ID: 1161564343

View in Genome Browser
Species Human (GRCh38)
Location 19:4991699-4991721
Sequence CTGTATCTTGATTGCAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 760
Summary {0: 1, 1: 8, 2: 42, 3: 163, 4: 546}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161564343_1161564345 -1 Left 1161564343 19:4991699-4991721 CCACCATTGCAATCAAGATACAG 0: 1
1: 8
2: 42
3: 163
4: 546
Right 1161564345 19:4991721-4991743 GAACTGTTCTGTCAACACAAAGG 0: 1
1: 0
2: 6
3: 1472
4: 2152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161564343 Original CRISPR CTGTATCTTGATTGCAATGG TGG (reversed) Intronic
900272426 1:1798221-1798243 CAGTATCTTGGCTGCACTGGTGG - Intronic
903099015 1:21011584-21011606 TTGTATTTTGACTGTAATGGTGG - Intronic
903389142 1:22952090-22952112 CTATATCTTGATTGTGGTGGTGG + Intergenic
904319119 1:29685080-29685102 CTCTAGCTTGTTTGCCATGGTGG + Intergenic
904653063 1:32020858-32020880 CTGTATCTTGACTGAGGTGGTGG + Intronic
904924475 1:34036586-34036608 CTGTGTCTTGATTGCAGTGATGG + Intronic
905331155 1:37198985-37199007 CTGCATCATGATTACAATTGTGG + Intergenic
906019438 1:42614477-42614499 CTGTATCTTCATTGGGGTGGTGG - Intronic
906051971 1:42881716-42881738 CTGTATCTTGATTGTTGTGGTGG + Intergenic
906441671 1:45852223-45852245 CTGTATGTTGATTGTGGTGGTGG - Intronic
906579979 1:46928304-46928326 CTAAATCTTGAATGGAATGGAGG + Intergenic
906603745 1:47150583-47150605 CTAAATCTTGAATGGAATGGAGG - Intergenic
906616811 1:47238916-47238938 CTATATCTTGATTGTGGTGGTGG + Intergenic
906849874 1:49236735-49236757 ATGTATCTTGATTGTGGTGGTGG - Intronic
906959682 1:50411414-50411436 CTGAATCCTGATTGTGATGGTGG + Intergenic
907865381 1:58394807-58394829 CTGTTTCTTGATTGTGCTGGGGG + Intronic
908185851 1:61652758-61652780 CTATATCTTGATTACAGTGGTGG - Intergenic
908379239 1:63579140-63579162 CTGTATCCTGATTGTGGTGGTGG - Intronic
908404797 1:63804200-63804222 CTGTATTGTAATTGTAATGGTGG + Intronic
908606986 1:65808635-65808657 CTTTATCTTAATGGCAGTGGGGG + Intronic
908711677 1:67022772-67022794 CTTTATCGTGATTGTAATGGTGG - Intronic
909262567 1:73511509-73511531 CTACATCTTGATTGCAATGATGG + Intergenic
910035730 1:82785237-82785259 CTATATCTTGATTGGAATGGTGG + Intergenic
910663932 1:89704131-89704153 CTGTATCCTGTTTGTAGTGGTGG - Intronic
911037628 1:93567222-93567244 CTGTATCGTAATTGAAATGAAGG - Intronic
911954142 1:104214695-104214717 TTATATCTTGATTGTGATGGTGG + Intergenic
912524275 1:110269256-110269278 CTGTATCTTGATTGTGGTGGTGG - Intronic
912915310 1:113808852-113808874 CTGTATCTTGATTGTAGTGGTGG + Intronic
913705803 1:121421748-121421770 CTAAATCTTGATTGTGATGGTGG + Intergenic
914338837 1:146740899-146740921 CTGGATCTTAATTGCGGTGGTGG - Intergenic
914891986 1:151633265-151633287 CTGTATCTTGACTGGGGTGGTGG - Intronic
915984850 1:160454349-160454371 CTGCATCTTGATTGTGAGGGTGG - Intergenic
916161195 1:161916830-161916852 TTATATCTTGATTGAAATGGTGG - Intronic
917620059 1:176786430-176786452 CTGTATCTTGATCTGACTGGTGG + Intronic
917784893 1:178444312-178444334 CTGTATCTTGATCATAGTGGTGG - Intronic
918035010 1:180860739-180860761 CTGTAACTTGATTGTAGTGATGG + Intronic
918061863 1:181068651-181068673 CTGCATCCTGATTGCAGTGGTGG + Intergenic
918317805 1:183337094-183337116 CTGTATCTTGATTGGAGAGTTGG + Intronic
918336697 1:183522329-183522351 CATTTTCTTGATTGCAATGGTGG - Intronic
918457982 1:184745031-184745053 CTGTATCATGACTGTGATGGTGG + Intronic
918594054 1:186272352-186272374 ATGTATCTTGATTGTGACGGTGG + Intergenic
918626056 1:186657108-186657130 TTGTATCTTGATTGTGATGGTGG + Intergenic
919005457 1:191893307-191893329 CTGTATGTTGATTGCAGTGGTGG + Intergenic
919032760 1:192265725-192265747 CTGCATTTTGATAACAATGGAGG + Intergenic
919037533 1:192333748-192333770 CTGTGTCTTGACTTCATTGGTGG + Intronic
919155624 1:193762065-193762087 CTATATCTTGATTGTGGTGGTGG + Intergenic
919949980 1:202354202-202354224 CTACATCTTGATTACAGTGGTGG - Intronic
919961084 1:202469562-202469584 CTGTATCTTGATTACAGTGACGG + Intronic
919984642 1:202664467-202664489 CTGTATATTGATTGGGGTGGTGG - Intronic
920285545 1:204876231-204876253 CTCCATCTTGATTGGAGTGGTGG - Intronic
920590505 1:207214190-207214212 CTGTATTTTGATTGCTGTGGTGG - Intergenic
920592722 1:207236712-207236734 CTGTATCTTGACTGTGATGGTGG + Intergenic
921120802 1:212135191-212135213 CTGTACCTTGATGGCGGTGGTGG + Intergenic
921311839 1:213852203-213852225 CTGTATCTCAAGGGCAATGGAGG - Intergenic
921827065 1:219684463-219684485 CTGTATCTTAATTGAGATGGTGG - Intergenic
922112048 1:222569139-222569161 CTATATCATGATTACCATGGTGG + Intronic
922707878 1:227799617-227799639 CTGTATCCTGGTGGCAGTGGTGG - Intergenic
923020239 1:230157877-230157899 CTATATCTTGATTGTGGTGGTGG + Intronic
923743542 1:236678703-236678725 CATTATCTTGATTGCAGTGATGG - Intergenic
923906010 1:238384440-238384462 CTGCATCTTGGCTGTAATGGTGG + Intergenic
924252506 1:242147097-242147119 GTGTATCTTGATTGTGGTGGTGG - Intronic
924418189 1:243881477-243881499 CTGTATCTTGATTCTGATGGTGG - Intergenic
924730059 1:246702873-246702895 CTGTATCTTGATCTGAGTGGTGG + Intergenic
1063019203 10:2109419-2109441 GTGTATCTTTATTGCCACGGAGG - Intergenic
1063282994 10:4651172-4651194 CCGTCTTTTGATTGCAATTGTGG + Intergenic
1063753543 10:8979784-8979806 CTGTACCATGAGTGTAATGGAGG - Intergenic
1064477933 10:15711613-15711635 CTATATCTTGATTGTGGTGGGGG - Intronic
1064613831 10:17132098-17132120 CTGTATCATGATTGTGATTGTGG + Intergenic
1064739943 10:18422740-18422762 CTGTAGTATGAGTGCAATGGCGG + Intronic
1065102779 10:22347089-22347111 CTGTATCTTGACTGTGCTGGTGG - Intronic
1065338342 10:24678331-24678353 CTGTATCTTGACTGGTATGGTGG - Intronic
1065621095 10:27582651-27582673 CTTTATCTTGATGGTAATGATGG - Intergenic
1066403875 10:35100856-35100878 CTGTATCCTGATTGCGGTGATGG - Intergenic
1067073736 10:43159539-43159561 CTGTATCTTAATTGGGGTGGTGG - Intronic
1067100685 10:43332150-43332172 CTGTATCTTGATTGTGGTGCTGG + Intergenic
1067191402 10:44071295-44071317 CTGTATCTTGATGGGAGTAGTGG - Intergenic
1067244447 10:44525737-44525759 CTGTATCTTGGTTGTTGTGGTGG - Intergenic
1067530762 10:47070494-47070516 CTGTATCTTGACTGTGATGGTGG - Intergenic
1068271621 10:54734924-54734946 CAGTATCTTTATTGTGATGGTGG + Intronic
1068509966 10:57952994-57953016 CTATATCTTGATTGTGGTGGTGG + Intergenic
1068736282 10:60416815-60416837 CTGTATCTTCATTCCACTGGTGG + Intronic
1068889243 10:62131805-62131827 CTGTATGTTGACTGCAAAGGTGG - Intergenic
1070383259 10:75900723-75900745 CTGAATCTTGATTGGAATTTGGG + Intronic
1070499825 10:77062055-77062077 CTGTATCCTGATTGTGGTGGTGG + Intronic
1070534757 10:77367640-77367662 CTGTATCTTGATTATGGTGGTGG - Intronic
1070701775 10:78607661-78607683 CTGTATCTTGATTGTGAAGCTGG - Intergenic
1071308304 10:84319540-84319562 CTGTGTTTTGATTGACATGGTGG - Intergenic
1072144582 10:92623145-92623167 CTGTATCTTGATTGCAGTGGTGG - Intronic
