ID: 1161570038

View in Genome Browser
Species Human (GRCh38)
Location 19:5025488-5025510
Sequence CTCTGGCTGTGGGAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 1, 1: 0, 2: 4, 3: 138, 4: 694}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161570038_1161570044 2 Left 1161570038 19:5025488-5025510 CCATCCACTTCCCACAGCCAGAG 0: 1
1: 0
2: 4
3: 138
4: 694
Right 1161570044 19:5025513-5025535 AGCTTTCTAGAAATTTCGGTTGG 0: 1
1: 0
2: 2
3: 8
4: 104
1161570038_1161570043 -2 Left 1161570038 19:5025488-5025510 CCATCCACTTCCCACAGCCAGAG 0: 1
1: 0
2: 4
3: 138
4: 694
Right 1161570043 19:5025509-5025531 AGAGAGCTTTCTAGAAATTTCGG 0: 1
1: 0
2: 2
3: 37
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161570038 Original CRISPR CTCTGGCTGTGGGAAGTGGA TGG (reversed) Intronic
900125300 1:1066518-1066540 CTCGGGCTCTGGGAAGGGGCCGG + Intergenic
900651075 1:3730326-3730348 TCCTGGCTGTGGGAGGTGGAGGG + Intronic
901004376 1:6164800-6164822 CTCTGGTTCTTGGAAGGGGAAGG - Intronic
901209738 1:7518085-7518107 AGCTGGATGTGAGAAGTGGATGG + Intronic
902378057 1:16039525-16039547 CCCTGGCTGTGGGAAGGGCATGG - Intergenic
902383146 1:16062021-16062043 CCCTGGCTGTGGGAAGGGCATGG - Intronic
902810225 1:18883851-18883873 CTCGGTGTGTGGGAGGTGGATGG + Intronic
903171578 1:21557891-21557913 CTCTGGCTTTGGGAGGGGGTTGG - Intronic
903298539 1:22361627-22361649 CTCTACCTGTGAGAACTGGAGGG + Intergenic
903604582 1:24566357-24566379 CTCTTGATGTGGGCAGTGGCCGG + Intronic
903774005 1:25781495-25781517 GGCTGCCTGTGGGAAGAGGAGGG - Intronic
903830380 1:26170804-26170826 CTCTGGGTTTGGGGAGCGGAGGG + Exonic
903878393 1:26491916-26491938 CTCTGACTGTGGTCAGTGGTGGG - Intergenic
904326159 1:29728065-29728087 ATTTGGCTGTGGGTGGTGGAGGG + Intergenic
904433345 1:30479193-30479215 ATTTGGCTGTGGGTGGTGGAGGG - Intergenic
904876156 1:33656082-33656104 TTCTGGCTTAGGGAAGGGGAAGG + Intronic
905174045 1:36125263-36125285 CCGTGGCTGTGGAAAGAGGAGGG - Intergenic
905215003 1:36400765-36400787 ATCTGGCTGTGTGCAGTGGTCGG - Intergenic
905398332 1:37682873-37682895 CTGAGGCTCAGGGAAGTGGATGG - Exonic
905519972 1:38590060-38590082 ATGTGGCTGTGGGAGGTGGGAGG - Intergenic
905533763 1:38702421-38702443 ATTTGGCTGTGGGAAGAGGCTGG - Intergenic
905858502 1:41330662-41330684 CTCTGGCTGAGGGCAGGGCAGGG - Intergenic
906141156 1:43534345-43534367 CTGTGGCTATGGGAAAAGGATGG + Intronic
906582932 1:46951349-46951371 CTCTGGCTGTGTGAAGCACAAGG - Intergenic
907239994 1:53075996-53076018 CTCGGGCTGGGGCAAGGGGAGGG + Intronic
907310662 1:53537184-53537206 CTCTGGCTTGGGGAGGGGGAGGG + Intronic
907358083 1:53892806-53892828 CTCTGGCTGAGGTGAGAGGATGG + Intronic
908474257 1:64472120-64472142 CTCTCCCGGTGGGAGGTGGAAGG - Intronic
908598935 1:65718540-65718562 CTCTGTCTTTGGAAAGGGGAGGG - Intergenic
909128636 1:71707408-71707430 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
909270427 1:73617226-73617248 GTCTGCCTTTGGAAAGTGGAGGG - Intergenic
909271360 1:73627405-73627427 CTCTGCTTGTGAAAAGTGGAAGG + Intergenic
909309537 1:74129316-74129338 CTCTGCTTGTGGGTAGAGGAGGG - Intronic
909316311 1:74223775-74223797 CTCTGCCTATGGAAAGGGGAGGG + Intronic
909420698 1:75461832-75461854 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
910349239 1:86277263-86277285 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
910716338 1:90235696-90235718 CTATGTCTGTGGAAAGTGGAGGG - Intergenic
910894370 1:92052428-92052450 CTTTGGCTTTGGAAAGGGGATGG - Intronic
911373721 1:97024896-97024918 CTCTGCCTTTGGAAAGGGGAAGG + Intergenic
912152812 1:106880488-106880510 CTCTGCCTGTGGAAAGAGGAGGG + Intergenic
912242711 1:107927688-107927710 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
912800273 1:112715545-112715567 CTGTTGCTGTGGGAAGGGGGCGG + Intergenic
912949419 1:114110497-114110519 GTCTGGCTGGGGGAAGCGGATGG + Intronic
913137925 1:115910818-115910840 ATGAGGCTGGGGGAAGTGGATGG - Intergenic
913320305 1:117583246-117583268 CTCTGGCTGTGGGAGCAGCATGG + Intergenic
913712823 1:121503156-121503178 GTATGGCTGTGTGCAGTGGAAGG + Intergenic
914195292 1:145445358-145445380 CTCTGCCTGTGGGTGGGGGATGG - Intergenic
915597921 1:156905903-156905925 CAGTGGCTGAGGGAAGTGGGAGG - Intronic
915912198 1:159922352-159922374 TTCGGGCTGGGGGAAGTGGAGGG - Intronic
917387215 1:174490804-174490826 CTCTGCTTGTGGAAAGAGGAGGG - Intronic
917986566 1:180326254-180326276 CTCTGCCTGTGGAAAAGGGAGGG - Intronic
919373553 1:196763292-196763314 CTCTGACTTTGGAAAGGGGAGGG - Intergenic
919379993 1:196847969-196847991 CTCTGACTTTGGAAAGGGGAGGG - Intronic
919832506 1:201552071-201552093 GGGTGGCTGTGGGAAGTGGATGG + Intergenic
920122382 1:203668481-203668503 CTCTAGGTGGGGGAAGGGGAGGG - Intronic
921163201 1:212487424-212487446 CACTGGCTGTGGGGAAAGGAAGG - Intergenic
921296102 1:213705356-213705378 CTCTGCCTTTGGAAAGGGGATGG - Intergenic
921432068 1:215077356-215077378 CTTTGGATGTGGGGAGTGGGTGG - Intronic
922377199 1:224980390-224980412 CTCTGCCTGTGGAGAGAGGAAGG + Intronic
922388493 1:225113715-225113737 CTCTGCCTGTGGAAAGGGAAGGG - Intronic
924058191 1:240144108-240144130 CTGCTGCTGTGGGATGTGGATGG - Intronic
924127323 1:240868527-240868549 CTCCGTCTGTGGGAAGTGAGGGG - Intronic
