ID: 1161564077

View in Genome Browser
Species Human (GRCh38)
Location 19:4989988-4990010
Sequence CTTTAGAAACAGTTTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161564072_1161564077 -9 Left 1161564072 19:4989974-4989996 CCCTTGTTAATTTCCTTTAGAAA 0: 1
1: 0
2: 6
3: 84
4: 732
Right 1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG 0: 1
1: 0
2: 2
3: 42
4: 337
1161564073_1161564077 -10 Left 1161564073 19:4989975-4989997 CCTTGTTAATTTCCTTTAGAAAC 0: 1
1: 0
2: 3
3: 39
4: 430
Right 1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG 0: 1
1: 0
2: 2
3: 42
4: 337
1161564070_1161564077 27 Left 1161564070 19:4989938-4989960 CCACGGTGTCTGACTCAGTCTTC 0: 1
1: 0
2: 0
3: 14
4: 192
Right 1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG 0: 1
1: 0
2: 2
3: 42
4: 337
1161564071_1161564077 5 Left 1161564071 19:4989960-4989982 CCTTTTCATGTCATCCCTTGTTA 0: 1
1: 0
2: 0
3: 15
4: 248
Right 1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG 0: 1
1: 0
2: 2
3: 42
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161564077 Original CRISPR CTTTAGAAACAGTTTGGGCC AGG Intronic
901418972 1:9137374-9137396 CCTTAGAAACAGCCTGGTCCTGG + Intergenic
901636462 1:10672500-10672522 CTTTGAAAACAGATTGGGCCCGG - Intronic
902537538 1:17129172-17129194 ATTTAAAAAGAGTTTAGGCCAGG - Intergenic
902908183 1:19574871-19574893 CTTTAAAAATATTTTAGGCCAGG - Intergenic
903290495 1:22310800-22310822 TTTTACAAACAGCTTTGGCCGGG - Intergenic
903640504 1:24856731-24856753 TTTCAAAACCAGTTTGGGCCGGG - Intergenic
903877651 1:26486484-26486506 CTTTAAAAACTGTTTAGGGCCGG + Intergenic
903942174 1:26939311-26939333 CTCTAAAAACAGTCTTGGCCAGG - Intronic
903944684 1:26954535-26954557 CTTTAAAAAAAGGTTAGGCCAGG + Intronic
904233609 1:29098488-29098510 CTTTAAAAAAAATTTAGGCCAGG - Intronic
905423084 1:37861428-37861450 ATTTAAAAACATTTTAGGCCAGG + Intronic
905736887 1:40335176-40335198 TCTAAGAAACATTTTGGGCCAGG + Intergenic
905910038 1:41647431-41647453 CTGTGGAAACAGCTTGTGCCCGG - Intronic
906497669 1:46317007-46317029 TTTTAAAAATATTTTGGGCCGGG + Intergenic
906776917 1:48538108-48538130 ATTTAGAAACAATCTGGGACAGG + Intronic
907506866 1:54925477-54925499 CTGTAGAATCAGTGTGGGTCAGG - Intergenic
908724580 1:67161919-67161941 CTTTAAAAATATTTTGGGCCTGG - Intronic
908909920 1:69061603-69061625 CTTTAGGAACAGTTTAGGGAGGG - Intergenic
909247585 1:73307162-73307184 TTTTAGAACCAGTTTGGCTCTGG + Intergenic
916680333 1:167098302-167098324 TCTTAAAAAAAGTTTGGGCCGGG - Intronic
916799642 1:168204373-168204395 TTTTAAAAAGAGCTTGGGCCAGG - Intergenic
917125741 1:171686011-171686033 CTTTAGAAACAGTTGGCTACAGG + Intergenic
917396292 1:174598033-174598055 TTTTAAAAACATTTTAGGCCAGG + Intronic
919140588 1:193566683-193566705 CTTTAGAAACACTTTATCCCAGG + Intergenic
919621403 1:199868104-199868126 CTATACAAACAGTGTGTGCCAGG + Intergenic
921113536 1:212063579-212063601 CTTTAAAATCAGGCTGGGCCTGG - Intronic
921224838 1:213008157-213008179 CATAAGAAAAAGTTGGGGCCGGG - Intronic
921428048 1:215028089-215028111 CTTTAAAAATAGCTTGGGCTGGG + Intronic
921556925 1:216610228-216610250 CTTTAGAAACATTTTGGAACTGG - Intronic
923349955 1:233094565-233094587 TTTTAAAAAAAGTTAGGGCCTGG + Intronic
924055391 1:240119426-240119448 CTTTAGAGAGAGGTTAGGCCTGG + Intronic
924578649 1:245303491-245303513 CTTTAAGAACATTTAGGGCCGGG - Intronic
924861542 1:247928797-247928819 CTAAAGAAACAGGATGGGCCGGG + Intergenic
1063613715 10:7584598-7584620 CTTTAGAAAATGGCTGGGCCGGG - Intronic