1072257543 10:93634407-93634429 TTGTATCTTGATTCTAATGGTGG + Intronic
1072350704 10:94554395-94554417 CTGTATCTTGATTGTGCTGGTGG - Intronic
1072506496 10:96073070-96073092 CTGTATCTTGGTTGTGGTGGTGG - Intergenic
1072891308 10:99327872-99327894 CTGTATTTTGAGTGCAGTGATGG + Intergenic
1073990083 10:109252730-109252752 CTGGTTCTTGAGTACAATGGAGG - Intergenic
1074435962 10:113434569-113434591 CTCTATCTGGAATGCAGTGGGGG + Intergenic
1074656851 10:115599909-115599931 CTTTATCTTGATTGTGTTGGTGG - Intronic
1074730749 10:116372392-116372414 CTATATCTTGATTGCAGTGGTGG - Intronic
1075163392 10:120044141-120044163 CTATATCTTTATTGGGATGGTGG - Intergenic
1075422739 10:122315282-122315304 CTCTATCTTGATTGCAGTGCTGG - Intronic
1075516347 10:123111662-123111684 CTTTATCTTGATTGTGGTGGTGG + Intergenic
1075529390 10:123215174-123215196 CTGTATCTTGATTGCAGTAGTGG - Intergenic
1076058427 10:127394185-127394207 CTGTTTCTTGATTTCAGAGGTGG - Intronic
1077649290 11:3955279-3955301 CTGCATCTTGATTGGGGTGGTGG + Intronic
1077743774 11:4877954-4877976 CTGTATCTTTGTTTCAGTGGTGG - Intronic
1078033440 11:7777853-7777875 CTGTATCCTAATTGTGATGGTGG + Intergenic
1078126815 11:8573975-8573997 CTGTATCTTGATTACAGTGATGG + Intronic
1078314998 11:10287582-10287604 CTATATCTTGATTGCAGTAGTGG + Intronic
1078682396 11:13489145-13489167 CATTATCTTCATTGTAATGGTGG - Intergenic
1078963898 11:16314113-16314135 CTTTATATTGAAGGCAATGGAGG - Intronic
1080137991 11:28880468-28880490 CTATATCTTTGTTGGAATGGTGG - Intergenic
1080468984 11:32526646-32526668 TTATATCTTGATTGTACTGGTGG + Intergenic
1080552398 11:33384060-33384082 CTGTATCTGGATTGTGGTGGTGG - Intergenic
1081331110 11:41801262-41801284 CTGTATCTTGACTGTGGTGGTGG - Intergenic
1082819242 11:57532923-57532945 CTGTATCCTGATTGTGGTGGTGG + Intergenic
1084058958 11:66657013-66657035 CTGTATTTTGATTGCAACAATGG - Intronic
1084262072 11:67985636-67985658 CTGTACATTGATTGCTATGTTGG - Intergenic
1085167972 11:74421120-74421142 CTGTATCTTGACTGTAGTGGTGG - Intergenic
1085169644 11:74438438-74438460 CTGCATCTTGATTGGAGTGAGGG + Intergenic
1085405825 11:76261211-76261233 CTGTATCTTGATTGTGGTGGGGG + Intergenic
1085654437 11:78300044-78300066 TTGTGTCTTGATTGAAGTGGTGG - Intronic
1086340900 11:85847147-85847169 CTGTATCTTGATTGTGGTGGTGG - Intergenic
1086391039 11:86363141-86363163 CTGTATCTTGATATGATTGGTGG - Intergenic
1086669057 11:89524638-89524660 CTGTATCTTCCTTGTAATGGTGG - Intergenic
1086770613 11:90760509-90760531 CTTTACCTTGATTGCAGTGGAGG + Intergenic
1087088608 11:94245104-94245126 CTGTATCTTGATTACAGTGATGG + Intergenic
1087215560 11:95489492-95489514 CTATATCTTAATTGTAGTGGTGG - Intergenic
1087888770 11:103512371-103512393 CTATATCTTGATTATGATGGTGG - Intergenic
1088144544 11:106660013-106660035 CCGTATCTTGATTCTAATGCAGG - Intergenic
1088677585 11:112210688-112210710 CTGTATCTTGAGTGGCGTGGTGG + Intronic
1088855598 11:113749457-113749479 CTGTGTCTTGATTGTAGTGGTGG + Intronic
1089314381 11:117581386-117581408 CTGTATCTTGATTGCGGTGGTGG - Intronic
1089440004 11:118507293-118507315 CTGTATCTTGATCCGAGTGGTGG - Intronic
1092993953 12:13930307-13930329 TGGGATCTTGATTTCAATGGGGG + Intronic
1094110831 12:26861052-26861074 TTGTATCCTGATTGTGATGGTGG - Intergenic
1094443937 12:30509417-30509439 CTGTATCCTGATTGTTGTGGTGG - Intergenic
1094452381 12:30596405-30596427 CTGTATCTTGAGAGTAATGATGG + Intergenic
1094544788 12:31394557-31394579 CTGTATCATGATTGTGGTGGTGG - Intronic
1094667125 12:32531392-32531414 CTGTATCTTCATTGTGGTGGTGG - Intronic
1095236886 12:39807270-39807292 CTATATCTTGACTGTACTGGTGG + Intronic
1095544364 12:43347376-43347398 CTGGATCTTAGTTGCAAGGGAGG + Intergenic
1096442746 12:51659360-51659382 CTACATCTTGATTTCAGTGGTGG + Intronic
1096468395 12:51861269-51861291 CCACATCTTGATTGGAATGGTGG + Intergenic
1096891001 12:54771077-54771099 CTGGATCTTTATTGTGATGGTGG - Intergenic
1098403259 12:70096322-70096344 CTCTACCTTGATTGGAATAGTGG - Intergenic
1098593403 12:72241231-72241253 CTGTGTCTTGATTGTAGTGGTGG - Intronic
1098599294 12:72311097-72311119 CTATATCTTGATTGTGGTGGTGG - Intronic
1098928360 12:76379461-76379483 CTATATCTTGATTGTGGTGGTGG - Intronic
1099003229 12:77205859-77205881 TTGTATATTGAATGCAATGAGGG + Intergenic
1099034468 12:77568139-77568161 TTGTATCTTGATTGTAAGGGTGG - Intergenic
1099121797 12:78699227-78699249 CTATACCTTGATTGGAGTGGTGG - Intergenic
1099866448 12:88288521-88288543 CTATATCTTGATTATAGTGGTGG - Intergenic
1100332446 12:93597197-93597219 CTGTATCCTGATTTCAGTGGTGG - Intergenic
1102410858 12:112717252-112717274 CTGTATCTTGATTGAGGTAGTGG - Intronic
1102703412 12:114860229-114860251 CTATTTCTTGATTGCAGTGATGG - Intergenic
1102903204 12:116655042-116655064 CTATATCTTAATTGCAGTGATGG + Intergenic
1102926668 12:116831806-116831828 TTATATCTTGATTGGGATGGGGG - Intronic
1103234958 12:119364303-119364325 CTATATCTTGATTAGGATGGTGG - Intronic
1103297999 12:119904758-119904780 CTATAGCTTAATTGCATTGGCGG + Intergenic
1103317684 12:120069779-120069801 CTGTATCTTGATCTCCATGGTGG - Intronic
1103434507 12:120914531-120914553 CTGTCTCTTGGTGTCAATGGTGG - Intergenic
1103454635 12:121055322-121055344 CTCCATCTTGATTGCAGTGGTGG - Intergenic
1105060563 12:133146537-133146559 CTGTATCTTGAATGAAGTGGGGG - Intronic
1105895651 13:24715417-24715439 CTCTATCTTGATTGTGATGTGGG - Intergenic
1106439969 13:29757570-29757592 CTGTATCTTGAAATGAATGGTGG - Intergenic
1106535581 13:30639637-30639659 CTATATCTTGATTGTAGTGAGGG - Intronic
1107156994 13:37179482-37179504 CTGTACCTTGGTTGCAGTGATGG - Intergenic
1107545028 13:41427213-41427235 CTGTACCTTGATTGCTATGTTGG - Intergenic
1107763000 13:43701935-43701957 CTGTTTCTTGATTACAGTGATGG - Intronic
1108193193 13:47964371-47964393 CTGTATCTTGATTGTGGTAGTGG + Intronic
1108199557 13:48029453-48029475 CTGTATCTTGATTATCATGGTGG - Intergenic
1108371427 13:49773268-49773290 TTACATTTTGATTGCAATGGTGG + Intronic
1109129639 13:58566484-58566506 CTGTATCTTTATTGCAATAAAGG - Intergenic
1109176527 13:59164363-59164385 TTGTATCTTGACTGCAGTGGTGG + Intergenic
1109216974 13:59600428-59600450 CTGTATCTTGATTGTGGTGATGG + Intergenic
1109660991 13:65459958-65459980 CTCTATCTTGATTGCGATGTAGG + Intergenic
1109765523 13:66890883-66890905 CTATAACTTGATTGTAGTGGTGG - Intronic
1109840984 13:67915698-67915720 CTGTACCTTGATTGCTATGTTGG + Intergenic
1110087333 13:71397375-71397397 CTGTATCTTGATTGTAGTGATGG + Intergenic
1110583995 13:77166187-77166209 ATGTATCTGGATTGCATTCGAGG - Intronic
1110843925 13:80172545-80172567 CTGCATCTTGATGCCAATGTGGG + Intergenic
1111886161 13:94024030-94024052 CTGTATGTTGATTGTGGTGGTGG + Intronic
1112068139 13:95816783-95816805 CTACATCTTGATTGTGATGGTGG + Intronic
1112351133 13:98634600-98634622 CTGTCTGCTGATTGCAGTGGTGG - Intergenic