924642393 1:245846640-245846662 CTCTGGCTGTGAGGATTAGAAGG + Intronic
924833816 1:247628315-247628337 CTCTGCCTGTGGAAAATGGGGGG - Intergenic
1063048925 10:2424249-2424271 TTCTGGCTGTGGGCGGTGGGTGG + Intergenic
1063377761 10:5564194-5564216 CTCTGGCCGTGGGCAGTGGTGGG - Intergenic
1063843223 10:10094948-10094970 TGCTGGCTCTGGGAAGGGGAAGG + Intergenic
1065161309 10:22925660-22925682 CTTGGGCTATGGGAATTGGAAGG + Intergenic
1065431396 10:25660998-25661020 CTCTGTCTGGGGAAAGGGGAGGG - Intergenic
1066408405 10:35142405-35142427 ATTTGGTTGTGGGAAGTTGATGG + Intronic
1066504398 10:36026377-36026399 CATTAGCTGTGGGAAGAGGAGGG - Intergenic
1066708291 10:38204256-38204278 CTCTGCCTGGGGAAAGGGGAGGG + Intergenic
1066981218 10:42418326-42418348 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1067558214 10:47286896-47286918 CTGTGGCTGGGGGAAGTGTTAGG + Intergenic
1067715937 10:48691217-48691239 GGCTGGATGTGGGAAGTGGCAGG + Intronic
1068411325 10:56659951-56659973 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1068901665 10:62276667-62276689 CTCTGCCAATGGCAAGTGGAAGG - Intergenic
1069343550 10:67440248-67440270 CTCCGCCTGTGGAAAGTGGAGGG + Intronic
1069550521 10:69360721-69360743 CTCTGGGTGCGGGGAGTGGTGGG + Intronic
1069554589 10:69389463-69389485 CTCTGGCGGGGGGAGGTGGGGGG + Intronic
1069832610 10:71290414-71290436 CTCTGAGGGTGGGAAGTGGAGGG - Intronic
1070253449 10:74793678-74793700 CTCTGGCTGTTGGGAGTGAGTGG - Intergenic
1070791301 10:79191074-79191096 CTATGGGTGTGGGAGGTGGAGGG + Intronic
1070953849 10:80452057-80452079 TTCTGGCTGGGGTAAGTGGGTGG - Intergenic
1070987405 10:80700671-80700693 CTCTCTCTCTGGGAAGGGGATGG - Intergenic
1071912105 10:90247865-90247887 CCCTGGCTGGGTGGAGTGGATGG + Intergenic
1072052010 10:91714298-91714320 CTGTGCCTGGGGGAAGTGGGAGG + Intergenic
1072083660 10:92057358-92057380 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
1073026291 10:100489448-100489470 CTCTGGTTTTGGGGAGTGGCAGG + Intronic
1073267088 10:102234334-102234356 CTCTGCCTGTGGAAAGAGCAGGG - Intronic
1074120067 10:110487529-110487551 CTCTGGCAGAGGGAGGGGGAAGG - Intergenic
1074962801 10:118463373-118463395 CTCTGGACGTGGGAAGTTCAAGG - Intergenic
1075514766 10:123100151-123100173 CTCTGGCTGTGGGAAGAGAAGGG - Intergenic
1075997787 10:126892566-126892588 CCCTGGCTGTGGGATTTGTAAGG - Intergenic
1076323767 10:129604611-129604633 CTCTTGGTGTGGGTAGTGAAAGG + Intronic
1076602055 10:131663629-131663651 CTCTGGAAGTGGGAAGGGGTAGG - Intergenic
1076676798 10:132151340-132151362 CACTGGATGGAGGAAGTGGAAGG - Intronic
1076755674 10:132570381-132570403 CTCTGGCCCTGGGAAGCGGGAGG + Intronic
1076990692 11:271965-271987 CCAGGGCTGTGGGAAGGGGATGG - Intergenic
1077410843 11:2403248-2403270 CTCCAGCTGTGGGGAGGGGAGGG + Exonic
1077726010 11:4675702-4675724 ACCTGGTTGTGGGGAGTGGAGGG - Intergenic
1077902136 11:6498062-6498084 CTCAGGCTCTGGGCAGGGGATGG - Exonic
1078017448 11:7627107-7627129 CTTAGACTGTGGGAAGAGGAGGG - Intronic
1078095893 11:8297021-8297043 CTCCTGCTGTGGGAAGCAGAGGG - Intergenic
1078250252 11:9610921-9610943 CTCTAGCTTTGAGAAGAGGATGG + Intergenic
1078614312 11:12850857-12850879 CTGTGGCTTGGGGAAGTGGCAGG + Intronic
1079037986 11:17037196-17037218 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1079187111 11:18247683-18247705 CTCAGGATGTGTTAAGTGGATGG - Intronic
1079189692 11:18267194-18267216 CTCAGGATGTGTTAAGTGGATGG + Intronic
1079517022 11:21281314-21281336 CTCTGCCTGTGGAAACGGGAGGG + Intronic
1079571923 11:21953432-21953454 CTCTGCCTTTGGAAAGGGGAAGG + Intergenic
1080382763 11:31791030-31791052 TTCTAGCTGTGGCCAGTGGAAGG - Intronic
1081779295 11:45698984-45699006 GGCAAGCTGTGGGAAGTGGAGGG - Intergenic
1081794550 11:45810622-45810644 CTCTGGCTGTGCTTATTGGAGGG + Intronic
1081890480 11:46537653-46537675 TTTTGCCTGTGGGCAGTGGAGGG - Intronic
1083267812 11:61555094-61555116 CTGTGGCTGTGGGCACTGGGTGG - Intronic
1083428954 11:62603849-62603871 CTCTGGGGATGGGAAATGGATGG - Intronic
1085037068 11:73307238-73307260 GTTTGGCAGTGGGAAGTCGAGGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085219154 11:74859009-74859031 CTCAGGGTGGGGAAAGTGGAAGG - Intronic
1085223516 11:74896430-74896452 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1085753524 11:79184665-79184687 CTCTGTCTCTGGGAATTTGACGG - Intronic
1085845155 11:80056603-80056625 ATGTGCTTGTGGGAAGTGGATGG - Intergenic
1086007057 11:82049123-82049145 CTCTGCCTTTGGAAAGAGGAAGG + Intergenic
1086033147 11:82384243-82384265 CTCTGCCTGTGGAAAGAAGAAGG + Intergenic
1086106974 11:83157219-83157241 CTGTGGCGGCTGGAAGTGGACGG + Exonic
1086468132 11:87076269-87076291 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1086838854 11:91659708-91659730 CCCTAGCTATGGGTAGTGGAGGG + Intergenic
1087178583 11:95119902-95119924 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
1087313323 11:96576881-96576903 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1087492317 11:98844527-98844549 CTCTGCCTGTGGAAAGGTGAGGG - Intergenic
1087877000 11:103370225-103370247 CTCTGCCTTTGGAAAGGGGAAGG + Intronic
1088009873 11:104986728-104986750 CTCTGCCTGTGGGAAGGGAAGGG + Intergenic
