ID: 1161569096

View in Genome Browser
Species Human (GRCh38)
Location 19:5020467-5020489
Sequence GTTGAAGGGTGCAGCCGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161569096_1161569100 1 Left 1161569096 19:5020467-5020489 CCACGGCGGCTGCACCCTTCAAC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1161569100 19:5020491-5020513 TTCCCACCAGCCGTGCATGAGGG 0: 1
1: 9
2: 159
3: 757
4: 1902
1161569096_1161569106 17 Left 1161569096 19:5020467-5020489 CCACGGCGGCTGCACCCTTCAAC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1161569106 19:5020507-5020529 ATGAGGGCTGCCTCTGGTCTTGG 0: 1
1: 0
2: 2
3: 15
4: 216
1161569096_1161569099 0 Left 1161569096 19:5020467-5020489 CCACGGCGGCTGCACCCTTCAAC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1161569099 19:5020490-5020512 ATTCCCACCAGCCGTGCATGAGG 0: 1
1: 8
2: 168
3: 802
4: 1988
1161569096_1161569108 30 Left 1161569096 19:5020467-5020489 CCACGGCGGCTGCACCCTTCAAC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1161569108 19:5020520-5020542 CTGGTCTTGGAAAAGACTCTCGG 0: 1
1: 0
2: 2
3: 16
4: 224
1161569096_1161569105 11 Left 1161569096 19:5020467-5020489 CCACGGCGGCTGCACCCTTCAAC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1161569105 19:5020501-5020523 CCGTGCATGAGGGCTGCCTCTGG 0: 1
1: 0
2: 2
3: 15
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161569096 Original CRISPR GTTGAAGGGTGCAGCCGCCG TGG (reversed) Intronic
901618253 1:10559579-10559601 GTTGAGAGCTGCAGCAGCCGTGG - Intronic
902189015 1:14747792-14747814 GTGCAATGGTGCAGCCGCTGTGG - Intronic
904337261 1:29805991-29806013 GGTGAAGGGTGCAGGCCTCGGGG + Intergenic
904837737 1:33349868-33349890 CTCGAGGGCTGCAGCCGCCGCGG + Intronic
906002253 1:42436872-42436894 GTAAAAGGGTGCAGCCTCTGTGG + Intronic
906183460 1:43841113-43841135 TTTGCAGGGTGCAGCCCCTGTGG + Intronic
908321116 1:62979901-62979923 GGTGAAGTGTTCAGCTGCCGAGG + Intergenic
909699859 1:78511039-78511061 TTTGCAGGGTGCAGCCACCATGG + Intronic
909709338 1:78628036-78628058 GTTGAAAGATGCAGCCGTCAGGG + Exonic
911193984 1:94975572-94975594 GTAGAATGGTGCAGCAGCTGTGG - Exonic
914782059 1:150794304-150794326 GTAAAAGGGTGCAGCTGCAGTGG - Intergenic
915733467 1:158070115-158070137 GCTGAAGAGTGCAGCCTCCCAGG + Intronic
916400975 1:164448347-164448369 TTTGCAGGGTGCAGCCCCTGTGG + Intergenic
923488519 1:234460606-234460628 GTAAAACGGTGCAGCCGCTGTGG + Intronic
1069933740 10:71900971-71900993 GTGGATGGGTGCAGCCGGCCTGG + Intergenic
1070100000 10:73376569-73376591 GTAAAAGGGTGCAGCTGCTGTGG + Intronic
1070315658 10:75309432-75309454 GTTGAAGGATGCAGTGGCTGTGG - Intergenic
1073417549 10:103396703-103396725 GTAGCTGGGTGCAGACGCCGTGG + Exonic
1074694962 10:116042063-116042085 GTGTAAGGGTGCAGCCAGCGTGG - Intergenic
1076797006 10:132803259-132803281 GTTGTGGGGTGCAGGCTCCGCGG + Intergenic