1112877782 13:104066633-104066655 CTGTGTCTTGACTGTATTGGTGG + Intergenic
1113411182 13:110091371-110091393 CTGTATCTTGATTGTGGTGGTGG - Intergenic
1113637640 13:111930899-111930921 CTGTATCTTGATTGAAGTAGGGG - Intergenic
1114198541 14:20501279-20501301 CTGTATCTTGATTGCAGTGGTGG - Intergenic
1114507300 14:23226950-23226972 CTGTTTCTTGATTGTGGTGGTGG + Intronic
1114630225 14:24154744-24154766 CTGTATCTTGATTATGGTGGTGG - Intronic
1114705290 14:24720100-24720122 TTGTGTCTTGATTGTCATGGTGG + Intergenic
1115030717 14:28790400-28790422 CTGAAGCTTGATTATAATGGTGG - Intronic
1115765649 14:36620530-36620552 CTGCATTTTGATTGTGATGGTGG - Intergenic
1116000695 14:39239589-39239611 CTATATCTTGAATTCATTGGAGG + Intronic
1116828096 14:49691615-49691637 CTGTATCTTGATTGAGGTGGTGG - Intergenic
1117030903 14:51669071-51669093 CTGTATCTTGACCGCAGTGCTGG - Intronic
1117226218 14:53662890-53662912 CTACATCTTGATTGCAGTGGTGG + Intergenic
1117465880 14:55993495-55993517 CTGTATCTTGATTGTGGTGATGG - Intergenic
1118108434 14:62688283-62688305 CTGTATTTTGATTACAATGGTGG + Intergenic
1118150545 14:63184692-63184714 CTGTATCTTGATTGGGATGTGGG - Intergenic
1118164695 14:63324747-63324769 CTGTCTCTTGACTGCAGTGGTGG + Intergenic
1118583298 14:67326556-67326578 CTAAATCTTGATTGGCATGGTGG - Intronic
1118735418 14:68697445-68697467 CTGTATCTTGATTGTGGTGATGG - Intronic
1119019354 14:71094340-71094362 CTATATCTAGATTGCAGTAGTGG + Intronic
1119076205 14:71641942-71641964 CTGTATTTTGATTGTGTTGGGGG + Intronic
1119283240 14:73428959-73428981 CTATATCTTGATTGTGGTGGTGG - Intronic
1119417417 14:74482363-74482385 ATGTATCTTGATAAGAATGGAGG - Intronic
1121195120 14:92065035-92065057 CTATGTCTTGATTGTAGTGGTGG - Intronic
1121582706 14:95042961-95042983 CTGTATCTTGATTGTGATGCTGG + Intergenic
1121609622 14:95268564-95268586 CTTCATCTTGACTGCCATGGTGG + Intronic
1121722942 14:96124201-96124223 TTTTATCTTGATTGAGATGGTGG + Intergenic
1122431479 14:101650589-101650611 CTGTAACTTGATTGCAGTAGTGG + Intergenic
1123803536 15:23847844-23847866 CTATATCTTGATTGTTATTGTGG + Intergenic
1124082534 15:26515249-26515271 CTGTATCTTGAGGGCAATGCGGG - Intergenic
1124550072 15:30672105-30672127 CTGTACTTTGATTGCAGAGGTGG + Intronic
1124701886 15:31921430-31921452 CTGTATCTTGGCTGAAGTGGTGG - Intergenic
1124711068 15:32012403-32012425 CTGTATCTTGACTGTGGTGGAGG - Intergenic
1124854605 15:33375751-33375773 CTATATCTTAATTTCATTGGTGG - Intronic
1125020379 15:34979420-34979442 CATTATCTTGCTTGCACTGGAGG + Exonic
1125075826 15:35617037-35617059 CTGTATCTTGACTGTTGTGGTGG + Intergenic
1126752802 15:51894505-51894527 CTATATCTTGAGTGTAATGGTGG - Intronic
1127113690 15:55701992-55702014 CTGTATCCTGATTGTAGTGATGG + Intronic
1127404395 15:58626062-58626084 CTGATTCTTGATTGTGATGGTGG + Intronic
1127897949 15:63318945-63318967 CATTATCTTGATTGCAGTGATGG - Intergenic
1128271353 15:66312766-66312788 CTGTATCTTGATTGTGGTGGTGG - Intronic
1128515655 15:68340289-68340311 CTGAATCTAGATTGAGATGGGGG + Intronic
1128554971 15:68625378-68625400 CTGTATCATGATAGTGATGGTGG - Intronic
1128586373 15:68854016-68854038 CTATATCTTGACTACAATGGTGG + Intronic
1128607790 15:69049909-69049931 CCATATTTTGATTGCAGTGGTGG - Intronic
1129217976 15:74111885-74111907 CTGTATCTTGATTGTAGCAGTGG + Intronic
1129406582 15:75323258-75323280 CTGTATCTTGATTGTAGCGGTGG - Intergenic
1129632561 15:77277375-77277397 CTGTATCTTGGTTGCAGTGTTGG + Intronic
1129684673 15:77678263-77678285 CTGTACCTTGATGGCCATAGTGG - Intronic
1129735105 15:77956031-77956053 CTGTGTCTTGATTGTAGTGGTGG + Intergenic
1130433229 15:83870185-83870207 CTGTATTTTGATTGTGGTGGTGG + Intronic
1131179446 15:90230041-90230063 CTGTATCCTGATTGGGGTGGTGG - Exonic
1131539529 15:93264675-93264697 CTCTATCTTCATGGCAAGGGAGG + Intergenic
1132000717 15:98177122-98177144 CTGTCTCTTGCTTCCAGTGGTGG - Intergenic
1133177759 16:4028112-4028134 CTGTATCCTGATTGTACTGGTGG + Intronic
1133657134 16:7876589-7876611 CTGTATCTTGATTTTGGTGGTGG - Intergenic
1134305460 16:13028115-13028137 CTATCTCTTGATTGTCATGGTGG + Intronic
1134352335 16:13449509-13449531 CTATATCTTGATTTGAGTGGTGG + Intergenic
1135009155 16:18858017-18858039 CTGTATCTCGATCGTATTGGTGG + Intronic
1135477753 16:22792500-22792522 CTGTATCTTGACTGTGATGGTGG + Intergenic
1135499746 16:22984549-22984571 CTGTATCTTTATTTCACTAGAGG + Intergenic
1135583896 16:23652587-23652609 CTATATCTTGATTGTAGTAGTGG - Intronic
1135728727 16:24876905-24876927 CTTTATCTTGGGGGCAATGGGGG + Intronic
1135834638 16:25814134-25814156 CTATATCTTGTTTTCAGTGGAGG + Intronic
1136312867 16:29425639-29425661 CTGTATCTTGATCGTATTGGTGG + Intergenic
1136326301 16:29527404-29527426 CTGTATCTCGATCGTATTGGTGG + Intergenic
1136440990 16:30267388-30267410 CTGTATCTCGATCGTATTGGTGG + Intergenic
1136468678 16:30463612-30463634 CTATATCTTGATTGTCATAGTGG + Intergenic
1137798792 16:51243709-51243731 CTGTATCCTGATTGTGATGGTGG + Intergenic
1138064773 16:53929171-53929193 CTGTACCTTGATTGTGGTGGTGG - Intronic
1138253220 16:55524457-55524479 TTGTGTCTTAATTGCAGTGGTGG + Intronic
1138371426 16:56530066-56530088 CTGTATTTTGATTGTGGTGGTGG + Intergenic
1138814166 16:60185257-60185279 CTGTAACCTGATTGTGATGGTGG + Intergenic
1139190185 16:64854465-64854487 CTGTGTCTTTATTGCAGTGGTGG + Intergenic
1139521948 16:67488199-67488221 TTGTATCTTGATCTCAGTGGTGG + Intergenic
1139995442 16:70976453-70976475 CTGGATCTTAATTGCGGTGGTGG + Intronic
1140160651 16:72488993-72489015 CTGTATCTTGATTGTAGTGGTGG - Intergenic
1141864654 16:86741717-86741739 CTGGACCTTCATGGCAATGGTGG - Intergenic
1142316563 16:89350702-89350724 CTGTATCATGACTGTGATGGTGG + Intronic
1143311330 17:5991962-5991984 CTGTATCTTGATTACAGTAGTGG - Intronic
1144325443 17:14175163-14175185 CTATATCTTGATTGTGGTGGTGG + Intronic
1144389684 17:14781640-14781662 CTGTATCTTGATTGTGATGGTGG - Intergenic
1144953583 17:19006610-19006632 CTGTATCTTGACTGTAATGGTGG - Intronic
1145243777 17:21254349-21254371 CTGTATTTTGATTTGGATGGTGG - Intergenic
1146451581 17:32978815-32978837 TTGTATCTGGATTGGAGTGGTGG - Intronic
1146581538 17:34042627-34042649 CTCTATCTTGATTGCTGTGATGG + Intronic
1146636059 17:34505884-34505906 CTGTATCATGATTGTGGTGGTGG + Intergenic
1146718610 17:35107049-35107071 CTATATGTAGATTCCAATGGAGG - Exonic
1146978380 17:37136161-37136183 CTCTATCTTGATTGTTGTGGTGG - Intronic
1147045625 17:37749800-37749822 CTATATTTTGATTGGGATGGTGG + Intergenic
1147342171 17:39759481-39759503 GTGTATCTTCATAACAATGGTGG + Intergenic
1147485858 17:40813244-40813266 CTGTATCTTGATTTGGGTGGTGG + Intergenic
1148988111 17:51641494-51641516 CTGTATCTTTATAGTAAAGGAGG + Intronic
1149286718 17:55173259-55173281 CTGTATCTTGATTACGGTTGTGG - Intergenic
1149349100 17:55769390-55769412 CTGTATCTTGGCTGCAAGGGAGG - Intronic
1149764409 17:59262934-59262956 TTGTATCTTGATTGCGGTAGTGG + Intronic