1088154789 11:106790227-106790249 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1089537161 11:119168147-119168169 CCCTGGCTGTGGGTGGTGGGTGG + Intronic
1089628827 11:119770696-119770718 CACTGGCTGGGAGAAGTGGAAGG + Intergenic
1089762149 11:120735768-120735790 CTCTGCCTGTGGAAAGGAGAGGG - Intronic
1089778918 11:120859507-120859529 CTCTGTGTGTGGGGAGAGGATGG + Intronic
1089946581 11:122480078-122480100 CTCTGCCTATGGAAAGGGGAGGG + Intergenic
1090035504 11:123246275-123246297 CTCTGGCTTTGGGAGTGGGATGG + Intergenic
1090885288 11:130870653-130870675 CCCTGTCTCTGGGATGTGGAAGG + Intergenic
1090987630 11:131785209-131785231 ATCTGGGTGTGGGCAGTGGCAGG + Intronic
1091223177 11:133942866-133942888 CCCTGCCTGTGGGAGGTGGCTGG - Intronic
1091265414 11:134267155-134267177 CGCTGGATGTGGAAGGTGGAAGG + Intergenic
1091281381 11:134383625-134383647 CTCCGGCTGCGGGGAGTGGAGGG - Intronic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091309660 11:134563330-134563352 CTCTGGGTGGGGGCAGTGGGAGG + Intergenic
1091697980 12:2640814-2640836 CTCTGGCTCTGGGTCCTGGAAGG + Intronic
1091711730 12:2745823-2745845 CAGTGGCTGTGGGAAGGGAAGGG - Intergenic
1091724242 12:2834577-2834599 CTCAGGATCTGGGAAGTGGAAGG + Intronic
1091763539 12:3103650-3103672 CTGTGACTTTGGGAAGTGGCTGG + Intronic
1091863165 12:3805300-3805322 ATCTGGCTGAGAGAAGTGGTTGG - Intronic
1093025267 12:14239994-14240016 CTGTGGCTGTGGGAAGAGAATGG + Intergenic
1093903247 12:24660839-24660861 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
1093991169 12:25591415-25591437 CTCTGCCTTTGGAAAGGGGATGG + Intronic
1094380703 12:29840366-29840388 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1094489971 12:30953912-30953934 CTCTGGCTCTGGGAAGGACAAGG + Intronic
1095286263 12:40414516-40414538 CTCTGGATGTGGGATTTGGTTGG + Intronic
1095721380 12:45405045-45405067 TTCTGGGTGGGGGAAGAGGAAGG - Intronic
1095769552 12:45937881-45937903 TCCTGGCTGTGGGTAGAGGAAGG - Intronic
1096252122 12:50040149-50040171 CTCTGGCGGTGGGTAGGGGCGGG - Intergenic
1096591039 12:52659415-52659437 CTCAGGCAGTGGGCAGTGAAGGG + Intergenic
1096670749 12:53196980-53197002 CACTGGCTCAGGGAAGTGGCAGG + Intronic
1097094012 12:56531034-56531056 CTCTGGGGCTGGGAAATGGAGGG - Intronic
1097195392 12:57240041-57240063 CTGCGGCTGTGGGACGTGGAGGG + Intronic
1097769983 12:63572331-63572353 CTCTGCCTGGGGAAAGGGGAAGG + Intronic
1097916061 12:65021562-65021584 CGCTGGCAGTGGGAGGAGGAGGG - Intergenic
1098142863 12:67468961-67468983 CTCTGCCTGTGGAAAGGGAAGGG - Intergenic
1098207858 12:68132334-68132356 CTCTGGCTTTAGAAAGAGGAGGG - Intergenic
1098444288 12:70550437-70550459 CTCTTGCTCTGGTAAGTGAATGG + Intronic
1099246218 12:80196531-80196553 CCCTAGGTGTGGGAAGTGGAGGG + Intergenic
1099495371 12:83339935-83339957 CTCTGCCTTTGGTAAGTGGAGGG + Intergenic
1099610040 12:84856999-84857021 CTCTGACTGAGGAAAGAGGAGGG - Intergenic
1099826055 12:87779500-87779522 TTCTGCCTATAGGAAGTGGAGGG - Intergenic
1100875767 12:98959891-98959913 CTCTGTTTGTGGAAAGGGGAGGG + Intronic
1101226727 12:102694795-102694817 CTCTGCCTTTGGAAAGTGTAGGG + Intergenic
1101251919 12:102945534-102945556 CTCTGTTTGTGGAAAGGGGAGGG - Intronic
1101824343 12:108209067-108209089 CTCTGGCTCTGGGAGTAGGAAGG - Intronic
1104390593 12:128388083-128388105 CTCGGGCTCTTGGAAGTGGAGGG - Intronic
1104708998 12:130971947-130971969 TTCTGGCTCTGGGATGTTGACGG + Intronic
1105243905 13:18630841-18630863 CTCCGGGTGTGGGAATTTGAAGG + Intergenic
1105706686 13:22971644-22971666 CTGTGGCTGTGGGCGGTGTAGGG + Intergenic
1107524151 13:41213774-41213796 CTCTGCTTGTGGAAAGGGGAGGG - Intergenic
1108269708 13:48747827-48747849 CACTTGCTATGGAAAGTGGAAGG - Intergenic
1108580917 13:51827560-51827582 CTCTGACAGTGGGAACTGGGGGG - Intergenic
1109100654 13:58180603-58180625 CTCTGCTTGTGGGAAGGGGAGGG - Intergenic
1109336635 13:61003221-61003243 CTCTGCCTGTGAAAAGGGGAGGG - Intergenic
1110108779 13:71716086-71716108 CTCTGGTTTTGGGGATTGGATGG - Intronic
1110501359 13:76231750-76231772 CTCTGCCTTTGGAAAGAGGAGGG + Intergenic
1110889472 13:80680247-80680269 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1111542769 13:89689873-89689895 CTCTGCCTGTGGAATGGGGAGGG + Intergenic
1113037112 13:106062373-106062395 GTCTGCCTCTGGGAAGTGGCCGG - Intergenic
1113782188 13:112983043-112983065 CTTTGGGTGTGGAAAGTGGTGGG + Intronic
1114269794 14:21093608-21093630 CTTTGGTTCTGGGAAGTGCAGGG + Exonic
1114506330 14:23217269-23217291 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1114537540 14:23432501-23432523 CTCTGTCTGTGGGGAGAGGGTGG + Exonic
1114809760 14:25884023-25884045 TTCTGGCTTTGGTAACTGGATGG + Intergenic
1114814241 14:25937747-25937769 TAGTGGGTGTGGGAAGTGGAAGG + Intergenic
1115133965 14:30086738-30086760 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1115821052 14:37212485-37212507 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
1116021582 14:39468618-39468640 CTCTGCCTGTGGAAAGTGGAGGG - Intergenic
1116434107 14:44877495-44877517 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1116481131 14:45392406-45392428 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1116497742 14:45582977-45582999 CTCTGCCTGAGGAAAGTGGAGGG - Intergenic
