75876423 AACTGGAGCTAGAGCGGTGCCGG - Exonic
978272218 4:106904608-106904630 AACTGGAAAGAGAGGGTAGCAGG - Intergenic
980396947 4:132226787-132226809 AACAGGAAATGAAGGGAAGCTGG + Intergenic
981912528 4:149998201-149998223 GCATGGAAGTAGAGGGAAGCAGG - Intergenic
982435439 4:155379396-155379418 GACGGGAATTAGAGGGAAGGTGG - Intergenic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
983679522 4:170336621-170336643 AAATGAAACTGCAGGGAAGCTGG - Intergenic
985500408 5:240551-240573 AACTAGATCTAGGGGGATGCAGG + Intronic
985736989 5:1589150-1589172 AACTAGATCTAGGGGGATGCAGG - Intergenic
985797260 5:1972384-1972406 AACTGGAGCTTGCGGGGAGCTGG + Intergenic
985797285 5:1972502-1972524 AACTGGAGCTTGCGGGGAGCTGG + Intergenic
985797293 5:1972536-1972558 AACTGGAGCTTGCGGGGAGCTGG + Intergenic
985797308 5:1972604-1972626 AACTGGAGCTTGTGGGGAGCTGG + Intergenic
986243732 5:5985515-5985537 ACCTGGAACCAGAGAGAGGCAGG - Intergenic
986514222 5:8543691-8543713 AGTTTGAACTGGAGGGAAGCTGG + Intergenic
987957519 5:24760524-24760546 AACTGAAACCAAAGGTAAGCAGG - Intergenic
988433446 5:31146227-31146249 AACTAGAACTAGAAGGGAGAGGG + Intergenic
988913512 5:35869800-35869822 CCCTGGACTTAGAGGGAAGCAGG - Intronic
989261568 5:39424764-39424786 AAATGGAGCCAGAGGGAAGAAGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
992156178 5:73957431-73957453 AACAGGAGCTAAAGGGAAGTAGG - Intergenic
992193104 5:74313328-74313350 AACTGGAAGTGGAGGGCAGGGGG - Intergenic
994213115 5:97108207-97108229 AACTGTTACTAGAAGGAAGGTGG - Intronic
995407663 5:111819101-111819123 TACTGAAACTAGAGGCAAGCAGG - Intronic
996508937 5:124297684-124297706 AACTGAAACTTTAAGGAAGCAGG - Intergenic
997691810 5:135832343-135832365 ATCTGGAAGCAGAGGGGAGCAGG + Intergenic
997895756 5:137715417-137715439 AATGGGAACTAGAGAGAGGCTGG - Intronic
999730683 5:154474840-154474862 AACTTGAAATCAAGGGAAGCCGG - Intergenic
1000945045 5:167412125-167412147 CACTGGAACCAGAGGGATCCTGG - Intronic
1003255467 6:4471359-4471381 TACTGAAACTAGAGGCAAGGGGG - Intergenic
1003299532 6:4865052-4865074 TACTGAAACTAGAGGCAAGGGGG - Intronic
1004312576 6:14558563-14558585 AACTGGAATGAGGGGGAAACGGG - Intergenic
1004503515 6:16229340-16229362 ATCTGGAAAAAGAGGGAGGCAGG - Intergenic
1005468818 6:26141792-26141814 AGCTGGAACTAGTGGGCAGAGGG - Intergenic
1005817232 6:29563540-29563562 TACTGAAACTAGAGGCAAGAGGG + Intronic
1006714797 6:36110279-36110301 AACTGGAGCAAGAAGGAAGGAGG + Exonic
1007115608 6:39341097-39341119 GGCTGGAGCTAAAGGGAAGCAGG - Intronic
1007612463 6:43159387-43159409 ACCTGGAACCAGAGGGACTCAGG - Intronic
1008627171 6:53328004-53328026 AAACGGAACTAGAGGGATACAGG - Intronic
1009589744 6:65652107-65652129 AGCTCAAACTAGAGGGAAGCTGG + Intronic
1010425479 6:75724558-75724580 AACTGGAAGAAGAGAGAAGATGG + Intergenic
1011466642 6:87664810-87664832 AACTGCACCTAGAGTGTAGCAGG + Exonic
1012588706 6:100952894-100952916 AACTGTATTTAGAGAGAAGCTGG - Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1015444693 6:133289315-133289337 ATCAGGAAGTAGATGGAAGCAGG + Intronic
1016380638 6:143475008-143475030 TACTCAAACTGGAGGGAAGCAGG + Intronic
1018083797 6:160282895-160282917 ATCTGTACCTAGAGGGAAACTGG - Intergenic
1018684993 6:166297526-166297548 AACTGGATCCAGGGGGCAGCCGG - Intergenic