1064500453 10:15966482-15966504 TTTTAGAAATAGTTTTAGCCAGG + Intergenic
1065033894 10:21618211-21618233 GTTTAAAAACATTTTGGGCTGGG + Intronic
1065053461 10:21819105-21819127 TTTTAAAAAAGGTTTGGGCCAGG + Intronic
1065192162 10:23222726-23222748 CTTTAGAAATAATTTCAGCCTGG + Intronic
1066197942 10:33119419-33119441 CTTTATAAAGTGTTTGGGCAGGG - Intergenic
1068081320 10:52321769-52321791 TTTTAGAAACTTTTTCGGCCGGG + Intergenic
1068436024 10:56992095-56992117 CTTTAGAGACAGTTTGAGCTGGG - Intergenic
1069398878 10:68020469-68020491 CTAAAAAAAAAGTTTGGGCCGGG + Intronic
1069557983 10:69410219-69410241 TTTTGGAAACAGTGTAGGCCAGG + Intronic
1070467941 10:76743772-76743794 CTATAAAAAAAGCTTGGGCCGGG + Intergenic
1070591370 10:77804185-77804207 TTATAGAAAAAGTTTAGGCCAGG - Intronic
1071081499 10:81817938-81817960 CTTAAGAACCACTTTGGGCCGGG + Intergenic
1071468743 10:85963578-85963600 CTTTGGAATCAGGTTGGGCGTGG - Intronic
1071541603 10:86489922-86489944 CTTAAGACACAGTTTTGGCTTGG + Intronic
1072131248 10:92496168-92496190 TTTAAGAAACACTTTAGGCCAGG - Intronic
1072205500 10:93201320-93201342 CCTGAGAAACTGTTAGGGCCTGG - Intergenic
1072433607 10:95395847-95395869 ATTTAGAAACAGTTTGAACAGGG + Intronic
1072504862 10:96055609-96055631 CTATAGAAACATTCTGGGGCTGG + Intronic
1073281326 10:102356468-102356490 CTTAAAAAACAAATTGGGCCGGG + Intronic
1073496798 10:103899064-103899086 TCTTAGCAGCAGTTTGGGCCTGG - Intronic
1074320701 10:112399295-112399317 CTTTAACAACAGTTTTGGCAGGG - Intronic
1075065326 10:119285431-119285453 TTTCAGAAACTGTCTGGGCCAGG - Intronic
1076002150 10:126920899-126920921 CTTTACAAAAAGTTCAGGCCGGG + Intronic
1077080759 11:723767-723789 CTTTGGAAACAGGTGGGGCTGGG - Intronic
1080854526 11:36100731-36100753 CTTAAGAAACTGTATAGGCCGGG - Intronic
1081237449 11:40662457-40662479 CTTAAAAAAGAGTTTGGGCAGGG + Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1084449097 11:69222292-69222314 CTTTAAAAACATTTGGGGCTGGG + Intergenic
1085576425 11:77608325-77608347 TTTTCAAAACATTTTGGGCCGGG + Intronic
1085774467 11:79352852-79352874 CTTAAGAAAGAACTTGGGCCTGG - Intronic
1085932943 11:81107047-81107069 CTTTTGTAAGAGTTTGGGGCTGG + Intergenic
1087199550 11:95331900-95331922 CTAGGGAAACAGTTTTGGCCAGG - Intergenic
1089741216 11:120585884-120585906 CTTGAGAAACTGATTGGGTCAGG + Intronic
1089762131 11:120735640-120735662 CTATAGACCCACTTTGGGCCTGG - Intronic
1089910554 11:122095633-122095655 TTTTAGAAAGAGGGTGGGCCGGG + Intergenic
1091511426 12:1131147-1131169 TTTTAGAACTAGTTGGGGCCAGG + Intronic
1091734525 12:2908715-2908737 ATTTAAAAACTTTTTGGGCCAGG - Intronic
1093331285 12:17844559-17844581 CTTTAGAAACAGAGTGGTGCTGG - Intergenic
1094145977 12:27228610-27228632 CTTTAAAAACATTTTAGGCCAGG - Intergenic
1094771160 12:33661450-33661472 ATTTACACACAGTTTGTGCCAGG - Intergenic
1096608673 12:52786882-52786904 GATTAGAAACAGTCAGGGCCTGG + Intergenic
1098448101 12:70588336-70588358 GTTTAAGAAAAGTTTGGGCCGGG + Intronic
1099977974 12:89566226-89566248 CTTTAAAAAAATTTTAGGCCGGG - Intergenic
1101270719 12:103141181-103141203 CTTTAGAAACAGTATTGTTCAGG - Intergenic
1101868451 12:108541831-108541853 CTTAAAAAAAAGTCTGGGCCGGG - Intronic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1102894666 12:116589153-116589175 ATGATGAAACAGTTTGGGCCAGG + Intergenic
1102949581 12:117021823-117021845 CTTTAGAAACAGTGAGGCACTGG - Intronic
1103768428 12:123300360-123300382 TTTTAGAAAATGTTTAGGCCAGG + Intronic
1105452031 13:20508549-20508571 TTTTAAAAACATTTTGGGCTGGG + Intronic