1149902124 17:60490109-60490131 CTGTATCTTGATAGTGATGGTGG + Intronic
1149935285 17:60799350-60799372 CTGTATCTTGATTGTGCTGGTGG - Intronic
1149956046 17:61051362-61051384 CTGTATCTTGATTGTAGTGGAGG + Intronic
1150021642 17:61621128-61621150 CTGTATCTTTATTGCAGTGGTGG - Intergenic
1150671951 17:67208323-67208345 CTGTATCTTAATTGTATTCGTGG + Intronic
1151774932 17:76194158-76194180 CTTTATTTTGTTTGTAATGGTGG - Intronic
1152492492 17:80646767-80646789 CTGTGTCTTTATTGCAAGAGTGG + Intronic
1153234535 18:2973284-2973306 CTGTATCTTGATTATAGTGGTGG - Intronic
1153516931 18:5912463-5912485 CTGTTTCTTGATTGAATTGGCGG - Intergenic
1153767871 18:8391642-8391664 TTGTATCTTGATCTGAATGGTGG + Intronic
1154291731 18:13114353-13114375 CTGTATCTTGGTTGGAGTGCTGG - Intronic
1155026985 18:21950073-21950095 CTGTATCTTGACTATAGTGGTGG - Intergenic
1155287570 18:24306712-24306734 CTCTATCTTGATAGGAGTGGTGG + Intronic
1156551350 18:38021814-38021836 CTGTATCTTAATTGTCATGGTGG + Intergenic
1156828338 18:41460706-41460728 CTGTATATTGATTGTTATTGTGG + Intergenic
1157632872 18:49117117-49117139 CTTTATCTTGATTGCACTGATGG + Intronic
1157664173 18:49471606-49471628 CTCTATCTTGATGTCAGTGGTGG - Intergenic
1157813300 18:50713170-50713192 ACGTATCTTGATTGTGATGGTGG + Intronic
1157994017 18:52533322-52533344 CTGTATCTTGACTGTAGTGATGG - Intronic
1158433427 18:57414390-57414412 CTGTATCTTGATTGTATTGATGG + Intergenic
1158880221 18:61771316-61771338 CTGTGTCTTCATTGTGATGGTGG - Intergenic
1158939147 18:62390948-62390970 CTATATCTTGATTGTGATGGTGG - Exonic
1159787777 18:72734876-72734898 CACTATCTTGATGGCAGTGGTGG - Intergenic
1161564343 19:4991699-4991721 CTGTATCTTGATTGCAATGGTGG - Intronic
1161601250 19:5184827-5184849 CTGTATCTTGATGGCGGTGATGG - Intronic
1163028113 19:14525708-14525730 CTGTATCTTGATTGTAGTGGTGG + Intronic
1164814740 19:31187094-31187116 CTGTGTCCTGATTGTAATGGTGG - Intergenic
1165617759 19:37217287-37217309 CTATATCCTGATTACGATGGTGG + Intronic
1166200837 19:41237090-41237112 CTGTGTCTTGATTTGGATGGTGG - Intronic
926501415 2:13657964-13657986 CTGTATCCTGATTGTAATGGTGG - Intergenic
926706254 2:15839829-15839851 CTGTGTATTGATTGCCCTGGTGG + Intergenic
926768346 2:16345235-16345257 CTGTATCTTAATGAGAATGGTGG - Intergenic
927052409 2:19343453-19343475 CCATATCTTGATTGTAGTGGTGG + Intergenic
927493308 2:23534991-23535013 CTGTATCATGATTGGGGTGGTGG + Intronic
927601587 2:24446959-24446981 CTGTAACTTGATTGTGGTGGTGG - Intergenic
928101769 2:28441963-28441985 CTATATCTTGATTGGAATTGTGG - Intergenic
928345734 2:30493604-30493626 CTGTATCTTGACTACAGTTGGGG - Intronic
928365389 2:30696551-30696573 TTGTATCTTGATTGTGATGCAGG - Intergenic
928551169 2:32372224-32372246 CTGTATCCTGACTGTGATGGTGG - Intronic
930115648 2:47716165-47716187 CTATATCTTGATTGAAGTTGTGG + Intronic
930279209 2:49350037-49350059 CTGTATTTTGATTGTGATGGTGG + Intergenic
931016551 2:57988061-57988083 CTGTATCTTGATTGTAATGGTGG + Intronic
931142221 2:59474253-59474275 CCGTATCTTAATTGTGATGGAGG + Intergenic
931245925 2:60492910-60492932 CTGTATCTTGATTTTGGTGGAGG - Intronic
931261172 2:60620634-60620656 CTGTGTGTTGATTGTAGTGGTGG + Intergenic
931477544 2:62605069-62605091 CTGTATCTTGATTGTAATGGTGG + Intergenic
931639694 2:64370902-64370924 CTGTGTCTTGACTGGGATGGTGG - Intergenic
931712125 2:64997411-64997433 CAGTATCTTGATTGTGGTGGTGG - Intronic
931737452 2:65209787-65209809 CTGTATCTTGACTGTGGTGGTGG - Intergenic
931795631 2:65707016-65707038 CTGTATCTTCATTGCATTGGTGG + Intergenic
932040670 2:68295793-68295815 CTGTATCTTGATTGGGATGGTGG + Intronic
932646109 2:73504331-73504353 CTGTATCTTGATTATGATGGCGG - Intronic
933207174 2:79520199-79520221 CTGTATCTTGATCGCACTGCTGG - Intronic
933912437 2:86954804-86954826 CTGTATCTTGACAGTAGTGGTGG - Intronic
934010558 2:87815091-87815113 CTGTATCTTGACAGTAGTGGTGG + Intronic
934051284 2:88213373-88213395 GTGTATCTTGATTGCGGAGGTGG - Intergenic
934102951 2:88670504-88670526 CTGTATCTTGATCACAGTGATGG - Intergenic
934286955 2:91658222-91658244 CTGTATCATGAATGCTGTGGTGG - Intergenic
934854376 2:97719800-97719822 CTGTATCTTGATTGATGTGGTGG - Intronic
934894702 2:98105454-98105476 CTCTCTCTTGATTGTAGTGGTGG - Intronic
934908738 2:98230588-98230610 CTGTATCTTGACTGTAGTGGTGG - Intronic
935247096 2:101228208-101228230 CTGTATCTTGATTGTGATGGTGG - Intronic
935437321 2:103048758-103048780 TTGTATTTTGATTGTAGTGGTGG + Intergenic
935774132 2:106455795-106455817 CTGTATCTTGACGGCAGTGGTGG + Intronic
935905935 2:107840118-107840140 CTGTATCTTGACGGCAGTGGTGG - Intronic
935992410 2:108732629-108732651 CTGTATCTTGACTGCAGTGGTGG - Intronic
936127725 2:109805284-109805306 CTGTATCTTGACGGCAGTGGTGG - Intronic
936216972 2:110566201-110566223 CTGTATCTTGACGGCAGTGGTGG + Intronic
936240593 2:110785439-110785461 CTATATCTTGATTGTGGTGGTGG - Intronic
936426110 2:112420785-112420807 CTGTATCTTGACGGCAGTGGTGG + Intronic
936850247 2:116887797-116887819 GTTTATCTTTATTGCAATGATGG + Intergenic
937348325 2:121142231-121142253 CTATATCTTGATTGTGGTGGTGG + Intergenic
937934077 2:127228617-127228639 CTATATCTTGACTGTAGTGGTGG - Intergenic
938141949 2:128801718-128801740 CTGCATCTTGAATATAATGGTGG - Intergenic
938147048 2:128843754-128843776 CATTCTCTTGATTGCAATGAAGG - Intergenic
938408854 2:131047465-131047487 CTGGGTCTTGAGTGCAAGGGAGG - Intergenic
938925435 2:136036887-136036909 CTTTATCTTGATTGCAGCAGTGG - Intergenic
939483719 2:142781525-142781547 ATTTATCTTGATTGTCATGGTGG + Intergenic
939640961 2:144639302-144639324 CTATATCTTGAACGCAGTGGTGG - Intergenic
939782588 2:146466436-146466458 CTCTATCTTGATAAAAATGGTGG - Intergenic
940155640 2:150653307-150653329 TTGTATCTTGATTGTGGTGGTGG + Intergenic
940281324 2:151992699-151992721 TTGCTTCCTGATTGCAATGGTGG - Intronic
941549615 2:166898694-166898716 CTGTGTCTTGATTGCTGTGGTGG - Intronic
942303168 2:174582071-174582093 CTATATCTTGATTGTGACGGTGG - Intronic
942940704 2:181612357-181612379 CTGTATCTTTATTGGGATAGTGG - Intronic
943371356 2:187020548-187020570 CTGTATCTTGACTGGGGTGGTGG - Intergenic
943748958 2:191491254-191491276 CTATGTCTTGATTGCAGTGATGG - Intergenic
944070935 2:195668189-195668211 CTTTATCTTGACAGCAATGTAGG - Intronic
945060547 2:205905029-205905051 CACTATCTTGATTGCAGTGATGG - Intergenic
945073264 2:206012293-206012315 CTGTATCTTGATTTAGGTGGTGG + Intronic
945816721 2:214613793-214613815 CTGGATCTTGATTAAGATGGAGG - Intergenic
945853877 2:215043767-215043789 TTGTATCTTAATTGGCATGGTGG - Intronic
946292973 2:218759602-218759624 CTGTATCTTGACTGTGGTGGTGG + Intergenic
946383974 2:219370447-219370469 CTGTATCTTGATTGTGGTGGTGG + Intergenic
946387839 2:219396200-219396222 CTATGTCTTGATTATAATGGTGG + Intronic
946768986 2:223068688-223068710 ATGTATCTTGATTGTAGTGATGG - Intronic
946895175 2:224317033-224317055 CTTTATCTTGATTGCAATGGTGG + Intergenic