1076877173 10:133221577-133221599 GGGGGAGGGTGGAGCCGCCGTGG - Intronic
1077186786 11:1239051-1239073 GCTGAAGGGTGGAGCTGCTGGGG + Intronic
1082948812 11:58788821-58788843 TTTGAAGGGTGTAGCCTCCATGG + Intergenic
1089395864 11:118136065-118136087 GTTGGAGGGTGCAGCCTCTCAGG + Exonic
1090105938 11:123853777-123853799 TTTGCAGGGTGCAGCCCCTGTGG - Intergenic
1090981203 11:131724202-131724224 GGTGAGGGGTGCAGGCGCCCTGG - Intronic
1091686840 12:2568371-2568393 GTAAAATGGTGCAGCCACCGTGG + Intronic
1094465365 12:30748304-30748326 GCTGAAGGTTGCAGCGGCTGTGG - Intronic
1095838784 12:46669382-46669404 TTTGCAGGGTGCAGCCCCAGTGG + Intergenic
1096552214 12:52380553-52380575 GTTGGAGGCTGCAGTGGCCGAGG - Exonic
1096573813 12:52540359-52540381 GTGGAAAGGTGCAGCCGCAGGGG + Intergenic
1096752816 12:53773123-53773145 GTAAAATGGTGCAGCCACCGTGG + Intergenic
1097813581 12:64046111-64046133 ATTGAAGGGTGCAGAGGCAGAGG + Intronic
1102228009 12:111242786-111242808 GTTGATGGATGCAGCTGCCCCGG - Intronic
1102787734 12:115618057-115618079 GTAAAAAGGTGCAGCCGCTGAGG + Intergenic
1111457994 13:88508649-88508671 ATTGCAGGGTGCAGCCCCCATGG + Intergenic
1113760563 13:112843379-112843401 GGAGAAGGGTGCAGACACCGTGG - Intronic
1114591373 14:23867899-23867921 GTAAAATGGTGCAGCCACCGTGG - Intergenic
1114957822 14:27845713-27845735 GTTGATGGGACCAGCCGCCGCGG - Intergenic
1116067607 14:40003970-40003992 GTTGGAGTGTGCAGCAGCTGAGG + Intergenic
1118761703 14:68884237-68884259 GTTGAAGGGTGCAGCCCGCTTGG + Exonic
1120072918 14:80123470-80123492 TTTGCAGGGTGCAGCCCCCATGG - Intergenic
1125672365 15:41483308-41483330 GTTGAAGGGTGCAGCACCCAAGG + Exonic
1127677296 15:61253421-61253443 GTAGAATGGTGCAGCTGCTGTGG - Intergenic
1129857083 15:78832083-78832105 TTGGAAGAGTGCAGCCGCTGGGG - Intronic
1132701040 16:1222237-1222259 GCTGAAGGATGCTGCCCCCGGGG + Exonic
1137499348 16:48998370-48998392 GTTGAAGGGTGTTGCCACCATGG + Intergenic
1138363420 16:56451910-56451932 GTGAAAGGGAGCAGCAGCCGAGG - Intronic
1141125706 16:81399321-81399343 GTTAAATGGTGCAGCTGCCGTGG - Intergenic
1142212911 16:88816828-88816850 GCTGAAGTCTGCAGCTGCCGAGG + Intronic
1142240293 16:88941675-88941697 GTTGAGGGGTGCGGGCGCCGTGG + Intronic
1142563596 17:825613-825635 TGTGAAGGGGGCAGCCGCCACGG + Intronic
1145387272 17:22424053-22424075 GTAAAATGGTGCAGCCGCTGTGG + Intergenic
1145908405 17:28528774-28528796 CTGGAAGGGTGCAGGGGCCGAGG + Intronic
1148316813 17:46708277-46708299 GTAAAATGGTGCAGCCACCGTGG - Intronic
1149994891 17:61401153-61401175 GTCGAAGGGTGGAGGGGCCGGGG - Intronic
1151619169 17:75234788-75234810 GGTGAAGGTTGCAGCAGCAGTGG + Exonic
1153800607 18:8665071-8665093 ATTGAAGGGTGCAGCCACTTTGG + Intergenic
1157610627 18:48952691-48952713 GCTGAGGGGAACAGCCGCCGAGG + Intergenic
1157618171 18:49000028-49000050 GTAAAATGGTGCAGCCGCTGTGG - Intergenic