1106018270 13:25889865-25889887 CTTTAAAAACAAATTTGGCCGGG + Intronic
1108157122 13:47596651-47596673 CTTTAAAAGGAGTTTAGGCCGGG - Intergenic
1108545456 13:51488902-51488924 CTTTAAAAAGCCTTTGGGCCGGG + Intergenic
1108626611 13:52235010-52235032 CTTAAGAATCTCTTTGGGCCAGG - Intergenic
1108659459 13:52571481-52571503 CTTAAGAATCTCTTTGGGCCAGG + Intergenic
1108728947 13:53212783-53212805 CATTAAAAACATTTTTGGCCAGG - Intergenic
1108829706 13:54462352-54462374 CTTTAAAAAAATTTTTGGCCAGG + Intergenic
1109150190 13:58837172-58837194 CTTTAGAATAATTTTAGGCCAGG - Intergenic
1109428541 13:62200306-62200328 CTTTACAAAAATCTTGGGCCGGG + Intergenic
1110493708 13:76139831-76139853 ATTTTAAAACAGTTTTGGCCGGG + Intergenic
1111766985 13:92544261-92544283 CTTCAGAAACAGTTTGCTCCTGG - Intronic
1111876499 13:93903783-93903805 TTTTAAAAACAGTTGGGGCGGGG - Intronic
1114468638 14:22943205-22943227 TTTAAAAAATAGTTTGGGCCGGG + Intergenic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1118020046 14:61702130-61702152 CTTTAGAAATATTGTCGGCCCGG + Intronic
1119332880 14:73808430-73808452 TTTTAGAAAAATTTTAGGCCGGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119527994 14:75337836-75337858 TTTTAAAAAGAGTTTGTGCCAGG + Intergenic
1119583894 14:75813596-75813618 ATTCAAAAACAGTTTGGGCCAGG - Intronic
1121133027 14:91466555-91466577 CTTAAGAAACACTCTGGGCAGGG + Intronic
1121941471 14:98074887-98074909 CTTTGGAGCCAGTTTGGCCCAGG + Intergenic
1124033476 15:26032252-26032274 GTTTAGCTTCAGTTTGGGCCAGG - Intergenic
1126836514 15:52672039-52672061 CTTTAATAAGAGTCTGGGCCAGG + Intronic
1127191589 15:56537038-56537060 CTTTAAAAACTCTCTGGGCCAGG + Intergenic
1127484172 15:59404175-59404197 CTTTAGAAACAATTCAGGCCGGG - Intronic
1128448406 15:67785239-67785261 TTTAAGAAACAGTTCGGGGCCGG - Intronic
1128754604 15:70172977-70172999 CCTTAAAAGCAGTTTGGACCAGG - Intergenic
1130164712 15:81442122-81442144 CTTTAGAAAGGTATTGGGCCAGG - Intergenic
1130474641 15:84253686-84253708 CTGTCAAAACAGTTTGGACCTGG + Intergenic
1130482057 15:84367740-84367762 CTGTCAAAACAGTTTGGACCTGG + Intergenic
1130523816 15:84686096-84686118 TTTTAGAAATTGTTTGGGGCCGG - Intronic
1130586134 15:85184406-85184428 CTGTCAAAACAGTTTGGACCTGG + Intergenic
1131280474 15:91017225-91017247 ATATAAAAACAGTATGGGCCAGG + Intronic
1133079577 16:3307823-3307845 CTTTAAAAATATTTTAGGCCAGG - Intronic
1133451687 16:5909385-5909407 TTTTAGAAAGGGCTTGGGCCGGG - Intergenic
1135039945 16:19110620-19110642 CTTTACAAAAAGTGTGAGCCAGG + Intergenic
1135085006 16:19468268-19468290 CTTTAGAATCATTTCTGGCCGGG - Intronic
1136236666 16:28918315-28918337 CTTTCGAACCAGCCTGGGCCGGG + Intronic
1138015573 16:53425408-53425430 ATTTAAACACAGTTTGGACCGGG + Intergenic
1139129544 16:64124640-64124662 CATTAGAAACAGTCTGGGTTTGG - Intergenic
1139436031 16:66936884-66936906 CTTTTAAAATATTTTGGGCCAGG + Intronic
1140026688 16:71297365-71297387 CATTAGAAACTGTTTGGGAGTGG + Intergenic
1140212426 16:72981122-72981144 CTTTAGAGATAGCTGGGGCCCGG - Intronic
1141091819 16:81135576-81135598 CTTTCAAAACAGTCTGGGCACGG + Intergenic
1141225462 16:82110798-82110820 CTTTTATAACAGTGTGGGCCAGG - Intergenic
1141279483 16:82618125-82618147 CTTAAGAAATAGATTAGGCCAGG + Intergenic
1141295653 16:82766316-82766338 CTTCAGAAACAGTTTGGACCTGG - Intronic
1141539386 16:84707777-84707799 CTTAAGAAATATTTTGGGCCAGG + Intronic
1141561460 16:84870761-84870783 CATTATAAACAGTTGCGGCCAGG + Intronic