947272405 2:228351995-228352017 CTGTATTTTGATTATAAGGGAGG - Intergenic
947423802 2:229964279-229964301 CTGTATCTTGATAATGATGGCGG - Intronic
947522680 2:230860625-230860647 CTGTATCTTGATTGGTTTGTTGG + Intergenic
947581355 2:231321190-231321212 CTGTCTCTAGATCGCAAGGGCGG - Intronic
948000937 2:234566928-234566950 CTGTATCTTCATTGTGGTGGTGG - Intergenic
948036269 2:234860658-234860680 CTGTATTTTGATTGAGGTGGTGG + Intergenic
1168738817 20:169910-169932 TTGTGTCTTGACTGTAATGGTGG + Intergenic
1168989776 20:2084803-2084825 CTGTATCTTGACTGTGGTGGTGG + Intergenic
1169247518 20:4035189-4035211 CTGTATCTTTTTTGTAATGTTGG + Intergenic
1169295409 20:4393145-4393167 CTGAATCTTGAATGTAGTGGTGG + Intergenic
1169297711 20:4414310-4414332 TTATATCTTGATTACAATGGTGG - Intergenic
1169558019 20:6769475-6769497 GTGTATCTTGACTGCACTGTGGG + Intronic
1170234749 20:14090234-14090256 CTGTATCTAGATTGTGGTGGTGG - Intronic
1170429330 20:16262129-16262151 CTTTATCTTGTTTGCAGTGAAGG - Intergenic
1170487508 20:16834110-16834132 CTATATCTTGATTGTGGTGGTGG + Intergenic
1170517880 20:17150597-17150619 CATTATCTTGATTGCAGTAGTGG - Intergenic
1170775284 20:19369976-19369998 CTGTATCTTGACTGGGATGTGGG + Intronic
1171024669 20:21618685-21618707 CTGTATCTCAATTACAGTGGTGG - Intergenic
1172041443 20:32049383-32049405 CTATATCTTGATTGGGGTGGTGG + Intergenic
1172309864 20:33909321-33909343 CTATATCTTGATTGTGATTGTGG - Intergenic
1172784873 20:37461490-37461512 CTATATCTTGATTGTAGTGGTGG - Intergenic
1173087538 20:39938466-39938488 TTGTATCTTGATATCAATGACGG + Intergenic
1173343141 20:42172775-42172797 CTGCATCTTGACTGTGATGGTGG - Intronic
1173766826 20:45618973-45618995 CTGTATGTTGAGTGCACTGAGGG + Intronic
1173905499 20:46625551-46625573 CTATATCTTGGTTGGGATGGTGG - Intronic
1174817709 20:53701126-53701148 CTGTATCTTGATTGTGGTGGTGG - Intergenic
1174876572 20:54232708-54232730 CTGTTCCTTCATTGCAATGGTGG - Intergenic
1176956303 21:15108261-15108283 CTGTACCCTGATTGTAGTGGTGG - Intergenic
1177309716 21:19374832-19374854 CTGTATCTTAATTACGATTGTGG - Intergenic
1177523483 21:22262484-22262506 TGGTATCTTGATGGCGATGGTGG + Intergenic
1177575730 21:22952753-22952775 CTGTATCTTAATTGTGCTGGTGG - Intergenic
1177649432 21:23941447-23941469 CTGTATCTGAATTCCAAGGGCGG - Intergenic
1178116927 21:29427274-29427296 CTGTGGCTGGAGTGCAATGGTGG + Intronic
1178784401 21:35639346-35639368 CTGTATCCTGATTGTGGTGGTGG - Intronic
1179161006 21:38899167-38899189 CTGAATCTTGATTGGGATGATGG + Intergenic
1179530824 21:42018232-42018254 CTGTAGCTTTATTGTCATGGTGG - Intergenic
1181020953 22:20102175-20102197 CTGCATCTTGATTGCAGTGTTGG - Intronic
1181425603 22:22835864-22835886 TTGTGTCTTGATTGTAGTGGTGG - Intronic
1181569858 22:23762687-23762709 CTGTATCTTGACTGTGGTGGTGG + Intergenic
1182074972 22:27489152-27489174 CTGTATCTTGACTGTGGTGGTGG + Intergenic
1182247484 22:28970919-28970941 CTGTATCTTGATAGTGGTGGTGG + Intronic
1182266957 22:29124459-29124481 CTGAATCCTGATTGTACTGGTGG + Intronic
1182342074 22:29631307-29631329 CTGTATCTTGAAAGCCAGGGGGG - Intronic
1182511599 22:30824138-30824160 CTGTATCTTGAGAGCAGTGACGG + Intronic
1182674305 22:32026044-32026066 CTACATCTTGATTGAGATGGTGG + Intergenic
1182888972 22:33800482-33800504 CTGTATCTTGATTGTGATGGTGG - Intronic
1183050000 22:35253193-35253215 CTTTATCCTGACAGCAATGGCGG + Intergenic
1183088641 22:35505596-35505618 CTGTATCTTGACTGTGACGGTGG - Intergenic
1183447056 22:37864340-37864362 CTATATCTTGATTGTGGTGGTGG + Intronic
1183478354 22:38049148-38049170 CTGTATCTTAATTGTGATGGTGG + Intergenic
1184299259 22:43545654-43545676 CTGTATCTTCAGTGCAAGGCTGG + Intronic
1184567812 22:45303135-45303157 CTGTATCTTGATTGTGTTGATGG - Intergenic
949577832 3:5355974-5355996 CTGTACCTTGATTGTGATGGTGG - Intergenic
950022130 3:9794708-9794730 CTGTATTTTGGTTGCAGTAGTGG - Intronic
950082022 3:10229450-10229472 CCGTATCTTGATTGTGGTGGTGG - Intronic
950129966 3:10535456-10535478 CTACATCTTGATTGTAGTGGTGG - Intronic
950746130 3:15090880-15090902 CTTTATCTTAATTGGAGTGGTGG + Intronic
950966229 3:17148034-17148056 CTGTATCTTGATTGTGGTGGTGG + Intergenic
952065666 3:29566810-29566832 CTGTATCTTGATCGTTATGGTGG + Intronic
952067412 3:29587928-29587950 TTGTGTCCTGATTGCAGTGGTGG + Intronic
952385311 3:32837293-32837315 CTATATCTTGATTGTGGTGGTGG - Intronic
952480590 3:33757070-33757092 CATTATCTTGATTTTAATGGTGG + Intergenic
952561691 3:34602979-34603001 CTGTATCCTGATTGTTATGGTGG + Intergenic
952972112 3:38657972-38657994 CTGTATCTTGACTGTGATAGTGG + Intergenic
953131081 3:40139339-40139361 CTGTATCTTGACTGTAGTAGTGG - Intronic
953155920 3:40373219-40373241 CTGTATCTTGATTGTGGTGGTGG + Intergenic
953189708 3:40672985-40673007 CTGTACCTTGATTGTGATGGTGG + Intergenic
953634116 3:44647877-44647899 GTGTATCTTGATTGCAGTGGTGG + Intronic
953751602 3:45612612-45612634 CTATATCTTGATAGGAATGTGGG - Intronic
953914799 3:46911401-46911423 GTGTATCTTGATTGTGGTGGTGG - Intergenic
953937664 3:47059746-47059768 CTGTATCATGATTGTGGTGGTGG + Intronic
954058483 3:48048867-48048889 CTGTATCTTGATTGCAGTTGTGG - Intronic
954078339 3:48197349-48197371 CTGTGTCTGGATTGCAGTGGTGG - Intergenic
954607849 3:51927914-51927936 CAGTATCTTGGTTGTGATGGTGG + Intergenic
954641727 3:52104381-52104403 CTATATCTTGATTGTGGTGGTGG + Intronic
954932181 3:54293854-54293876 CTGCATCTTGATTGTGGTGGTGG + Intronic
955044321 3:55345574-55345596 CTGTATCCTGATTGTGGTGGTGG + Intergenic
955696972 3:61646728-61646750 CTGTATCTAGATTGTGATGCTGG - Intronic
955846279 3:63166614-63166636 CTGTATTTTGACTGTGATGGTGG - Intergenic
955998465 3:64702746-64702768 CTGTTACTTGATTGGAGTGGTGG + Intergenic
956107714 3:65838100-65838122 GTGTATCTTGATTGGGGTGGTGG - Intronic
956154678 3:66282777-66282799 CTGTATCTTGATTGTGATGATGG - Intronic
956498219 3:69851715-69851737 CTGTATCTTGATTGTGCTGGTGG + Intronic
958026420 3:88055439-88055461 ATTTATCTTGATCACAATGGTGG + Exonic
958107161 3:89090923-89090945 CTGCATCCTGATTGTAGTGGGGG + Intergenic
958606796 3:96368445-96368467 CTGTATCTTGACTGTAATGGTGG - Intergenic
958838079 3:99170666-99170688 ATATATCTTGATTGCAAAGTTGG + Intergenic
958839220 3:99183411-99183433 CTATATCTTCATTGTGATGGTGG - Intergenic
958921962 3:100116975-100116997 CTGTATCTTCATGGCAAGGTAGG + Intronic
959284072 3:104384515-104384537 CTGTATCATGAATGCAGTGGTGG + Intergenic
959335856 3:105064538-105064560 CTGTATTATGATTGCACTGGAGG - Intergenic
959347088 3:105210128-105210150 CTGTATCTTGATTGCAGTAATGG - Intergenic
959895839 3:111604953-111604975 CTGTATATTGATTAAAATAGAGG - Intronic
959914895 3:111805808-111805830 TTATATCTTGATTGTGATGGTGG + Intronic
960813753 3:121652272-121652294 CTATATCTTGATTGCATTGGTGG + Intronic
961205541 3:125078562-125078584 CTGTAACTTGATTTCGGTGGTGG - Intergenic
961230498 3:125303281-125303303 CTGAATCTTGATTGCTTTGGTGG + Intronic