1158744182 18:60178637-60178659 GTTGAAAGGTGAAGCCGGCTGGG - Intergenic
1161021966 19:2015000-2015022 ATGGAAGGGTGCAGGCCCCGGGG + Intronic
1161569096 19:5020467-5020489 GTTGAAGGGTGCAGCCGCCGTGG - Intronic
1161643186 19:5436710-5436732 GTTGCAGGGTCCAGCCCCGGAGG - Intergenic
1167360113 19:49025617-49025639 GGTGGAGGGGGCTGCCGCCGGGG - Intronic
1167578413 19:50328702-50328724 GTCGAAGCGTGCCGCCGCCTCGG + Exonic
925999513 2:9319097-9319119 GTTTAAGGGGGCAGCAGACGGGG + Intronic
927530065 2:23788803-23788825 GTTGAAGGGTTCAACCGCATGGG + Intronic
931917616 2:66975327-66975349 ATAAAATGGTGCAGCCGCCGTGG + Intergenic
932069486 2:68604017-68604039 GTAAAATGGTGCAGCCGCTGTGG + Intronic
935220155 2:101005077-101005099 ATTGAAGGGTGCAGCAGGAGAGG + Intronic
938279860 2:130056198-130056220 TTTGCAGGGTGTAGCCCCCGTGG - Intergenic
938330812 2:130446913-130446935 TTTGCAGGGTGTAGCCCCCGTGG - Intergenic
938359133 2:130674590-130674612 TTTGCAGGGTGTAGCCCCCGTGG + Intergenic
938435534 2:131281239-131281261 TTTGCAGGGTGTAGCCCCCGTGG + Intronic
946359874 2:219212869-219212891 ATTGAATGGTGCAGCCTCCATGG - Intronic
946515050 2:220402658-220402680 TTTGCAGGGTGCAGCCCCTGTGG - Intergenic
946771925 2:223097572-223097594 GTCGAAGGGTACAGCCACCCTGG + Intronic
947249880 2:228090139-228090161 TTTGCAGGGTGCAGCCCCCATGG - Intronic
1168868901 20:1112480-1112502 GTAAAATGGTGCAGCCTCCGTGG + Intergenic
1170436238 20:16332404-16332426 GTTGAAAGGTACAGACCCCGAGG - Intronic
1175234093 20:57497048-57497070 GTTAAATGGTGCAGCCACTGGGG - Intronic
1175329187 20:58150987-58151009 GTTCATGCGTTCAGCCGCCGCGG - Exonic
1176189212 20:63799870-63799892 ATGGAACGGTGCAGCCGCTGTGG + Intronic
1178765886 21:35450629-35450651 TTTGGAGGGTGCAGCCCCTGTGG + Intronic
1184597622 22:45523867-45523889 GGAAAAGGGTGCAGCTGCCGTGG - Intronic
953560019 3:43981006-43981028 GTAAAATGGTGCAGCTGCCGTGG - Intergenic
954477262 3:50759295-50759317 GTAAAATGGTGCAGCCGCTGTGG - Intronic
956465886 3:69520470-69520492 GTTGCAGGGTGCAGCCCAAGAGG - Intronic
962457127 3:135574885-135574907 GTTGAAGGGTGAAGACACTGTGG - Intergenic
963577113 3:147075070-147075092 GTTGATGGGTGCAGCCATCAGGG - Intergenic
963996532 3:151716616-151716638 CTTGAAGGGTACAGCCCCTGTGG + Intergenic
966863077 3:184241419-184241441 GGTGGAGGGTGGTGCCGCCGGGG + Intronic
967592977 3:191299832-191299854 TTTGCAGGGTTCAGCCCCCGTGG - Intronic
968747616 4:2368895-2368917 GTTGAATGGTGCAGCCTCTTTGG - Intronic
973367734 4:49221427-49221449 TTTGCAGGGTGTAGCCGCCGTGG - Intergenic
974874845 4:67690853-67690875 GTAGAATGGTGCAGCTGCCATGG + Intronic
975521983 4:75311211-75311233 TTTGCAGGGTGCAGCCCCTGTGG - Intergenic
978138912 4:105295726-105295748 GTTAAATGGTGCAGCCACTGTGG + Intergenic
978983731 4:114983320-114983342 TTTGAAGGGTACAGCCCCCATGG - Intronic
985992941 5:3578276-3578298 TATGAAGGGTGCAGGGGCCGAGG - Intergenic