1142594838 17:1024489-1024511 ATATAAAAACAGTCTGGGCCAGG + Intronic
1144590487 17:16519688-16519710 CTATAAAAACAGTATGGGCTGGG - Intergenic
1144769273 17:17750424-17750446 CATTAGAAACATGATGGGCCGGG + Intronic
1144845221 17:18214234-18214256 CTTTAAAAAAATTTTGGGCCAGG + Intergenic
1145057757 17:19714519-19714541 CCTTTGAAAGAGTCTGGGCCAGG - Intronic
1145803432 17:27707136-27707158 CTTTAAAAACATTTTTGGGCTGG - Intergenic
1145874368 17:28305700-28305722 CATTAGAAACAGTTAAGGGCTGG - Intergenic
1146441140 17:32896209-32896231 TTTAAGAATCAGTTTAGGCCAGG - Intergenic
1146487093 17:33251823-33251845 CTTTAGAAACAACTTGGGGTGGG - Intronic
1146542497 17:33709666-33709688 TTTAAGAAATTGTTTGGGCCAGG - Intronic
1147355949 17:39896858-39896880 CTTTAGAAACCATTGGGGCCGGG - Intergenic
1147396306 17:40145465-40145487 TTTTAAAAAAATTTTGGGCCAGG - Intronic
1148264385 17:46213601-46213623 CATTAGAAAACGTTTGGGCCGGG - Intronic
1149712899 17:58758782-58758804 GTTTAAAAACAGTTTTTGCCGGG + Intronic
1150029086 17:61712507-61712529 TCATAGAAACAGGTTGGGCCAGG - Intronic
1150137157 17:62702352-62702374 ATTTAGAAACAGTTTAAGCCAGG + Intronic
1150324236 17:64243220-64243242 CTTTAAAAAAATTTTTGGCCGGG - Intronic
1151459950 17:74248510-74248532 CTTTAGAAAGAGTTTGGGGGAGG + Intronic
1152617674 17:81345450-81345472 CTGCAGGAACACTTTGGGCCGGG + Intergenic
1152966280 18:117784-117806 CTTTAAAAACACTGTTGGCCGGG - Intergenic
1153751288 18:8233233-8233255 TTTGAAAAACAGTTTGGGCCAGG - Intronic
1153902644 18:9631724-9631746 TTTTAAAAACAGTTTGGGCATGG - Intergenic
1154257140 18:12792574-12792596 CAAAAAAAACAGTTTGGGCCGGG - Exonic
1154349055 18:13567987-13568009 CATTAGAAACAAGTTTGGCCGGG + Intronic
1154478482 18:14791859-14791881 CTTTAGGAAAAGATTGGGCATGG + Intronic
1154927692 18:20954277-20954299 CTTTAAAAACACTGTTGGCCGGG + Intronic
1155136086 18:22994345-22994367 CTTTAAAAACATTGTTGGCCCGG + Intronic
1157172929 18:45424529-45424551 TTTTAGAAACAGTTTGCTCCTGG - Intronic
1157809091 18:50680385-50680407 TTTTAAAAAGAGTTTAGGCCAGG - Intronic
1159870919 18:73759126-73759148 CTTCAAAAACAGTTTAGGCCTGG - Intergenic
1159953926 18:74506429-74506451 CGTTAAAAACAGTCTGTGCCCGG - Intronic
1160287842 18:77562165-77562187 CTATAGAAACTGTTTGCCCCTGG - Intergenic
1160537400 18:79602396-79602418 CTTAAGAAATACTTTTGGCCGGG - Intergenic
1161087599 19:2342359-2342381 TTTAATAAACAGTTTGGGCACGG + Intronic
1161148020 19:2691246-2691268 CATTAGAAATGGTTTCGGCCTGG + Intronic
1161419195 19:4166689-4166711 CAATAGAAACAGATGGGGCCAGG - Intronic
1161436537 19:4267040-4267062 CTTGAGAAAGAGTTAGGGGCAGG - Intronic
1161514277 19:4688089-4688111 AATTAAAAACATTTTGGGCCAGG - Intronic
1161536182 19:4820123-4820145 TTTAAAAAAAAGTTTGGGCCAGG + Intronic
1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG + Intronic
1161917915 19:7243539-7243561 CTTAAGAAAAAATTTAGGCCAGG - Intronic
1163416648 19:17190938-17190960 TTTCAGAAATAGTCTGGGCCGGG - Intronic
1163516517 19:17767250-17767272 TTTTAAAAAATGTTTGGGCCTGG + Intronic
1164050616 19:21583284-21583306 TTATAGAAAATGTTTGGGCCGGG - Intergenic
1164713684 19:30376558-30376580 TTTCAGAAACAGAATGGGCCAGG + Intronic
1166952885 19:46441700-46441722 GTTTTCAAACAGTTTGGGACTGG - Intergenic
1167004950 19:46769672-46769694 TTTTAGAAAAAGTTTGAGCCAGG + Intronic
925229709 2:2222194-2222216 TTTTAGAAATATTTTGGGGCTGG + Intronic
925528641 2:4834456-4834478 CTTTCCAAACAATTTGGGTCAGG + Intergenic
926874016 2:17455342-17455364 CTTTAGAAAGTGTTTGGACTAGG + Intergenic