1116889190 14:50250399-50250421 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1117132017 14:52695875-52695897 CTCTCGCTCTGGGAACTGGAAGG - Intronic
1117225591 14:53655057-53655079 CTTGGGCAGTTGGAAGTGGAAGG + Intergenic
1117302286 14:54441400-54441422 CTGTGGCCGGGGGAAGTGAATGG - Exonic
1117359519 14:54959387-54959409 CCCTGGCGGGGGGAAGAGGAGGG + Intronic
1117384202 14:55194772-55194794 CTCTGCCTGTGGAAAGGGAAGGG - Intergenic
1117726459 14:58679571-58679593 CTCTTGCTAAAGGAAGTGGAAGG - Intergenic
1118501418 14:66365922-66365944 CTCAGGCTGGGGGAAATCGAAGG - Intergenic
1118543602 14:66858913-66858935 CTCTGCCTGTGGAAAATAGAGGG + Intronic
1118956710 14:70489307-70489329 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1119585522 14:75831497-75831519 CGGTGGCTGTGGGCAGTAGAGGG - Intronic
1119929870 14:78535155-78535177 CTCTACCTGAGGGAAATGGAAGG - Intronic
1120279373 14:82419893-82419915 CTCTGCATGGGGGAAGTGGGTGG + Intergenic
1120543203 14:85777284-85777306 CTCTGTCTGAGGGAAGTAGAGGG - Intergenic
1121312145 14:92940992-92941014 CTCTGGCTGTGGGGAGGGAGGGG + Exonic
1121545347 14:94759045-94759067 GTCTGGAGGTGGGGAGTGGAGGG - Intergenic
1122446832 14:101775837-101775859 CTCTGGCTGGGGGAAGGAGGTGG - Intronic
1122967900 14:105139787-105139809 GTGTGGCTGTTGGAGGTGGAGGG - Intergenic
1122978335 14:105180148-105180170 CACTGGATGTGGGAAAAGGATGG + Intronic
1123565809 15:21545838-21545860 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1123602071 15:21983125-21983147 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1123948075 15:25248512-25248534 CTCTGTGTGTGGGAGGTGTAGGG + Intergenic
1124820997 15:33045240-33045262 GCCTGGCTGTGGGCAGTGGCTGG + Intronic
1124999217 15:34754108-34754130 CTCTGACTCTGGAGAGTGGAGGG + Intronic
1125044437 15:35230256-35230278 CTCTGCCTTTGGAAAGGGGAAGG - Intronic
1125584379 15:40809883-40809905 CCCTGGCTCTGGGAAGTGCTGGG - Exonic
1125759081 15:42084925-42084947 CTGTGGCTGTGGGTCTTGGAGGG - Intronic
1126440603 15:48683902-48683924 CTCTGCCTGGGGAAAGTGGAGGG + Intergenic
1126517568 15:49553632-49553654 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
1126534203 15:49742664-49742686 CTCTGCGTGTGGAAAGGGGAGGG + Intergenic
1127132666 15:55883292-55883314 CTCTGCCTGTGGAAAGAGAAGGG + Intronic
1127216132 15:56824645-56824667 CTCTGGCTGTGAGCAGAGCATGG + Intronic
1127705746 15:61545722-61545744 CTCAGGCTGTTAGAGGTGGAAGG - Intergenic
1127862627 15:63007032-63007054 CACTGGCTCTTGGAAGTTGATGG - Intergenic
1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG + Intronic
1128758075 15:70196553-70196575 CTCGGGCAGTGGGCAGAGGAGGG + Intergenic
1129209666 15:74060356-74060378 CTCTGCCTGTGGAAAGGGAAAGG + Intergenic
1129659447 15:77544813-77544835 TTCTGGCTGGGGGAGGTGGGAGG - Intergenic
1130114486 15:80994809-80994831 CTCTGGCAGGGCGAGGTGGATGG - Intergenic
1130183319 15:81652601-81652623 ATCTGACTGTGGGCAGTGGCCGG + Intergenic
1130441098 15:83955253-83955275 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1130511854 15:84595884-84595906 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
1130867894 15:87947887-87947909 CTCTGGGTGTTTGAAGTGGCAGG + Intronic
1130975839 15:88773481-88773503 CACTGGCTGTGGGATGGGAAAGG + Intergenic
1131651932 15:94409733-94409755 CACTGCTTGTGGGAAGGGGATGG - Intronic
1202974178 15_KI270727v1_random:272931-272953 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1133001941 16:2856239-2856261 CACAGGCTGGGGGAACTGGAGGG + Exonic
1133871308 16:9689078-9689100 CTGTGGCTGAGGGAAGAGAATGG - Intergenic
1134021352 16:10923563-10923585 CTGAGGCTGTGGGATGTGGATGG - Intronic
1134084765 16:11348810-11348832 CTCTGTCTGTGTGCAGTGGCAGG + Intronic
1134522186 16:14923890-14923912 CCATGGCTGTGGTGAGTGGAGGG + Intronic
1134709856 16:16322541-16322563 CCATGGCTGTGGTGAGTGGAGGG + Intergenic
1134949747 16:18346104-18346126 CCATGGCTGTGGTGAGTGGAGGG - Intergenic
1135381261 16:21997941-21997963 CTCTGGCTGTGGGGAGCTGGAGG + Intronic
1137546456 16:49407934-49407956 CTCTGCCTCTGGGAGGTGGAAGG - Intergenic
1137588770 16:49680706-49680728 GCCTGGCTGTGTGAAGTGGCCGG + Intronic
1137722059 16:50633273-50633295 CTTTCGGTGTGGGATGTGGATGG - Exonic
1137895385 16:52206195-52206217 CTCTGGCTGGGTCAAGTTGAGGG - Intergenic
1138363300 16:56451363-56451385 CTCTGGCGGCAGGAAGTAGAGGG + Exonic
1138537364 16:57667148-57667170 CTCTGGGTCTGGGAAGGGGTAGG - Intergenic
1139407702 16:66732161-66732183 ATCTGCCTGAGGGAAGTGGGTGG - Intronic
1139514048 16:67443034-67443056 GTGGGGCTGTGGGAAGTGGTAGG - Intronic
1141187218 16:81796493-81796515 CCCGGGCTGTGGGCAGTGGTGGG + Intronic
1141369004 16:83470163-83470185 TTCTGGAGGTGGGAAGTAGAGGG - Intronic
1141625354 16:85258628-85258650 CTCCGCCTGTGGGAGGAGGAGGG + Intergenic
1141701662 16:85645161-85645183 CTCAGGGTGTGGGCAGTGGTTGG + Intronic
1142032889 16:87847207-87847229 CTGTGGCTCTGGGGTGTGGAGGG - Intronic
1142799685 17:2337460-2337482 CTCCGGCTGTGGGAAGGGGCCGG + Exonic
1142890592 17:2940261-2940283 CTCTGGGTGGGGGATGTGGAGGG + Intronic
1142989160 17:3717900-3717922 CCCTGGGTTTGGGAAGTGAAAGG + Intronic
1143321759 17:6072889-6072911 GTGTGGATGTGAGAAGTGGATGG + Intronic
1143447060 17:7015765-7015787 TTCTGACAGTGCGAAGTGGACGG + Exonic
