ID: 1161560356

View in Genome Browser
Species Human (GRCh38)
Location 19:4969430-4969452
Sequence CGCCCCCGCCCGAAAACCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161560356_1161560367 9 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560367 19:4969462-4969484 GACAATGGCGGGGCGCGCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 75
1161560356_1161560374 22 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560374 19:4969475-4969497 CGCGCCCAGGGGCGGGAGCGGGG 0: 1
1: 0
2: 0
3: 38
4: 350
1161560356_1161560363 -3 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560363 19:4969450-4969472 GCGGCGGGGCCGGACAATGGCGG 0: 1
1: 0
2: 3
3: 6
4: 124
1161560356_1161560368 10 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560368 19:4969463-4969485 ACAATGGCGGGGCGCGCCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 27
1161560356_1161560362 -6 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560362 19:4969447-4969469 GGGGCGGCGGGGCCGGACAATGG 0: 1
1: 0
2: 9
3: 23
4: 281
1161560356_1161560375 23 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560375 19:4969476-4969498 GCGCCCAGGGGCGGGAGCGGGGG 0: 1
1: 0
2: 2
3: 70
4: 619
1161560356_1161560370 14 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560370 19:4969467-4969489 TGGCGGGGCGCGCCCAGGGGCGG 0: 1
1: 0
2: 4
3: 27
4: 372
1161560356_1161560373 21 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560373 19:4969474-4969496 GCGCGCCCAGGGGCGGGAGCGGG 0: 1
1: 0
2: 1
3: 56
4: 406
1161560356_1161560365 -1 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560365 19:4969452-4969474 GGCGGGGCCGGACAATGGCGGGG 0: 1
1: 0
2: 1
3: 27
4: 166
1161560356_1161560371 15 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560371 19:4969468-4969490 GGCGGGGCGCGCCCAGGGGCGGG 0: 1
1: 1
2: 9
3: 122
4: 781
1161560356_1161560372 20 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560372 19:4969473-4969495 GGCGCGCCCAGGGGCGGGAGCGG 0: 1
1: 0
2: 0
3: 45
4: 465
1161560356_1161560369 11 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560369 19:4969464-4969486 CAATGGCGGGGCGCGCCCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 76
1161560356_1161560364 -2 Left 1161560356 19:4969430-4969452 CCGCTGGTTTTCGGGCGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1161560364 19:4969451-4969473 CGGCGGGGCCGGACAATGGCGGG 0: 1
1: 0
2: 3
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161560356 Original CRISPR CGCCCCCGCCCGAAAACCAG CGG (reversed) Intronic
902814320 1:18907608-18907630 CGCCCCCGCCCTGAACCCAGAGG + Exonic
905890061 1:41513208-41513230 CTCCCCGGCCCGAGAACCACAGG - Exonic
1070141408 10:73740912-73740934 CGCCCCAGCCAGAAACCTAGAGG - Intergenic
1085276658 11:75304566-75304588 CGCCCCCGGCTGAGAACCAACGG - Intronic
1085641764 11:78197214-78197236 CTCCCCCGCCCCAAATCCTGTGG - Intronic
1089792832 11:120956867-120956889 ACCCCCCGACCGGAAACCAGAGG - Exonic
1091279971 11:134376180-134376202 CCCCCACGCCCGAACAGCAGGGG + Exonic
1102962109 12:117099521-117099543 CGCCCCGGCCCGGAAACCGCCGG + Intergenic
1103933658 12:124463831-124463853 CCCCCACGCCCCCAAACCAGAGG + Intronic
1106443389 13:29801025-29801047 TGCCCCTACCCGAACACCAGTGG + Intronic
1131688193 15:94793878-94793900 CCACCCCTCCCGGAAACCAGTGG - Intergenic
1136909283 16:34133336-34133358 CGCCCACGCGGGAAAGCCAGCGG - Intergenic
1148114879 17:45169721-45169743 GGCTCCGGACCGAAAACCAGCGG + Exonic
1153900593 18:9614446-9614468 CGCCGCCGCCCGGAGAACAGGGG + Intronic
1161560356 19:4969430-4969452 CGCCCCCGCCCGAAAACCAGCGG - Intronic
1163389573 19:17022139-17022161 CACGCCCGCGCGAAAAACAGAGG + Exonic
1163783355 19:19261805-19261827 CCCCCCCACCCCAAAACCCGAGG + Intronic
1164051317 19:21587294-21587316 CGCCCCCGCCCCTACGCCAGCGG + Intergenic
1164485901 19:28655356-28655378 AGCCCCACCCCCAAAACCAGTGG + Intergenic
1165130171 19:33627088-33627110 CGCCCCCCCCCCAAAAAAAGAGG - Intronic
948628409 2:239284720-239284742 CGCCCACGCCCCAGAGCCAGAGG + Intronic
1171779752 20:29408480-29408502 CGCCCAAGCGGGAAAACCAGCGG - Intergenic
1171813712 20:29764600-29764622 CGCCCACGCGGGAAAACCAACGG + Intergenic
1172421879 20:34825240-34825262 CGCCCCCGCCCGCAGGCCTGGGG + Intronic
1173548602 20:43916724-43916746 CACCCACACCCGCAAACCAGAGG - Intronic
1173797578 20:45873009-45873031 TGCCCCAGCCCAAAGACCAGGGG - Intronic
1173951843 20:46999671-46999693 CACCCCCGCCCCAACCCCAGTGG + Intronic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1179103430 21:38376875-38376897 CACTCCCGCCCTAAAACCAAAGG + Intergenic
1180338169 22:11598241-11598263 CGCCCACGCGGGAAAACCAGCGG - Intergenic
1180732129 22:17990008-17990030 CGCCCCTGCCCTAAAACCCAGGG + Intronic
955574679 3:60347666-60347688 CCCCCCCCCCCCCAAACCAGTGG - Intronic
957085373 3:75672144-75672166 CGCCCACGCGGGAAAACCAACGG + Intergenic
964606205 3:158562819-158562841 CGACCCCGCCCGACAACCTCTGG + Intergenic
971757169 4:30720032-30720054 CACCCCCGCCCGAAAGCCTTTGG + Intergenic
997641175 5:135449815-135449837 TGCCCCCGTCCGAGAAGCAGAGG + Exonic
1010678869 6:78776007-78776029 TTCCCCACCCCGAAAACCAGAGG - Intergenic
1011734457 6:90297081-90297103 CGCCCCCTCCCGCGAGCCAGCGG - Intergenic
1015181403 6:130365877-130365899 CGCCGCCGCCCCAAAACCTGTGG - Intronic
1016431433 6:143989997-143990019 TGCACCCTCCCTAAAACCAGAGG + Intronic
1020560603 7:9726353-9726375 CACGCCCGCGCGAAAAACAGAGG - Intergenic
1023993691 7:45146011-45146033 GGCCACCCACCGAAAACCAGAGG + Intergenic
1024019369 7:45351501-45351523 CACCCCCGCCCCAATATCAGGGG + Intergenic
1037662112 8:20936724-20936746 CACCCCTGCCCAAACACCAGTGG - Intergenic
1054254423 9:62799772-62799794 CGCCCACGCGGGAAAACCAACGG + Intergenic
1189334270 X:40161089-40161111 CGCTCCAGCCCGAGAGCCAGAGG - Intronic
1191065628 X:56343882-56343904 AGCCCCCACCCCGAAACCAGAGG - Intergenic