1018987103 6:168646218-168646240 ATCGGGAACACGAGGGAAGCAGG - Intronic
1020793981 7:12660415-12660437 AACTGGAATTAGAGGGACAGGGG - Intergenic
1021909191 7:25367146-25367168 GACAGGAAGTAGAAGGAAGCGGG + Intergenic
1022014734 7:26339659-26339681 AGCTGGAATTACAGGGTAGCTGG + Intronic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1025111551 7:56221158-56221180 AGCTGGGACTAGAGGCATGCTGG - Intergenic
1026952474 7:74356709-74356731 AACTGGAACTAGAGTAAGTCAGG - Intronic
1027456219 7:78394974-78394996 AACTGGATCTACAACGAAGCTGG + Intronic
1027747419 7:82094899-82094921 AGCTGGAATTAGAGGGAGGGAGG - Intronic
1028809637 7:95069428-95069450 AAATGGAAGGAGAGGGAAGGAGG + Intronic
1029002081 7:97164889-97164911 AACTGAAACTATAGGAAAGATGG + Intronic
1029288771 7:99485457-99485479 AAAAGGAACCAGAGGGAAGTAGG - Intronic
1030210825 7:106994111-106994133 ATATGGAAGTAGAAGGAAGCAGG - Intergenic
1031375963 7:121026279-121026301 AACTGAAACTGTAAGGAAGCAGG - Intronic
1031645942 7:124224882-124224904 TACTGGCACTAGAGCCAAGCTGG - Intergenic
1034652721 7:152704636-152704658 TACTGAAACTAGAAGGAAGGGGG - Intergenic
1036954325 8:13171138-13171160 AATTGCAACTAGAGGGGAGGAGG - Intronic
1037033864 8:14142384-14142406 AACAGGAACAGGAGGGGAGCTGG + Intronic
1038591899 8:28846913-28846935 TACTAGAGCTGGAGGGAAGCTGG + Intronic
1038960158 8:32509546-32509568 AATTGGAATTTGAGGGATGCAGG + Intronic
1040650523 8:49443857-49443879 AACAGGAACTAGAGAGGGGCAGG + Intergenic
1042217138 8:66438239-66438261 TACTGGAACCAGAGAGTAGCAGG + Intronic
1042476252 8:69251345-69251367 ACCTGGAACTAGACTGAAGCTGG - Intergenic
1048214457 8:132481564-132481586 ACCACGAACTAGAGGGAAGAGGG - Intergenic
1049679173 8:143909799-143909821 AACTGGAAGCTGAGGGACGCAGG - Intergenic
1050727564 9:8669201-8669223 TACTGTTACTAGAGGGTAGCGGG + Intronic
1051077471 9:13257070-13257092 AACAGCAGCTAGAGGGAAACTGG - Intronic
1051693354 9:19741285-19741307 AAGGGGAGCTAGAGGGAAGTGGG + Intronic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1054376458 9:64453489-64453511 AAATGGAACTGCAGGGATGCAGG - Intergenic
1057349248 9:94280936-94280958 TACTGAAACTAGAGGCAAGGGGG + Intronic
1058426088 9:104876291-104876313 AACGGGGAACAGAGGGAAGCTGG + Intronic
1059512182 9:114859129-114859151 AAATGGAACTAGCAGAAAGCAGG - Intergenic
1060973841 9:127753824-127753846 AGCTGGAGCTAGAGGGACGTGGG + Intronic
1061717094 9:132525752-132525774 ATTGGGAAATAGAGGGAAGCAGG - Intronic
1187198232 X:17109112-17109134 AACTGGAACTGGAAGTGAGCAGG - Intronic
1188808487 X:34621634-34621656 AAGTGGCACTAGAGTGAAGGCGG + Intergenic
1189201807 X:39202767-39202789 GCCTGCAACTAGAGGGCAGCTGG - Intergenic
1189630555 X:42948068-42948090 AATTGGAACAAAAGGCAAGCAGG - Intergenic
1189901229 X:45708483-45708505 GACTGGAACTGGAGGGGAGGGGG + Intergenic
1190856563 X:54300940-54300962 AGCTGAAACTAAAGGGAGGCAGG + Intronic
1192145182 X:68677468-68677490 AACTGGAACAAGAGGCAATGGGG - Intronic
1196196958 X:112846706-112846728 AGCCGGAGCAAGAGGGAAGCAGG + Intergenic
1197146739 X:123180261-123180283 AAATGGAACTATAGAGAAGTAGG + Intergenic
1197315419 X:124959960-124959982 AACTGGAAATAATGGGATGCAGG - Intronic
1197609963 X:128627051-128627073 AAGTGGAACTAAAGAGAAGTAGG + Intergenic
1201296690 Y:12469444-12469466 TACTGAAACTAGAGGCAAGGGGG + Intergenic