927301262 2:21518542-21518564 TTTTAGAAACAGTTTTCCCCTGG + Intergenic
928073396 2:28240572-28240594 TTTAAAAAACATTTTGGGCCAGG + Intronic
928147145 2:28789208-28789230 GTTTAGAAATATTTTGGGGCTGG + Intronic
928697295 2:33862138-33862160 ATTTAGAAATAGGGTGGGCCGGG - Intergenic
930694144 2:54394101-54394123 GTTAAGAAACACTTTGGGCTGGG - Intergenic
931374585 2:61695820-61695842 CCTAAGAAAAAGTTTTGGCCGGG + Intergenic
931693950 2:64858475-64858497 ACTTAGAAACAGTTAGGGGCTGG - Intergenic
932183938 2:69675215-69675237 AAATAAAAACAGTTTGGGCCGGG - Intronic
932205268 2:69875033-69875055 ATGTAAAAACTGTTTGGGCCTGG - Intronic
932341659 2:70966268-70966290 CTTAAGAAATAGCTTGGGCCAGG + Intronic
933111958 2:78413160-78413182 CTTTAGAAAATGTTTGTGGCAGG - Intergenic
933390010 2:81656455-81656477 CTTTAGAAAGAGTTTGGGTTTGG + Intergenic
933998948 2:87690430-87690452 CTTTATAAACATTTTGGGGAGGG - Intergenic
935047995 2:99498921-99498943 CTTTAGAAAGATTTTGGGTTCGG - Intergenic
935498167 2:103806932-103806954 CATTAGAAATATTTTGGTCCTGG + Intergenic
935724904 2:106015356-106015378 TTAAAGAAACACTTTGGGCCTGG - Intergenic
935986056 2:108674425-108674447 CTAAGAAAACAGTTTGGGCCAGG + Intronic
936138497 2:109918042-109918064 CTAAGAAAACAGTTTGGGCCAGG + Intergenic
936206199 2:110453443-110453465 CTAAGAAAACAGTTTGGGCCAGG - Intronic
936294896 2:111260453-111260475 CTTTATAAACATTTTGGGGAGGG + Intergenic
938619231 2:133031845-133031867 ATCTAGAAACACTCTGGGCCAGG + Intronic
938733954 2:134169090-134169112 CTTTAGAAATACTTTGGGGGAGG + Intronic
938752793 2:134350191-134350213 CTTTAGAAACTATTTGGGAAAGG + Intronic
939013223 2:136871660-136871682 CTTCAGAATCAGGTAGGGCCTGG + Intronic
940192722 2:151059474-151059496 ATTTAGAAACATATTTGGCCAGG - Intergenic
941823877 2:169870947-169870969 TTTTAAAGACAGTTTTGGCCAGG - Intronic
941949327 2:171137025-171137047 CTTTTAAAACAGTTTAGGCCAGG + Intronic
942264582 2:174209308-174209330 CTCTAGAGATAGTTTGGGTCAGG - Intronic
942771265 2:179524091-179524113 CTTTACAAATAGTATGGGCTGGG - Intronic
943220499 2:185097513-185097535 GTTAAAAAATAGTTTGGGCCAGG - Intergenic
944498456 2:200332540-200332562 ATTAAAAAATAGTTTGGGCCAGG - Intronic
945438466 2:209848741-209848763 CTTTGGAAGCAGTTTAAGCCTGG - Intronic
945486209 2:210399052-210399074 CTTTCAAAACACTTTGGGCTTGG + Intergenic
945557560 2:211298238-211298260 CTTTAGACCCATTTTGGGCCTGG - Intergenic
947077555 2:226362419-226362441 TTTTAGAAATAGTTAGGACCAGG - Intergenic
947189341 2:227485529-227485551 ATTTAAAAACAATTTGGGCTGGG - Intronic
947216619 2:227755721-227755743 CATTAAAAAAAGTTTGGGCCTGG - Intergenic
1168841151 20:910956-910978 CTTTCTAAGCAGTTTGGGACTGG - Intronic
1170025864 20:11889721-11889743 TTTTAGCAAGAGTTTGGCCCTGG - Intergenic
1170627252 20:18039323-18039345 CTTTAGAAAAAGTTTTTGGCCGG + Intronic
1172791192 20:37506614-37506636 CTAGAGTAACAGTTTGGGCCAGG - Intronic
1173278194 20:41602976-41602998 TTTTAAAAATAGTTTTGGCCAGG - Intronic
1176230702 20:64031379-64031401 TTTAAGAAACAGTTTGGGACAGG + Intronic
1176739795 21:10590710-10590732 CTTCAGAATCTCTTTGGGCCAGG + Intronic
1177953808 21:27571357-27571379 CTTTGGAAAGAGTGTGGCCCTGG + Intergenic
1178016393 21:28351233-28351255 CTGAAGAAACAGTGTGGGCACGG - Intergenic
1178138461 21:29655111-29655133 ATTTAAAAATAGTTTGGGCCAGG + Intronic
1180864984 22:19113074-19113096 CTAAAGAAACAGTATGGGCCAGG + Intronic
1181541858 22:23577826-23577848 CTTTAGAAATACTATGGGCCAGG - Intronic
1181721027 22:24774510-24774532 CTTTAAAAACCGCTTTGGCCGGG + Exonic