961505319 3:127367125-127367147 CTGTACCTTGCTTGCGGTGGGGG + Intergenic
961756737 3:129132133-129132155 CTGTATCTGGATTGTCATGATGG + Intronic
961972208 3:130981129-130981151 CTATATCTTGATTGTGGTGGTGG - Intronic
962262782 3:133925433-133925455 CTATATCTCGATTAAAATGGTGG + Intergenic
962299953 3:134230732-134230754 CTATATCTTGGTTGGAGTGGTGG + Intronic
962659665 3:137588670-137588692 CTGTCTCCTGATTGCAAATGGGG - Intergenic
962945729 3:140167634-140167656 CTGTATCTTGATTGTAGTGGTGG - Intronic
963157565 3:142115808-142115830 TTGTATCTTGATTGTGGTGGTGG + Intronic
963648969 3:147953040-147953062 CTGTGTCTTCATTGCAGTGGTGG + Intergenic
963728201 3:148945605-148945627 CTTCATGGTGATTGCAATGGTGG + Intergenic
963765411 3:149329932-149329954 TGTTATCTTGACTGCAATGGTGG + Intronic
964278597 3:155036354-155036376 CTATATCTTGATTCCAGTGATGG - Intronic
964623940 3:158741011-158741033 CTGTATCTTGCATGCTCTGGGGG + Intronic
964666301 3:159177652-159177674 CTCTACCTTGATTGCACTGGTGG + Intronic
965043844 3:163549554-163549576 CTGTGTCCTGATTGTTATGGTGG + Intergenic
965044937 3:163564826-163564848 CAGTCTCTTTATTGCAATGTAGG - Intergenic
965448003 3:168799943-168799965 CTTAATCATGATTCCAATGGTGG - Intergenic
966065940 3:175821750-175821772 CTGTATCTTGACTGCGGGGGTGG + Intergenic
966816521 3:183894314-183894336 CTGTATCTTGATTGTGGTGATGG - Intergenic
967176642 3:186866692-186866714 CTGTATCTTTTTTGTAATGTTGG + Intergenic
967477904 3:189942042-189942064 CTGTGTCATGATTACAGTGGTGG + Intergenic
967596857 3:191335872-191335894 CTGTATCTTGATTGTTGTGGTGG - Intronic
967757665 3:193188326-193188348 CTCTATCTTGATCCAAATGGTGG + Intergenic
967846639 3:194048418-194048440 CTGTTTGTTGACTGCCATGGAGG - Intergenic
968128924 3:196180578-196180600 CAGCATCTTGATTGCAGTGGTGG + Intergenic
968151450 3:196339732-196339754 CTGTATCTTGATTTCTGTGCTGG - Intergenic
968260822 3:197322607-197322629 TTGTATCTTGATTGTTGTGGTGG + Intergenic
969020546 4:4137360-4137382 CTGTACATTGATTGCTATGTTGG - Intergenic
969287034 4:6209187-6209209 CTGTATCTTGACTGCGGTGCTGG + Intergenic
969733286 4:8969976-8969998 CTGTACATTGATTGCTATGTTGG + Intergenic
969792876 4:9504052-9504074 CTGTACCTTGATTGCTATGTTGG + Intergenic
970544082 4:17108878-17108900 CTACATCTTGATTGTAGTGGTGG - Intergenic
971781453 4:31040181-31040203 CTATATCCTGATTGGAGTGGTGG - Intronic
972949804 4:44304795-44304817 CTATATCTTGATTATGATGGTGG + Intronic
973016360 4:45143500-45143522 CTGTAACTTAATTGCAATAATGG - Intergenic
973841833 4:54869956-54869978 TTGTATTTTGATTGCAGTAGAGG + Intergenic
973917335 4:55649057-55649079 CTGTATCTTGACCGCGGTGGTGG - Intergenic
974544403 4:63281827-63281849 CTATATCTTGATTGTGAAGGTGG - Intergenic
974930510 4:68356141-68356163 CTATATCTTGATTGTTGTGGTGG + Intergenic
975857061 4:78635950-78635972 CTATATCTTGTTTTGAATGGTGG + Intergenic
977098854 4:92782010-92782032 CAGTATCTGGATTTTAATGGAGG + Intronic
978371471 4:108033666-108033688 GTGTATCTTGCTTGCAATGGAGG - Intronic
978831747 4:113094704-113094726 TTTTATCTTGATTGCAGTGATGG - Intronic
979346517 4:119593641-119593663 CTATATCTTGATTGCAGTGGTGG + Intronic
979637068 4:122968375-122968397 CTGTATCTTGATCTGAGTGGTGG - Intronic
979693610 4:123586963-123586985 CTATATCTTGATTGTGGTGGTGG + Intergenic
980141497 4:128923137-128923159 CTGTATCTTAATTGCAGCGGTGG - Intronic
980214908 4:129839590-129839612 TTGTATCTTGATTGTACAGGTGG + Intergenic
981239416 4:142458334-142458356 CTGTGCCTTGATTGTAGTGGTGG + Intronic
981632720 4:146839614-146839636 CTGTATCTTGATTGCAGTGGTGG - Intronic
982548551 4:156766238-156766260 TTGTATCTTCATTGAAATGCTGG - Intronic
984535304 4:180967866-180967888 CTGTATCTTGTTTGTGGTGGCGG - Intergenic
987071727 5:14343323-14343345 CTGTATCTTGAAAGTGATGGTGG - Intronic
989812067 5:45689836-45689858 CTCTATGTTGAATGAAATGGAGG + Intronic
989972172 5:50537656-50537678 CTAAATCTTGATTGTGATGGTGG - Intergenic
990091415 5:52055476-52055498 CTGTATCTTGACTGTAGTGGTGG + Intronic
990971531 5:61512074-61512096 CTCTATCTTGATTGTGGTGGTGG - Intronic
991137608 5:63200447-63200469 CTGTATCTTGATTGTGATGGTGG + Intergenic
991678151 5:69109500-69109522 CTATATCTTGCTTGTAATGATGG - Intronic
992189588 5:74278102-74278124 CTCTATCTTGGTTGTGATGGTGG - Intergenic
992418050 5:76571964-76571986 CTGTGTCTTGATTGTGGTGGTGG - Intronic
993297499 5:86161192-86161214 CTGTATCTTGATTGTGGTGTTGG + Intergenic
993795505 5:92261518-92261540 CCGTTCCTTGATTGCAATGGTGG + Intergenic
993804885 5:92393532-92393554 CTATATCTTGATTACAGTAGTGG - Intergenic
993852537 5:93028944-93028966 TTGTATCCTGATTGTGATGGTGG - Intergenic
994339748 5:98612619-98612641 CTGTATGTTGATGGCACTGTTGG - Intergenic
994414227 5:99447957-99447979 CTGTATCCTGATTGCAGGGGTGG - Intergenic
994602098 5:101919234-101919256 CTGTATCTTGATTGTGACAGTGG + Intergenic
995491353 5:112695065-112695087 CTATATCTTGATTGTGGTGGTGG + Intergenic
995776758 5:115731682-115731704 TCATATCTTGATTGTAATGGTGG - Intergenic
995843586 5:116468380-116468402 CTGTCTTTTCATTGGAATGGAGG + Intronic
996255435 5:121397138-121397160 CTATATCTTCATTGCAATCGTGG + Intergenic
996488416 5:124064204-124064226 CTGTAACTTAAATGCTATGGTGG + Intergenic
996869508 5:128172443-128172465 CTGTATCTTTATTGCAATGGTGG - Intronic
997173863 5:131753647-131753669 CTTTATCTTTATTGCCATTGTGG + Intronic
997275847 5:132588370-132588392 CAGTATCTTGACTGCCATAGTGG + Intronic
997710169 5:135997485-135997507 CTGTGTCTTGATTGTCGTGGCGG - Intergenic
998155679 5:139785626-139785648 CTGAATCATGCTTCCAATGGAGG - Intergenic
998447234 5:142207713-142207735 TTGTATCTTGATTGTAGTGGTGG - Intergenic
998721677 5:144958992-144959014 CTGTATCATGATGGTAGTGGTGG - Intergenic
999183117 5:149684118-149684140 TTATATCCTAATTGCAATGGTGG - Intergenic
999235563 5:150090368-150090390 CTATATCTTGACTACAGTGGTGG - Intronic
999426767 5:151494385-151494407 CTGTATCTTGATTGAGATGGTGG - Intergenic
999432009 5:151532311-151532333 CTGTATCTTGATTGTGGTGTTGG + Intronic
999447869 5:151655162-151655184 CTGTATCTTGATTGTGGTGGTGG + Intergenic
999509323 5:152231658-152231680 CTATATCTTGATTGGGATGGTGG - Intergenic
1000131841 5:158307481-158307503 GTGTCTCTTGAGTGGAATGGAGG + Intergenic
1000323249 5:160151861-160151883 CTGTTTCTTGACTGTGATGGTGG - Intergenic
1000847331 5:166298098-166298120 CTGTATCTTGAGTATAATAGTGG - Intergenic
1001427381 5:171632102-171632124 CTGTGTCTTGATTGTGGTGGTGG - Intergenic
1002464192 5:179397441-179397463 CTTTATCTTGATTGAGGTGGTGG + Intergenic
1003202946 6:3979484-3979506 GTGTATCTTGATTGTGATGGTGG - Intergenic
1003275933 6:4653135-4653157 CTGTATCATAATTGTAGTGGTGG + Intergenic
1004147862 6:13086424-13086446 CTGTATCTTGATTGTGGAGGGGG - Intronic
1004912014 6:20294954-20294976 CTATATCTTGATTACGATGGTGG - Intergenic
1004968504 6:20881862-20881884 CTGTATCTTGATTGCAGCAGTGG - Intronic