1143521267 17:7445575-7445597 CTCTGGCCGTGGGTGGTGGACGG + Intronic
1143594770 17:7907584-7907606 CTGTGGCTGTGGGAGGGGGTAGG - Exonic
1144729510 17:17518434-17518456 CTCTGGCTGTGGAGTGTGAATGG - Intronic
1145823830 17:27861570-27861592 TTCTGGCTCTGGGAAGCAGAAGG - Intronic
1145898414 17:28474167-28474189 GGCTGGCTGTGGGGAGGGGACGG + Intronic
1145954066 17:28842578-28842600 CTCTGACTGTGGGAGACGGAAGG - Intronic
1146005881 17:29160395-29160417 TTCTGCCTGGGGGAAGTGGGGGG - Intronic
1146160828 17:30558783-30558805 CTCTGGCTGTTGCAGGTGGTGGG + Exonic
1146414027 17:32615190-32615212 CACTGGCTTTGGGAAGTAGGTGG + Intronic
1146586968 17:34090861-34090883 TTCTGCCTGTGGGATTTGGAAGG + Intronic
1146749971 17:35369369-35369391 CTCTGCCTGTGGAAAAAGGAGGG + Intronic
1146888032 17:36485505-36485527 CCCTGGCTGTGTGACCTGGAGGG - Intergenic
1146961779 17:36986507-36986529 TTCTGGCTGTGGGGAGTGAAGGG - Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147863991 17:43541129-43541151 TCCTGGCTCTGGGAAGAGGATGG - Intronic
1147987697 17:44315805-44315827 CTCTGGCTGTTGGAAGTCACTGG - Intronic
1148074936 17:44930042-44930064 CCCTGACTGAGGGCAGTGGAGGG - Intronic
1148198043 17:45728857-45728879 CTCTGGTTGTTGGAGATGGAGGG + Intergenic
1148270703 17:46259893-46259915 CTCTGGCTGTGGGGACCGCAAGG + Intergenic
1148508969 17:48152542-48152564 TACTGGCGGTGGGAAATGGAGGG + Intronic
1148697047 17:49567016-49567038 CTCTGGCTGTGGGATAAGGAGGG + Intergenic
1149239837 17:54635966-54635988 CTCTGCCTGTGGAAAGAGGTAGG + Intergenic
1150135981 17:62695356-62695378 CTCTCACTGTGGGCAGTGGCAGG - Intergenic
1150236712 17:63599157-63599179 CTAGGGCTGTGGGAATTGGGGGG + Intergenic
1150580471 17:66469171-66469193 CTCTGGCTGGGGGTAGAGGAGGG - Intronic
1151354174 17:73548726-73548748 CACTGTCTGGGGGAAGTAGAGGG + Intronic
1152008638 17:77697382-77697404 CTCAGGCTCTGGGAAGCGGTAGG - Intergenic
1152095424 17:78269258-78269280 TTCTGGCTGTGGGAACAGGTTGG - Intergenic
1152211677 17:79005685-79005707 CTCTGGGTGTGGGAAGGGAAAGG - Intronic
1152349382 17:79775870-79775892 CTGTGGGTGATGGAAGTGGATGG - Intergenic
1152642078 17:81453554-81453576 GTGTGGCTGTGGGCAGTGGAGGG + Intronic
1152797593 17:82315760-82315782 GTGTGGCCGTGGGAAGGGGAGGG - Intronic
1153074717 18:1148929-1148951 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1153184636 18:2472735-2472757 TTTTGGCTGTGAAAAGTGGAAGG + Intergenic
1153389146 18:4534626-4534648 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1153425791 18:4961464-4961486 CTCTGCCTTTGGCAAGGGGAGGG + Intergenic
1153714986 18:7838903-7838925 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
1154063272 18:11083469-11083491 CTGTGGCTTGGGGAAATGGAGGG + Intronic
1154136811 18:11786903-11786925 GTCTGGCCCTGGGAGGTGGAGGG + Intronic
1154445037 18:14429052-14429074 CTCTGGGTGTGGGAATTTGAAGG - Intergenic
1155081487 18:22414646-22414668 CTCTTGCTGTGGCAAGGGGAAGG - Exonic
1155282194 18:24251017-24251039 CTGTGCCTGTGGAAAGGGGAGGG + Intronic
1155767445 18:29653068-29653090 CTCTGCCTGTGAAAAGGGGAAGG + Intergenic
1156094307 18:33510665-33510687 CTCTGACTGTGGAAAGGGAAAGG + Intergenic
1156155904 18:34301365-34301387 CTCTGACTGTGAAAAGGGGAGGG + Intergenic
1156541317 18:37913738-37913760 CTGTGGCTGAAGGAGGTGGATGG - Intergenic
1156641362 18:39104167-39104189 CTGAGGCTGTTGAAAGTGGAGGG + Intergenic
1156912325 18:42425743-42425765 CTCTGACTGTGGAAAGAGGAGGG - Intergenic
1158402080 18:57130180-57130202 CTCAGGCTTTGGAATGTGGAAGG + Intergenic
1158481217 18:57823644-57823666 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1158948952 18:62474449-62474471 ATCTGCCTGTGGAAAGGGGAGGG - Intergenic
1159080685 18:63731842-63731864 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1159751741 18:72311211-72311233 CTCTGGGTGACGGAGGTGGAAGG + Intergenic
1160012176 18:75114449-75114471 CTCTGGCTGTGGGGAGAGTGAGG - Intergenic
1160844408 19:1160100-1160122 CTCTGGCTGTGGGTGCTGGTGGG + Intronic
1161089741 19:2353852-2353874 CTCTGGCTGAGGGCAGGGCAGGG - Exonic
1161265342 19:3361085-3361107 CGAAGGCTGGGGGAAGTGGAGGG - Intronic
1161570038 19:5025488-5025510 CTCTGGCTGTGGGAAGTGGATGG - Intronic
1162692965 19:12449198-12449220 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1162910739 19:13846843-13846865 CTCCGGATGTGGGGAGTGGCTGG - Intergenic
1163175486 19:15561701-15561723 CTCTGACTGTGGGCAGTGCTGGG - Intergenic
1163451016 19:17377455-17377477 CTCTGGCTGTGAGAAGGCGGGGG + Intergenic
1163725541 19:18921350-18921372 CTCTGGCTGGGGCAACTGGCTGG + Intronic
1164398450 19:27886557-27886579 GACAGGCTGGGGGAAGTGGAAGG + Intergenic
1165354154 19:35293544-35293566 CTCTGTCCGTGGGAAGAGGGCGG + Intronic
1165645474 19:37431940-37431962 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1165722912 19:38092518-38092540 TGCTGGGGGTGGGAAGTGGACGG - Intronic
1165843316 19:38802399-38802421 CACAGGCTGTGGGAAGAGAACGG + Exonic
1165861993 19:38914168-38914190 CTCTGGCTGTGTGGCGAGGATGG + Intergenic
1166284299 19:41814302-41814324 CTCTGTGGGTGGGAAGTGGTGGG - Intergenic
1166737904 19:45097052-45097074 ATGGGGCTGTGGGAGGTGGAGGG + Intronic
1167088022 19:47324004-47324026 GTCTGGCTGTGGCAAGGGGGTGG - Intergenic