1182000860 22:26918689-26918711 TTTTAGAAACATTTTGAGACAGG + Intergenic
1182723088 22:32420020-32420042 CTTAAGAAACAGTTTTGGCCGGG + Intronic
1183785379 22:40026223-40026245 CTTTAAAGACTGTTTGGGCCCGG + Intronic
1185099662 22:48831236-48831258 CTTTAGAAATAAATAGGGCCAGG - Intronic
949763156 3:7495510-7495532 CTGTAGCAAGAGTTTGGTCCAGG - Intronic
950767218 3:15281705-15281727 CAAAAGAAACATTTTGGGCCAGG + Intronic
951227014 3:20132077-20132099 ATCTAAAAACAATTTGGGCCAGG + Intronic
951230687 3:20175499-20175521 CTTTAAAAACATTATAGGCCAGG + Intronic
951504580 3:23429171-23429193 CTTATGAACCAGTCTGGGCCTGG - Intronic
951615213 3:24534855-24534877 TTTTAAAAAAAGTCTGGGCCGGG + Intergenic
951850558 3:27135121-27135143 GTTTAGAAACATTTTCAGCCAGG + Intronic
954262958 3:49453120-49453142 TTTTAGAAACAGGGTTGGCCGGG + Intergenic
955768923 3:62371068-62371090 CTTTAGAATCGGGTTGTGCCTGG - Intronic
956079339 3:65540938-65540960 ATTTAGTAACAGTTGGGCCCTGG - Intronic
956353950 3:68369991-68370013 CTTTAAAAATGTTTTGGGCCAGG + Intronic
957404459 3:79759278-79759300 CTTTCGAAACATTTTGTGCTTGG + Intronic
957987131 3:87586895-87586917 CTACAGAAATAGTTTGGGCTGGG - Intergenic
959931377 3:111986728-111986750 CTAAAGAAACAGCTTAGGCCGGG - Intronic
960661739 3:120068095-120068117 CTTTAAAAATATTTGGGGCCAGG + Intronic
960800506 3:121534169-121534191 CTTTTGAAACAGTATCGGCTGGG - Intronic
960994178 3:123330246-123330268 CTTTAGAAATAGCTTGGGCAGGG - Intronic
961582319 3:127892797-127892819 CTTTAGAAAGATTTTGGGTTCGG - Intergenic
962131714 3:132685754-132685776 GTTAAGAAACAATGTGGGCCAGG + Intronic
963346744 3:144104008-144104030 TTTTAAAAACAGTTTGTGACAGG + Intergenic
963539242 3:146565038-146565060 TTTAAAAAACAGTTTTGGCCAGG + Intergenic
963602715 3:147391737-147391759 TTTAGGAAACAATTTGGGCCAGG - Intronic
966721955 3:183072303-183072325 CAGTTGAAATAGTTTGGGCCAGG - Intronic
966831240 3:184011035-184011057 ATTAAGAATGAGTTTGGGCCGGG - Intronic
967273415 3:187749864-187749886 CTTTAGAAACCTTTTCAGCCTGG + Intergenic
968776822 4:2547069-2547091 TTTAAAAAACAGTTTAGGCCAGG - Intronic
969332658 4:6488381-6488403 ATTTATAAACAGTTTGATCCTGG + Intronic
975881461 4:78912886-78912908 CTTTAGAAACACTTTATGCATGG + Exonic
977419055 4:96774318-96774340 TTTGAGATACAGTGTGGGCCTGG - Intergenic
977750178 4:100600727-100600749 CTTAAGAAAAATTTTAGGCCAGG + Intronic
978525458 4:109660518-109660540 TTTTAAAAACTGTTTTGGCCTGG + Intronic
981411065 4:144433060-144433082 CTTTAGAAACATCTTCGGCCTGG + Intergenic
982036584 4:151352260-151352282 CTACATAAAGAGTTTGGGCCGGG + Intergenic
982266851 4:153545580-153545602 ACAAAGAAACAGTTTGGGCCTGG - Intronic
982450708 4:155549071-155549093 TTTTAAAAATATTTTGGGCCAGG - Intergenic
982799447 4:159685773-159685795 CTTTCTAAACAGTTTTGGCAAGG + Intergenic
983254371 4:165380486-165380508 CTTAGGAAATAATTTGGGCCTGG + Intronic
984168579 4:176333669-176333691 CATAAGAAAAAGTTTGGGCACGG + Intergenic
984704747 4:182839555-182839577 CTTTAGACAGAGCTTGGACCTGG - Intergenic
985197264 4:187444615-187444637 CTTTACAAACAGTATGAGCAAGG - Intergenic
985289404 4:188372962-188372984 TTTTAGAAACAGTCAGGGTCAGG + Intergenic
985681167 5:1256711-1256733 GTTTAAAAACATTCTGGGCCTGG - Intronic
989169231 5:38458683-38458705 CTTTAAAGAATGTTTGGGCCGGG + Intronic
989615588 5:43334411-43334433 CTTTAGAAAGATTTTGGGTTTGG + Intergenic
991010984 5:61882741-61882763 CTTTTTAAAAAGTTTCGGCCAGG - Intergenic
992181580 5:74202844-74202866 CCTTAGAGACAGTCTGGGTCTGG - Intergenic