987845448 5:23277441-23277463 TTTGCAGGGTGCAGCCTCCAAGG - Intergenic
990937039 5:61162378-61162400 GTTGGTGGCTGCAGCTGCCGTGG - Exonic
1003521609 6:6863072-6863094 GTTGCAAGTTGCAGCCCCCGTGG + Intergenic
1003694390 6:8388843-8388865 GTCGAAGAGTGCAGCTGCAGCGG - Intergenic
1006363960 6:33603896-33603918 TTTGGAGGGTGCAGCCCCTGTGG + Intergenic
1007754617 6:44090893-44090915 GTAAAAGGGTACAGCTGCCGTGG + Intergenic
1011627203 6:89292291-89292313 GTAAAATGGTGCAGCCGCTGTGG + Intronic
1017129014 6:151092109-151092131 GTTGAAGGGGGCAGCAGGTGTGG - Intronic
1018823824 6:167394465-167394487 GAGGAAGGGAGCAGCAGCCGAGG + Intergenic
1020537230 7:9415439-9415461 GTTGAAGGGTGAAGCTGGAGAGG - Intergenic
1027502178 7:78966757-78966779 GTTTAATGGTGCAGCCCCTGTGG - Intronic
1029741784 7:102495231-102495253 GTTGCGGGGTGCAGCGGCAGCGG - Intronic
1029759775 7:102594400-102594422 GTTGCGGGGTGCAGCGGCAGCGG - Intronic
1029777137 7:102690310-102690332 GTTGCGGGGTGCAGCGGCAGCGG - Intergenic
1031039235 7:116821580-116821602 GTTGATGGGTGCAGCAACCATGG - Intronic
1035515578 8:229628-229650 CTTGCAGGGTGCAGGCGCGGAGG + Intergenic
1035673995 8:1442201-1442223 GCTGATGGGTTCAGCCACCGGGG + Intergenic
1040952933 8:52954150-52954172 GTTGATGGGACCAGGCGCCGTGG - Intergenic
1041307585 8:56478533-56478555 GTAGAATGGTGCAGCTGCTGTGG + Intergenic
1041510387 8:58649073-58649095 TTTGAAGGGTGCAGCCCACTTGG - Intronic
1042549711 8:69983588-69983610 GTTGAAGAGTCCAGACGCAGTGG + Intergenic
1044146386 8:88719907-88719929 GTTAAATGGTGCAGCCACTGTGG + Intergenic
1048516212 8:135113934-135113956 TTTGCAGGGTGCAGCCTCCCTGG - Intergenic
1049392386 8:142378904-142378926 GTTGAAGGGTGCGCCACCCGGGG - Intronic
1050455785 9:5832888-5832910 GTGGATGGGTGCAGCGGCGGCGG - Exonic
1053281203 9:36820714-36820736 GTGGGAGGGTGCAGCCCCAGCGG + Intergenic
1055813362 9:80177720-80177742 TTTGCAGGGTGCAGCCCCTGTGG + Intergenic
1057385050 9:94599459-94599481 GTGAAATGGTGCAGCCGCTGTGG - Intergenic
1057548699 9:96036598-96036620 GTAAAATGGTGCAGCCTCCGTGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1060348742 9:122839025-122839047 TTTGCAGGGTGCAGCCCCTGTGG + Intergenic
1062621467 9:137424096-137424118 GTGCCAGGGTGCAGCGGCCGAGG + Intronic
1187325067 X:18278816-18278838 GTTGCAGGCTGCAGCCGTGGAGG - Intronic
1188964777 X:36537454-36537476 TTTGCAGGGTGCAGCCTCCATGG - Intergenic
1189594333 X:42548237-42548259 TTTGCAGGGTGCAGCCTCTGAGG + Intergenic
1192586354 X:72321371-72321393 GTAAAATGGTGCAGCCGCAGTGG - Intergenic
1198248914 X:134860374-134860396 GTTGAAGGGTCCAGGTGCGGTGG - Intergenic
1198683620 X:139205559-139205581 GTGGGAGGTGGCAGCCGCCGCGG - Intronic
1198699626 X:139382784-139382806 TTTGGAGTGTGCAGCCGCAGCGG + Intergenic
1199237800 X:145510723-145510745 TTTGCAGGGTTCAGCCTCCGTGG - Intergenic
1200152515 X:153958204-153958226 GCTGAAGACTGCAGCCGCCCAGG - Exonic