1167288063 19:48610001-48610023 CTGTTGGTGTGGGGAGTGGAGGG + Intronic
1167582131 19:50351379-50351401 CTCTGCCTGTGGCAAAGGGAGGG - Intronic
1167688912 19:50973387-50973409 GTTAGGCTGTGGGGAGTGGAGGG + Intergenic
1167791790 19:51688019-51688041 CTGAGGCTGTGTGGAGTGGAGGG - Intergenic
1168615383 19:57833280-57833302 CTCTGCCTGTGGAAAGGGGATGG - Intronic
1168621401 19:57882167-57882189 CTCTGCCTGTGGAAAGGGGATGG + Intronic
925249612 2:2421420-2421442 CTCTGCCTTTGGAAAGCGGAGGG - Intergenic
925260022 2:2520870-2520892 CCCTGGCTGTGGGGATTGAAAGG - Intergenic
925388945 2:3482657-3482679 CCCTGGCTGTGGAGAGTGGGTGG + Intronic
925947005 2:8874624-8874646 CTCTGGGTCTGGGCAGGGGAAGG - Intronic
927570209 2:24152927-24152949 CTCTGCCTGTGTAAAGGGGAGGG - Intronic
927859918 2:26554220-26554242 CTCTGGGTTAGGGAAGTTGATGG + Intronic
928293601 2:30061540-30061562 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
928458936 2:31451256-31451278 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
928626986 2:33149831-33149853 CTATGGCTGTTGGAAAAGGAGGG + Intronic
929281677 2:40087160-40087182 CTCTGCTTGTGGAAAGGGGAAGG - Intergenic
929300970 2:40303370-40303392 CACTGGCTGGGGAAAGTGGAAGG + Intronic
929388598 2:41442095-41442117 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
929524970 2:42693474-42693496 CTCTGCCTGTGGAAAGGGGAAGG - Intronic
929926501 2:46216805-46216827 CTCTGGCTTTGGAAAGGGGAGGG - Intergenic
930111715 2:47684590-47684612 CAGGGGCTGTGGGAAATGGAGGG - Intergenic
930288794 2:49467709-49467731 TTCTGGCTGTGGAAAGGGGAGGG - Intergenic
930439619 2:51390166-51390188 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
930475511 2:51876210-51876232 CTCTGCCTATGGAAAGGGGAAGG + Intergenic
930727459 2:54695640-54695662 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
930752909 2:54949446-54949468 CTGTGGCTGAGGGGAGTTGAGGG + Intronic
930944829 2:57061297-57061319 CTGTGCCTGTGGAAAGGGGAGGG - Intergenic
932003671 2:67907026-67907048 CCCTGGGTGGGGGGAGTGGAGGG + Intergenic
932814912 2:74853816-74853838 GGCTGGGTGTGGAAAGTGGATGG + Intronic
932822834 2:74915950-74915972 ATGTGGCTGTGGGCAGTGGCTGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934553369 2:95275382-95275404 CCCTGGCAGTGGGGAGAGGAGGG + Intronic
934870626 2:97861628-97861650 TTCTGCCTGTGGAAAGGGGAGGG + Intronic
934889957 2:98058747-98058769 CTCTGCCAGTTGGAAGTGGGCGG - Intergenic
935356550 2:102206979-102207001 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
935376236 2:102400379-102400401 CTCTAGTTGTGGTATGTGGAGGG - Intergenic
935580939 2:104755421-104755443 GGCTGGCTGTGGGCAGTGGCAGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935847182 2:107178539-107178561 CTCTGGCTGGGCAAAGTAGATGG - Intergenic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936233447 2:110724367-110724389 CTGTGGCTGTGTGGAGGGGAGGG + Intergenic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937167944 2:119837907-119837929 CCCTGGCTGTGTGCAGTGGCTGG + Intronic
937370726 2:121295595-121295617 CCCTGGCTGTGAGCAGTGGCCGG - Intergenic
937628388 2:124069249-124069271 CTCTGACTGTGGAAGGGGGAAGG + Intronic
937784039 2:125874274-125874296 GTCTGGCTGTGAGGAGTGCAGGG + Intergenic
938122916 2:128646260-128646282 ATCTTGCTCTGGGCAGTGGAGGG - Intergenic
938831275 2:135052413-135052435 TTCGGGCTGCGGGAAGGGGAAGG - Exonic
940411599 2:153370634-153370656 CTTTGGCTTTGGGAAGAGCAGGG - Intergenic
940560396 2:155288065-155288087 CTCTGTCTTTGGAAAGGGGAAGG + Intergenic
941476531 2:165957069-165957091 CTCAGCCTTTGGGCAGTGGATGG + Intergenic
941528197 2:166631999-166632021 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
941672521 2:168310339-168310361 CTCTGCCTGTGGAAAGGGGAAGG - Intergenic
941870363 2:170378234-170378256 CTCTGGCTATGGGGTTTGGAGGG - Intronic
942060633 2:172225632-172225654 GTCTGGTTGTGGGTAGGGGAAGG + Intergenic
942429134 2:175890956-175890978 CTCTGGCTGTCAGAAATTGAGGG + Intergenic
943143534 2:184013616-184013638 CCCTGGATGTGGGAAGGGAATGG + Intergenic
944404905 2:199373149-199373171 CCCTGTCTGAGGGAAGAGGAGGG + Intronic
946349529 2:219140550-219140572 CTTTGGCTGTAGGAAGTGAGAGG + Intronic
946389919 2:219409049-219409071 CTCAGGCTGTCAGAAGTTGAGGG + Intergenic
946399539 2:219461193-219461215 CTCAGCCTGGGGGAAGAGGAGGG - Intronic
946697329 2:222372644-222372666 CTCTGTCTGTGGAAAAGGGAGGG + Intergenic
946768991 2:223068751-223068773 CTGGGGGTGTGGGAAGAGGAAGG - Intronic
947687068 2:232097477-232097499 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
947909516 2:233791936-233791958 CTCAGGGTGGGTGAAGTGGAGGG + Intronic
948337477 2:237221742-237221764 CTCTGGCTGTGTGTTGTGTAGGG - Intergenic
948474020 2:238204786-238204808 CTCTGGCTGTAGGACATGGAGGG + Intergenic
948476945 2:238226535-238226557 CCCTGGCAGTTGGAACTGGAAGG - Intronic
948571233 2:238918460-238918482 CTCGGGCTCTGGGATGTGAAAGG + Intergenic
948642619 2:239385243-239385265 CTCTGGCTAAGGGAAGCTGAGGG - Intronic
948858651 2:240742479-240742501 CTCTGCCTGTGGGAACAGGTGGG - Intronic
948880772 2:240856163-240856185 CTCTGGCTGTGGCAAGTTCTTGG - Intergenic
948964101 2:241362933-241362955 CTGTGGTTCTGGGAGGTGGAGGG + Intronic