992454279 5:76901975-76901997 TTCTAGACACACTTTGGGCCAGG - Intronic
993909422 5:93663269-93663291 CTGTAAAAACAGTTTGGCACAGG - Intronic
995645195 5:114303961-114303983 CCTTGGAAAAAGTTTGGGCTGGG + Intergenic
997885258 5:137624429-137624451 TTTTAGAAGAAGTTTGGTCCTGG - Intronic
998002275 5:138634676-138634698 CTTAAGAAACAGTTTGAGGCCGG + Intronic
998615547 5:143736370-143736392 CTTTCTAAAAGGTTTGGGCCAGG + Intergenic
999741775 5:154560884-154560906 TTTAAGAAAGAGTGTGGGCCGGG - Intergenic
1001511137 5:172322809-172322831 CTTAAGAAACACTATGGGGCAGG - Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002587314 5:180257568-180257590 TTTTAGAAAAAATTCGGGCCAGG + Intronic
1006085393 6:31591518-31591540 CATTAAAAACAGTTTCGGCCGGG + Intronic
1006167317 6:32072672-32072694 TTTAAGAAATATTTTGGGCCGGG + Intronic
1006482372 6:34307281-34307303 CTTTAAAAAAAGTTGAGGCCAGG + Intronic
1011204855 6:84880705-84880727 CTGTAGAAACAATATGGCCCAGG - Intergenic
1012591991 6:100993159-100993181 CTTAAGAAACATTTGGGGCTTGG - Intergenic
1012921192 6:105222591-105222613 CTTTCTAAACAGTTTATGCCAGG + Intergenic
1013239999 6:108236186-108236208 CATATGAAACAGTTTTGGCCGGG + Intronic
1013254683 6:108372621-108372643 GTTAAGAACAAGTTTGGGCCAGG - Intronic
1013529706 6:111007647-111007669 CTTTAAAATCAGTATAGGCCAGG + Intronic
1013564312 6:111342104-111342126 CTTAGGAAACACCTTGGGCCTGG + Intronic
1014187706 6:118454540-118454562 CTTTTGGAACAATCTGGGCCGGG + Intergenic
1014287846 6:119521775-119521797 CTTAAGAAACAGTTTGGTTGGGG + Intergenic
1014927402 6:127289917-127289939 TTTTAGGAACAGTTTGGGGTGGG - Exonic
1015936577 6:138410779-138410801 GTTAAGAAACATTTTGGGCCAGG - Intronic
1017125270 6:151058969-151058991 CTTTAGAAGCTCTGTGGGCCAGG - Intronic
1017382899 6:153850730-153850752 TTTTAAAAACAGTTGTGGCCGGG + Intergenic
1017566566 6:155693328-155693350 TTTTATAAACTGTTTGGTCCTGG + Intergenic
1017870759 6:158484442-158484464 CTTTAGAAAATGTGTGGGCCAGG - Intronic
1019137441 6:169919584-169919606 CTTAAGAAATCGTTTCGGCCGGG + Intergenic
1020032003 7:4940035-4940057 TTATAGAAATAGATTGGGCCAGG - Intronic
1021303700 7:19005481-19005503 TTTAAGAAACAATTTTGGCCAGG + Intergenic
1021987346 7:26109771-26109793 CTTAAGAAAAAATTTAGGCCAGG + Intergenic
1022193177 7:28036993-28037015 CTTTAGGAAGAATCTGGGCCTGG + Intronic
1022541424 7:31138951-31138973 TTTAAGATACATTTTGGGCCGGG - Intergenic
1022649312 7:32260037-32260059 CTCTAGAGACTGGTTGGGCCCGG - Intronic
1023317462 7:38954492-38954514 CTTTAGACAGAGTTTTGGCTAGG - Intergenic
1023884533 7:44343489-44343511 TTTAAGAAACTGTGTGGGCCAGG + Intergenic
1028404287 7:90459476-90459498 TTTAAGAGACAGTTGGGGCCAGG + Intronic
1032222561 7:130005775-130005797 CATTAGGAAAATTTTGGGCCAGG - Intergenic
1032288364 7:130562061-130562083 CTTTAAAAACAATTTAGGCCAGG + Intronic
1032379761 7:131465832-131465854 CTTTAAAAAAATTTTAGGCCAGG - Intronic
1033071062 7:138202726-138202748 CTTTTGAAAAATGTTGGGCCAGG - Intergenic
1033098068 7:138448156-138448178 CTTTAGAAAGATTTTGGGTTCGG + Intergenic
1033373256 7:140731309-140731331 CTTTTGAAACTGCCTGGGCCAGG - Intronic
1034059179 7:148070419-148070441 CTTAAAAAACAGTTTTGGGCTGG + Intronic
1034741296 7:153475967-153475989 CTCTAGAGACAGTTTGGACTTGG + Intergenic
1036711261 8:11080355-11080377 CTTTAGAAACAGGGTGGGGAAGG + Intronic
1038177060 8:25190180-25190202 ATTTAAAAACATTCTGGGCCAGG - Intronic
1041829500 8:62137987-62138009 ATTTAAAAAGAGTCTGGGCCAGG + Intergenic
1042779441 8:72474524-72474546 CTTTAAAATCATTTTTGGCCGGG - Intergenic