1005359912 6:25022163-25022185 CTGTATCTTGATTGTGGTGGTGG - Intronic
1005366030 6:25078016-25078038 CTGTATCTTGATGGTGGTGGAGG - Intergenic
1005394175 6:25364336-25364358 CTGTATCTTAACTGCGGTGGTGG - Intronic
1006214443 6:32428238-32428260 CTGTATTTTGATCACAGTGGTGG - Intergenic
1006722797 6:36169683-36169705 CTGTATGTTGAGTGCAGTGGTGG + Intergenic
1006724829 6:36190743-36190765 CTGTAAGTTGATGGCAGTGGTGG - Intergenic
1007296959 6:40830866-40830888 CTGTATCTTGATTATGGTGGTGG + Intergenic
1008469800 6:51871576-51871598 CTGTGTCTTGATTGTCGTGGTGG + Intronic
1008599286 6:53074569-53074591 CTGTATCTTGATTGTGGTGGTGG - Intronic
1009744676 6:67797807-67797829 CATTATCTTGATTGTCATGGTGG - Intergenic
1009799353 6:68514382-68514404 TGGTACCTTGATTGCAGTGGTGG - Intergenic
1010161224 6:72858750-72858772 CTGTATCTTGATTGTGGTGGTGG + Intronic
1010177866 6:73050653-73050675 CTGTATTTTGATTGTGGTGGTGG - Intronic
1010725722 6:79330299-79330321 CTGTATCTTGATTGCTGTGGGGG - Intergenic
1011048201 6:83110947-83110969 CTGTGTCTTGATTGCAATAGTGG - Intronic
1011532987 6:88344795-88344817 TTGTGCCTTGATTGCCATGGGGG - Intergenic
1011543616 6:88460783-88460805 CTCTACTTTGATTGCAGTGGTGG - Intergenic
1012123711 6:95399751-95399773 CTGTATCTTTATTCCCAAGGAGG + Intergenic
1012409135 6:98936248-98936270 CTGTATCTTGATTTTGGTGGTGG - Intronic
1012552348 6:100475322-100475344 CTGTATCTTAATTGTAGTGATGG - Intergenic
1012970459 6:105724359-105724381 CTGTAACCTGACTGCAATGGTGG + Intergenic
1013078438 6:106791556-106791578 CTGTATCGTGATTGTGGTGGTGG - Intergenic
1013659930 6:112284837-112284859 CTGTATCCTGATTGTGATGGTGG + Intergenic
1014042491 6:116845543-116845565 CTGTATCTTGATGTCAGTGTAGG - Intergenic
1014402258 6:121005250-121005272 CTATATCTTGATTGTGGTGGTGG + Intergenic
1016075472 6:139789626-139789648 CTGTGTCTTGATGGCCATGTTGG + Intergenic
1017032344 6:150235402-150235424 CTGCATCTTGATAGTCATGGTGG + Intronic
1017341745 6:153332203-153332225 CTATATCCTGATTGTAGTGGTGG - Intergenic
1019315789 7:385779-385801 CTGCCTCTTGACTGCAGTGGGGG + Intergenic
1019753803 7:2752934-2752956 GTGTCTCTTGATTGCAGTGGTGG - Intronic
1020219174 7:6221482-6221504 CTGTATCTTGATTGCAGCGGTGG + Intronic
1020492491 7:8805203-8805225 CTGTATCTTGAGTGTGGTGGTGG + Intergenic
1020566245 7:9799234-9799256 CTATATCTTGATTGTAATGGTGG + Intergenic
1021419159 7:20425447-20425469 CTGTATCTTGATTGTGGTAGTGG - Intergenic
1021439083 7:20657674-20657696 CTATATCTTTATTGGTATGGTGG + Intronic
1022033226 7:26511326-26511348 CTGTTTCTTGATTGGGATGATGG + Intergenic
1022177343 7:27884471-27884493 CTGTGTCTTGATTGGGATGTTGG - Intronic
1022280060 7:28899080-28899102 CTGTATCTTGATCTGAGTGGTGG + Intergenic
1022422739 7:30239348-30239370 TTGCATCTGGAGTGCAATGGGGG - Intergenic
1023137855 7:37071060-37071082 CTGTATCCTGATTTTGATGGTGG + Intronic
1023681269 7:42690384-42690406 CTGTGTCTTGATTGTGATGATGG + Intergenic
1024010739 7:45264498-45264520 CTGTATCTTGATTGTGGGGGTGG - Intergenic
1024356578 7:48419476-48419498 CTGTACTTTGATTGGAGTGGTGG - Intronic
1024468492 7:49740213-49740235 CTGTATCTTGATTGTGGTAGTGG + Intergenic
1024515931 7:50256068-50256090 CTTTACCTTGACTGCTATGGTGG - Intergenic
1025853733 7:65261347-65261369 CTGTATCTTTTTTGTAATGTTGG + Intergenic
1026167815 7:67926096-67926118 ATGTATCTTAATTGCAGTAGTGG - Intergenic
1026922390 7:74165755-74165777 CTGTGTCTTGATTGAGATGCTGG + Intergenic
1026998564 7:74635605-74635627 CTGTATCTTGATTATGGTGGGGG + Intergenic
1027054463 7:75040492-75040514 CTGTATCTTGGTTGCCATTAGGG + Intronic
1028012174 7:85659987-85660009 CTGTACCTTGACTGTAATAGTGG - Intergenic
1028064447 7:86364844-86364866 CTGTACCTTAATTGTAATGATGG + Intergenic
1028106359 7:86883796-86883818 CTATATCTTGATAGGAATTGGGG + Intronic
1028583152 7:92427253-92427275 CTGAATCTTGATTGTGATGGAGG - Intergenic
1028786837 7:94804448-94804470 CTGAATCTTGATTATAGTGGTGG + Intergenic
1028843732 7:95456417-95456439 CGGTATCTTGACTGTGATGGTGG - Intergenic
1028924607 7:96344334-96344356 CTGCATCTTGATTGAGGTGGAGG - Intergenic
1029079097 7:97958400-97958422 CTGTACATTGATTGCTATGTTGG - Intergenic
1029154766 7:98508333-98508355 CTGTATCTTGATTGCAGTGGTGG + Intergenic
1029237498 7:99133039-99133061 GGTCATCTTGATTGCAATGGTGG + Intronic
1029926681 7:104326669-104326691 ATGCATCTTGAGTGCATTGGTGG - Intergenic
1030240894 7:107323051-107323073 CTATATCTTAATTGTAATGATGG + Intronic
1030503853 7:110395020-110395042 CATTATCTTGATTGCAGTGATGG + Intergenic
1030621537 7:111796007-111796029 CTGTATCTTGAGTGCCCTAGAGG + Intronic
1031138538 7:117914186-117914208 ATGTGTCTTGATTGTGATGGTGG - Intergenic
1031304115 7:120102449-120102471 CTCTATCTTGATTGGAGTGTTGG - Intergenic
1031910471 7:127511851-127511873 CAGGATCTTGACTGCAGTGGTGG + Intergenic
1032064664 7:128758017-128758039 CATTATCGTGATTGCAGTGGTGG - Intronic
1032769997 7:135042566-135042588 CTGTATCTTGAGTGTGATGGTGG + Intronic
1032887549 7:136157826-136157848 CAGTGTCTTGATTGTAGTGGTGG - Intergenic
1033011937 7:137632555-137632577 CTGTATCTTTATTTTAATAGGGG - Intronic
1033207495 7:139435538-139435560 CTATATCATGATTGCAGTGGTGG - Intergenic
1033969643 7:147024264-147024286 CTATATCGCAATTGCAATGGTGG + Intronic
1034178513 7:149119543-149119565 GTGTTTTTTGATTGCAGTGGTGG - Intronic
1035137032 7:156713674-156713696 CACTATCTTGATGGCAGTGGTGG + Intronic
1036401259 8:8410599-8410621 CTGTATGTTGATTGTGGTGGTGG - Intergenic
1037395734 8:18440750-18440772 CTGTATCTTGACTGTGATGGTGG + Intergenic
1037663670 8:20948824-20948846 ATATATCTTGATTGTAGTGGTGG + Intergenic
1038320046 8:26517616-26517638 CTGTGTCTGGAGTGGAATGGAGG - Intronic
1039519264 8:38156678-38156700 CTGTATCTTGATCGTGATAGTGG + Intergenic
1039994702 8:42521794-42521816 CTGTATCTTGATTGTGGTAGTGG + Intronic
1040617534 8:49053223-49053245 CTATATCTTGATTGGAATGGTGG + Intergenic
1040660456 8:49569347-49569369 CTGTGTCTTAATTGCACTGGTGG + Intergenic
1040790846 8:51228109-51228131 CTGTATCTAGACTGCAGTGGTGG + Intergenic
1042218162 8:66447990-66448012 TTGTATCTTGATTGGGGTGGTGG - Intronic
1042272091 8:66964863-66964885 CTGTATCTTTATTGCATTGATGG - Intronic
1043960008 8:86406714-86406736 CTGTACCTGGATTGAACTGGTGG - Intronic
1043964431 8:86457036-86457058 CTATATCTTGATTGTAATGGTGG + Intronic
1044009876 8:86981537-86981559 CTGTCTCTTGATTGCGGTGATGG - Intronic
1045105242 8:98886117-98886139 CTGTATCTTGATTGTGGTGGTGG + Intronic
1045161572 8:99552929-99552951 CTGTATCTTGATTGTGATGGTGG - Intronic
1045208892 8:100074359-100074381 CTGTATCTTGATTGTAGTCCTGG - Intronic
1045408405 8:101891190-101891212 CTCTATCTTGATTGTAGTGGTGG - Intronic
1045551640 8:103178304-103178326 CTGTATCTTGGTTGCAGTGGTGG + Intronic
1046664386 8:116983914-116983936 CTGCATCTTGATTGTGATTGTGG - Intronic
1047193042 8:122695851-122695873 CTGTATCTTGATTGGGATGGTGG + Intergenic