1168807837 20:683121-683143 CCCTGGCAGGGGGAAGGGGAGGG - Intergenic
1168813809 20:723100-723122 CTCTGGCTGTGGTCAGTGGCTGG + Intergenic
1168899864 20:1354488-1354510 CTCTGCCTGAGGAAAGGGGAGGG - Intronic
1169112264 20:3041857-3041879 CCCTGGGTGTGGGCAGTGGGAGG - Intergenic
1170005868 20:11668201-11668223 CTCTCACTGTGGGTACTGGAAGG - Intergenic
1170236090 20:14106308-14106330 CTCTGCCTTTGGAAAGGGGAAGG + Intronic
1170668455 20:18406965-18406987 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1171122282 20:22577869-22577891 CTCTGGCTGCAGGAAGCGGCTGG - Intergenic
1171938028 20:31294231-31294253 CTCTGCCTTTGGAAAGGGGATGG + Intergenic
1172117474 20:32581477-32581499 ATATGGCTGTGGGAGGAGGAAGG + Intronic
1174187856 20:48719820-48719842 CTCTGGCTGTGTGTGGAGGATGG - Intronic
1174222659 20:48969581-48969603 CTCTTGATGTGGGGTGTGGAGGG + Intronic
1174879896 20:54267675-54267697 GGCTGGCTGTGGGTAGGGGAGGG + Intergenic
1175270045 20:57727378-57727400 TGCTGGCTGTGGGAAGTTGCTGG - Intergenic
1175813246 20:61870122-61870144 TACTGGCTGGGGGAGGTGGAGGG - Intronic
1175925503 20:62469399-62469421 CTCTGGTTCAGGGAAGAGGATGG - Intronic
1176132757 20:63503191-63503213 CTCTGCCTCTGGGCACTGGAGGG - Intergenic
1176255559 20:64150858-64150880 GTCTGGCTAAGGGAAGGGGAGGG + Intergenic
1176363467 21:6017950-6017972 CCCTGGCTGAGGGTGGTGGAGGG - Intergenic
1177048845 21:16205804-16205826 CTCTAGCTGTGTGCACTGGAAGG + Intergenic
1177212896 21:18091860-18091882 CTCTGCCTGTGGAAAGGGGAAGG + Intronic
1177487945 21:21783269-21783291 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1177578004 21:22983167-22983189 CTCTGCCTTTGGGAAGGAGAAGG + Intergenic
1177761426 21:25406695-25406717 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1178690588 21:34746587-34746609 CTCTGGCTGGGGGAGGAGGGTGG + Intergenic
1178822925 21:35991741-35991763 CTCTGGCTCTGTGAGGTGGTGGG - Intronic
1179080782 21:38168869-38168891 CTCTGGCTGAGTGAAGGAGATGG + Intronic
1179185786 21:39084336-39084358 ACCTGGCTGTGGGAGGTGGGAGG + Intergenic
1179483193 21:41691652-41691674 CTCTGCCTGGGGGAGCTGGAAGG - Intergenic
1179760051 21:43520595-43520617 CCCTGGCTGAGGGTGGTGGAGGG + Intergenic
1179990830 21:44947481-44947503 CTCTAGCCCTGGGAAGTGGTGGG + Intronic
1181581124 22:23828724-23828746 CTCTGGCTGGGAGAGATGGAGGG - Intronic
1182504451 22:30771820-30771842 CTCAGGCTGTGGCAAGAGGCAGG + Intronic
1183497262 22:38154004-38154026 CTCTGCTTGTGGAAAGGGGAGGG + Intronic
1183625588 22:38999558-38999580 TTCTGGCTGTTGGCAGTGGAGGG - Intergenic
1183786316 22:40031034-40031056 CTCTGGCAGTGGGGAGGGGAAGG + Exonic
1183949037 22:41342512-41342534 CTCTGGCTGTGACAGGAGGAAGG - Exonic
1183989713 22:41589741-41589763 CTCTGCCTGTTTGACGTGGACGG - Exonic
1184091133 22:42293582-42293604 TTCAGGCTATGGGAAGGGGAGGG + Intronic
1184296833 22:43530326-43530348 CTCTGGGGGTGGGACATGGAGGG + Intronic
1185154769 22:49186732-49186754 CCCTGGCTGTGGGTGGAGGAGGG + Intergenic
1185273223 22:49938081-49938103 CACTGGCTGGCGGCAGTGGACGG - Intergenic
950127214 3:10517300-10517322 CCCAGGCTGGGGGAAGGGGAAGG - Intronic
950449747 3:13058961-13058983 CTCTGGGTGCAGGAGGTGGATGG + Intronic
951102370 3:18703660-18703682 CTCTGCCTTTGGAAAGTGGAGGG + Intergenic
951172092 3:19554470-19554492 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
951204426 3:19910360-19910382 CTCTGTCTTTGGGAGGGGGAGGG + Intronic
951310228 3:21116752-21116774 CTCTGCCTCTGGAAAGGGGAGGG - Intergenic
951494854 3:23315189-23315211 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
951494991 3:23316349-23316371 CTCTGCCTGGGGTAAGGGGAAGG - Intronic
951535351 3:23735742-23735764 CACTGGCTGGGGGAAGGGGCTGG - Intergenic
952203080 3:31151373-31151395 CTCTGTCTTTGGAAAGGGGAGGG - Intergenic
952836866 3:37610079-37610101 CTCTGGCTGGGGGACGGGGAGGG + Intronic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953201522 3:40782093-40782115 CTCTGGGTGTGGCAAGTGGGTGG + Intergenic
953217279 3:40931092-40931114 CTCTGCCTTTGGAAAGGGGAAGG + Intergenic
953362349 3:42309231-42309253 CTCTGCCTGTGGAAATGGGAGGG - Intergenic
953863421 3:46564327-46564349 CTCTGGCTCTGTAAAGTGGATGG - Intronic
954126882 3:48536554-48536576 CTCTGGTGGTTGGAAGTGCAAGG - Intronic
955380932 3:58437385-58437407 CTCTGGCTGGCAGAAGTGGGGGG + Intergenic
955386868 3:58487422-58487444 CTCTGGCACTGGGAAGTGAGGGG + Intergenic
955738633 3:62066092-62066114 CTCTGGCTGGGAGAAGAGGAGGG + Intronic
956223035 3:66923957-66923979 CTCTGCCCGTGGAAAGGGGAGGG + Intergenic
956808140 3:72837238-72837260 CTCTGGGTATGGGGAGTGGAGGG + Intronic
957614167 3:82506431-82506453 GTCTGGCTGTGCGCAGTGGCTGG + Intergenic
957621960 3:82604959-82604981 CTCTGCCTTTGGAAAGGGGAAGG + Intergenic
958617673 3:96515689-96515711 CTCTGCCTGTGAAAAGGGGAGGG + Intergenic
958632230 3:96699524-96699546 CTCTGCCTATGGAAAGAGGAGGG - Intergenic
958756838 3:98259880-98259902 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
959146622 3:102554048-102554070 CTCTTGCTTAGGGAAGTGGAGGG + Intergenic
959303964 3:104636113-104636135 CTCTGCCTTTGGAAAGGGGACGG + Intergenic
959336137 3:105067063-105067085 CTCTGCCTGTGGAAAGAGGAAGG + Intergenic