1042894863 8:73654978-73655000 TTTAAGAAATGGTTTGGGCCGGG - Intronic
1043804392 8:84653151-84653173 CTTTAGAAAGAATTTGTCCCTGG + Intronic
1044018307 8:87073804-87073826 CTAAAGAAGCAGTCTGGGCCGGG + Intronic
1044892680 8:96854234-96854256 TTTAAGAAACAATGTGGGCCGGG + Intronic
1045213861 8:100127318-100127340 CTTTATAAACACTTTGGAACTGG + Intronic
1045860155 8:106807317-106807339 CTTCAGATACAGTTTGGTCAAGG - Intergenic
1047478071 8:125254781-125254803 CTATGGAAGCAGTTTGGTCCGGG + Intronic
1048055786 8:130862706-130862728 ATTTAAAAATATTTTGGGCCAGG - Intronic
1048879992 8:138864194-138864216 CTTTAGAAGGAGAATGGGCCAGG - Intronic
1050152431 9:2630087-2630109 TGTAAGAACCAGTTTGGGCCAGG - Intronic
1051659783 9:19415193-19415215 TTAAAGAAACTGTTTGGGCCAGG + Intronic
1052876363 9:33569553-33569575 CTTTAAAAATAGTATGGGCTGGG - Intronic
1053095482 9:35323812-35323834 CTGTAGAAACAGGTTAGGCAAGG - Intronic
1053486848 9:38465042-38465064 ATTTAGAAAAATTTTGGGCATGG + Intergenic
1053528396 9:38852964-38852986 TTTTAAAAATAGTTTAGGCCAGG - Intergenic
1054200621 9:62077396-62077418 TTTTAAAAATAGTTTAGGCCAGG - Intergenic
1054637735 9:67510964-67510986 TTTTAAAAATAGTTTAGGCCAGG + Intergenic
1055468506 9:76588943-76588965 TTATAGAAAAAGTTTGGGCTGGG - Intergenic
1056214598 9:84395296-84395318 CGAAAGAAAAAGTTTGGGCCAGG - Intergenic
1056382482 9:86067705-86067727 ATTTAGAAACAGGGTTGGCCGGG + Intronic
1057633605 9:96741703-96741725 CATTAAAAACATTTAGGGCCCGG - Intergenic
1057685542 9:97230884-97230906 CTCAAGAAACATTTAGGGCCAGG + Intergenic
1058436987 9:104971982-104972004 CTTAAAAACAAGTTTGGGCCAGG + Intergenic
1058833507 9:108840326-108840348 TTTTAAAAACAATTTCGGCCAGG + Intergenic
1061978297 9:134084668-134084690 CTTCAGAAACAGTGGGGCCCTGG + Intergenic
1062591592 9:137277062-137277084 ATTTAGAAACAACTTGGGCCGGG - Intergenic
1203567770 Un_KI270744v1:106056-106078 CTTCAGAAAACTTTTGGGCCCGG - Intergenic
1185598549 X:1323586-1323608 CTTTAGAAGCTGTCTGGGCTGGG + Intergenic
1185604217 X:1358362-1358384 CATAAGAAACCTTTTGGGCCAGG + Intronic
1186149663 X:6660925-6660947 CTTTAGAAAGACTTTGGTCAAGG - Intergenic
1186336359 X:8593677-8593699 ATTTAGATACATTTTGGGACAGG + Intronic
1186596271 X:10985003-10985025 TGTTATAAACATTTTGGGCCGGG - Intergenic
1187600073 X:20819202-20819224 CTTTAAAAAAATTTTTGGCCGGG - Intergenic
1190852891 X:54264036-54264058 TTTTAAAAAAAATTTGGGCCAGG + Intronic
1192778541 X:74270224-74270246 CTTTAGAAAGATTTTGGGTGTGG - Intergenic
1194498913 X:94655869-94655891 CTTTGTAAAAAGTTTGGGCCAGG + Intergenic
1194973659 X:100371790-100371812 CTTGATAAACACTTTGTGCCAGG - Intronic
1195372869 X:104197274-104197296 ATTAAAAAACACTTTGGGCCGGG - Intergenic
1196813265 X:119645206-119645228 CTTTAGGAATTGATTGGGCCTGG - Intronic
1197253096 X:124235032-124235054 TTTTAGGAATAATTTGGGCCGGG - Intronic
1197544546 X:127808751-127808773 CTTTGGAAACACCTGGGGCCTGG + Intergenic
1197900860 X:131369748-131369770 CCCAAGAAACAATTTGGGCCTGG - Intronic
1198747999 X:139909426-139909448 ATTTAAAAACAGTGTGGGCCGGG - Intronic
1199315546 X:146373387-146373409 CTTAAGAGACAATCTGGGCCGGG - Intergenic
1200139899 X:153894941-153894963 CTTGAGAAACAGAGTGGGCCAGG - Intronic
1201679295 Y:16624444-16624466 CTTTAGAAACTGGCTGGGCATGG - Intergenic
1202376347 Y:24241185-24241207 CTGTCAAAACAGTTTGGACCTGG - Intergenic
1202494433 Y:25428934-25428956 CTGTCAAAACAGTTTGGACCTGG + Intergenic
1202598092 Y:26564566-26564588 CTTCAGAATCTCTTTGGGCCAGG + Intergenic