1047196168 8:122723504-122723526 CTGTATCCTGATTATGATGGAGG - Intergenic
1047335290 8:123930249-123930271 CTGTATCTTGATTGTGGTGGTGG - Intronic
1047359795 8:124158688-124158710 CTGTACCTTGATTTGAATGCTGG - Intergenic
1048891290 8:138950503-138950525 CTGTATCTTGATTGTGGTGGCGG - Intergenic
1050186332 9:2979029-2979051 CTATATCTTGATTGTGGTGGTGG - Intergenic
1050499203 9:6277148-6277170 CTATATCTTGATTGTGGTGGTGG + Intergenic
1050582298 9:7072673-7072695 GTGTATCTTGATTGTGGTGGAGG + Intronic
1050592878 9:7178391-7178413 CTTTATCTTGATTATGATGGTGG + Intergenic
1050990722 9:12148880-12148902 CTATATCTTGATTGTAGTGGTGG + Intergenic
1051103743 9:13552740-13552762 CTGTATCTCGATTGTGACGGTGG - Intergenic
1051683532 9:19632894-19632916 AATTATCTTGATTGCAGTGGTGG - Intronic
1051685463 9:19654015-19654037 CTGTATCGTGAGTGCGGTGGTGG - Intronic
1051973252 9:22916884-22916906 CTACATCTTGATTGTAGTGGTGG + Intergenic
1052147049 9:25062203-25062225 CTGTATCTTGATTTTATTGGTGG - Intergenic
1052284095 9:26765021-26765043 CTATATCTTGATTTTGATGGTGG - Intergenic
1052521863 9:29558453-29558475 CTGTATCTTGACTGGGATGGTGG - Intergenic
1052810273 9:33052039-33052061 CTGTATCCTGATTGTAATGGTGG + Intronic
1053030391 9:34771672-34771694 CTGTACCTTGATAGCAGTGGTGG - Intergenic
1053473698 9:38365670-38365692 CTGTATCTTGATTGATGTAGTGG - Intergenic
1055173576 9:73290215-73290237 CTGTTTATTGAGTGCCATGGGGG + Intergenic
1055188143 9:73481606-73481628 CTGTATCTTGATTGCCAGGGTGG + Intergenic
1055328462 9:75156994-75157016 CTGTATCCTGATTGTGGTGGTGG - Intergenic
1055510554 9:76992007-76992029 CTCTATCTTGATTGTAGTTGTGG - Intergenic
1055635561 9:78274392-78274414 CTGTATCCTGATTGCGGTGGTGG + Intronic
1055741973 9:79399352-79399374 CTGTATCTTGACTGTGGTGGAGG + Intergenic
1056144335 9:83714695-83714717 CTGTATCTTGACTGCAGTGATGG - Intergenic
1056709565 9:88979894-88979916 CTGTAACTTGATTGCAGTAATGG - Intergenic
1057127655 9:92631819-92631841 CTGTATCTTGACTGTGGTGGTGG - Intronic
1057710278 9:97435084-97435106 CTGTATGTTGATTGTACTGGTGG + Intronic
1057788670 9:98108003-98108025 CTGCATTTTGATTGCAGTGGTGG + Intronic
1058170158 9:101670710-101670732 CTGTATCATTACTGCTATGGAGG + Exonic
1058384975 9:104425188-104425210 CTATATTTTTATTGTAATGGTGG - Intergenic
1058737895 9:107911539-107911561 CTGTCTCTTGATTCTAATGAAGG + Intergenic
1058839092 9:108888305-108888327 CTAGATCATGAGTGCAATGGTGG + Intronic
1058853857 9:109040426-109040448 CTACATCTTGATTGTAATGATGG - Intronic
1059188027 9:112294584-112294606 CTTGTTCTTAATTGCAATGGAGG - Intronic
1059935052 9:119301590-119301612 CTGTCTCTTGATCGCAGTGGTGG + Intronic
1060203831 9:121669989-121670011 CTGGATGCTGATTGCAGTGGTGG - Intronic
1060304752 9:122401306-122401328 CTATATCTTGATTTCTATGGCGG - Intergenic
1061998517 9:134203176-134203198 CTATAGCTTGATTACAGTGGTGG + Intergenic
1185696711 X:2200441-2200463 TTGCATCGTGATTCCAATGGGGG - Intergenic
1186424454 X:9452988-9453010 CTGTATCTTGATGGTAGTGCTGG - Intergenic
1186588143 X:10898499-10898521 CTGTGCCTTGATTGCCGTGGTGG - Intergenic
1186681693 X:11881683-11881705 CTGTATCTTGATTGTAGTCATGG + Intergenic
1186828216 X:13363092-13363114 CCTTATCTTGATTGCAGTGTTGG + Intergenic
1186969377 X:14823762-14823784 CTATATCTTGATTGGGGTGGTGG - Intergenic
1186995923 X:15122351-15122373 CTGTATTTTGATTGTGGTGGTGG - Intergenic
1187406768 X:19011296-19011318 ATGTATCTTGATTATGATGGTGG + Intronic
1187568531 X:20477020-20477042 CTGTGTCTTGATTGTAGTGGGGG + Intergenic
1187625375 X:21106443-21106465 CCGTATCTTGATTGCCATCGTGG - Intergenic
1187714364 X:22087985-22088007 CTATTTCTTGATTACAGTGGTGG - Intronic
1187820465 X:23282357-23282379 CTATATCTTGATTGTCATGGTGG + Intergenic
1187960808 X:24564689-24564711 CTATGCCTTGATTGCAGTGGTGG - Intronic
1188019353 X:25140110-25140132 CTGTATCTTGATTGCAGTAGTGG + Intergenic
1188121435 X:26313018-26313040 CTGTATATTGTCTGCGATGGCGG + Intergenic
1188526298 X:31091475-31091497 CTATAACCTGATTGGAATGGTGG + Intergenic
1188538648 X:31225035-31225057 TTATATCTTGATTGGCATGGTGG + Intronic
1188914758 X:35896773-35896795 CTATATCTTGAGTGTGATGGTGG + Intergenic
1189597640 X:42586431-42586453 CTGTATCCTGATTGCTGTGGTGG + Intergenic
1189739997 X:44107815-44107837 CTGTATCTTGATTATGGTGGTGG - Intergenic
1189866049 X:45328410-45328432 CTGTATCTTGACTGTGGTGGTGG - Intergenic
1190211151 X:48449054-48449076 CTGTATCTTGATTACGGTGTTGG + Intergenic
1190364834 X:49682281-49682303 CTATATCTTGATTGTGATAGTGG - Intergenic
1190790351 X:53694131-53694153 CTGTATCCTGATTGTGGTGGTGG + Intergenic
1190792553 X:53713568-53713590 CTATATCTTGATTGTGGTGGTGG - Intergenic
1190795739 X:53739578-53739600 TTGTATGTTGACTGCAGTGGTGG - Intergenic
1190816181 X:53931725-53931747 CTGTATCTTGATAGGGATGTGGG + Intergenic
1190890627 X:54564272-54564294 CTGTACCTTGGTTGCATTGGTGG - Intergenic
1191077503 X:56470712-56470734 CTATATCTTAATTGTGATGGTGG - Intergenic
1191200529 X:57776425-57776447 CTGAAGCTTAACTGCAATGGTGG - Intergenic
1192187412 X:68959607-68959629 CTGTGTCTTGATTGGGGTGGTGG - Intergenic
1192354743 X:70390707-70390729 CTGTATCTTGATTGTTGTAGTGG - Intronic
1192401189 X:70837824-70837846 CTGTATCTTGATTGTGGTGGTGG + Intronic
1192566357 X:72167110-72167132 CTGTATCTTGATTGTGACGGAGG + Intergenic
1192806757 X:74517071-74517093 CTGTATCTTGATCACAATGGTGG + Intronic
1192846844 X:74915109-74915131 TTTTATCTTGATTGTGATGGTGG + Intronic
1193063426 X:77231402-77231424 CTCTATCTTGATAGCAGTGGTGG + Intergenic
1193149235 X:78107320-78107342 CTGTATCTTGATTGTGGTGGCGG - Intronic
1193451088 X:81668166-81668188 CTACATCTTGATTTCAGTGGTGG - Intergenic
1194561385 X:95426262-95426284 CTGTGTCTTGATTGTGGTGGTGG + Intergenic
1194890657 X:99373997-99374019 CTGTATCTTGATTGCAGTTGTGG + Intergenic
1195273628 X:103256834-103256856 CTGTATTCTGATTGCAGTGGTGG - Intergenic
1195651930 X:107293990-107294012 GAGTATCTTGACTGCGATGGTGG - Intergenic
1196135263 X:112202042-112202064 CTGTATCTTGACTGTGGTGGTGG - Intergenic
1196279507 X:113806591-113806613 CTATATCTTGATTGTAGTGATGG + Intergenic
1196282815 X:113843288-113843310 CTACATCTTGATTGCAGTGATGG - Intergenic
1196939956 X:120765751-120765773 CTGTATCTTGATTGTGGTGGTGG + Intergenic
1198250954 X:134878766-134878788 TTGCATCTTGAGTGCAATGGTGG - Intergenic
1198309012 X:135411705-135411727 CTATATCTTGATTGTGGTGGTGG + Intergenic
1199174382 X:144768069-144768091 ATATATCTTGATTGTAATTGTGG - Intergenic
1199329391 X:146541833-146541855 CTATTTCTTTATAGCAATGGAGG - Intergenic
1199351001 X:146799859-146799881 ATGTATCTTGCTTGCATTTGTGG - Intergenic
1199353102 X:146828260-146828282 ATGTATCTTGCTTGCATTTGTGG + Intergenic
1199932791 X:152541450-152541472 CAGTATCTTGACTGTGATGGTGG - Intergenic
1200362243 X:155620734-155620756 CTGTATCTTGATTGTGTTGTTGG + Intronic
1201728629 Y:17182741-17182763 CTTTATCTTGATTGTGGTGGTGG + Intergenic