959547386 3:107612981-107613003 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
959551845 3:107668975-107668997 CTCTGAATGTGGGAGGGGGATGG - Intronic
959724966 3:109532973-109532995 CTCTGCCTTTGGAAAGGGGAAGG - Intergenic
959798075 3:110456876-110456898 CTCTGTCTTTGGAAAGGGGAAGG - Intergenic
960862694 3:122168080-122168102 CTCTGACTGTGGTAAGTTAAGGG - Intergenic
960870082 3:122239325-122239347 CTCTGCCTGTGGAAAGGTGAGGG + Intronic
961141579 3:124560868-124560890 CCCTGTCTGGGGGCAGTGGAAGG + Intronic
961628936 3:128282224-128282246 CACTGGTGGTGGGAAGTGGGTGG + Intronic
961964372 3:130887565-130887587 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
962038724 3:131682872-131682894 CTCTGCTTGTGGAAAGGGGAGGG - Intronic
962086650 3:132198481-132198503 CGCTGGCCTTGGGAAGTGGCGGG + Intronic
962767641 3:138580117-138580139 CTCTGCCTGGGGAAAGGGGAGGG + Intronic
963310147 3:143700574-143700596 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
963448103 3:145440410-145440432 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
963763298 3:149307580-149307602 CTCTGCCTGTAGAAAGAGGAAGG - Intergenic
964240599 3:154589021-154589043 CTCTGGCTGTGGAGCGTGGGAGG + Intergenic
964339043 3:155688805-155688827 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
964810153 3:160654517-160654539 CTCTTTCTGTGGAAAGGGGAGGG + Intergenic
964952724 3:162316806-162316828 CTCTGCCTTTAGAAAGTGGAGGG - Intergenic
965236830 3:166135924-166135946 ATCTGCCTGTGGAAAGGGGAAGG - Intergenic
965253218 3:166369077-166369099 CTCTGCCTGTGGAAAGGGAAGGG + Intergenic
965866976 3:173216543-173216565 CTCTGTCTGTGGAAAGAGCAAGG - Intergenic
966142004 3:176767359-176767381 CTCTGCTTGTGGAAAGAGGAGGG + Intergenic
966281258 3:178232324-178232346 CTGTGGCTGTGAGCAGGGGAAGG + Intergenic
966452119 3:180074328-180074350 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
968810908 4:2799317-2799339 CCCTGGGTGTGTAAAGTGGAGGG + Intronic
969470421 4:7384470-7384492 GGCTGGCTGTGGGAAGGAGACGG + Intronic
969691596 4:8706937-8706959 CTCTGGCTGTGGGTGGGGGTGGG + Intergenic
969705961 4:8791786-8791808 CCCTGGCTGTGAGAAGAGAAGGG - Intergenic
970071164 4:12161781-12161803 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
970083227 4:12314413-12314435 CTCTGGAGCTGGGAAGTAGATGG + Intergenic
970610834 4:17723749-17723771 ATTTGGCTGTGTAAAGTGGAGGG - Intronic
971089428 4:23323576-23323598 CACTGCCTGTGGGACCTGGAAGG - Intergenic
971095613 4:23399070-23399092 CTCTGCCTGTGGAAAGGGGACGG - Intergenic
971223745 4:24732809-24732831 CCCTGGGAGTGGGATGTGGAGGG - Intergenic
971237811 4:24858709-24858731 CCCTGGGTGTGGGAACTGGGAGG + Intronic
971914459 4:32850581-32850603 CTCTGACTGTGGAAAGGGGAGGG - Intergenic
971944872 4:33261392-33261414 CTGTGGTTGTGGGCAGTAGAAGG - Intergenic
972035201 4:34510927-34510949 GTCTGGGTGTGGACAGTGGAGGG - Intergenic
973289830 4:48459994-48460016 CTCTGTCTCTGGGAAGGGGTAGG + Intergenic
974301075 4:60067668-60067690 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
974333204 4:60506006-60506028 CTCTGCCTGTGGTTAGGGGAGGG + Intergenic
975369442 4:73567983-73568005 CTTTGCCTGTGGAAAGGGGAGGG - Intergenic
975375900 4:73645716-73645738 CTTGGCCTGTGGCAAGTGGAGGG - Intergenic
975502215 4:75099756-75099778 CTCTGCCTTTGTAAAGTGGAGGG - Intergenic
975592721 4:76016809-76016831 CTCTGCCTCTGGAAAGGGGAGGG - Intronic
976041152 4:80886114-80886136 CTCTGCCTGTGGAAATGGGAAGG + Intronic
976451807 4:85199365-85199387 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
976982122 4:91244173-91244195 CTATGCCTGTGGAAAGGGGAAGG + Intronic
978030976 4:103939470-103939492 CTCTGCCTTTGGAAAGAGGAAGG + Intergenic
978183875 4:105835376-105835398 GCCTGGCTGTGTGAAGTGGCCGG - Intronic
978520460 4:109610009-109610031 CTCTGCTTGTGGAAAGGGGAGGG - Intronic
979395094 4:120178160-120178182 CTCTGTTTGTGGAAAGGGGAGGG + Intergenic
979573050 4:122252561-122252583 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
980442564 4:132867646-132867668 CTCTGACTGTGGAAAGGGTAGGG + Intergenic
980629290 4:135412252-135412274 CTCTGGTGGTGGGGAGGGGAAGG + Intergenic
980686892 4:136240595-136240617 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
980693068 4:136320706-136320728 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
980723484 4:136727522-136727544 CTCTGCCTTTGGAAAATGGAGGG - Intergenic
981870992 4:149486375-149486397 CTCTGCCTGTGGAAACTGGAGGG - Intergenic
982504125 4:156196744-156196766 CACAGGATGTGGGAAGTGGCAGG - Intergenic
982683319 4:158458903-158458925 CTCTGTCTTTGGAAAGTGGAGGG - Intronic
982899473 4:160980549-160980571 CTCTTCCTGTGGAAAGGGGAGGG - Intergenic
983165906 4:164477298-164477320 CTCTGTCTGTGGAAAAAGGAGGG - Intergenic
983338018 4:166420979-166421001 CTCTGCTTGTGGAAAGGGGAGGG - Intergenic
984844646 4:184099184-184099206 CTCTGGCAGTGTGGAGTGGAAGG - Intronic
985323495 4:188740648-188740670 CTCTTGTTCTGGGAAGAGGACGG + Intergenic
986050574 5:4086279-4086301 CTCTGGCTTTGACAAGTGCAGGG + Intergenic
986251166 5:6059725-6059747 CACTGGCACTGGGAAATGGATGG + Intergenic
986756376 5:10840130-10840152 CTCTGCCTTTGGAAAGTGGAGGG + Intergenic
987998549 5:25317467-25317489 CTATGGCTGTGGGGACTTGAAGG + Intergenic
988340174 5:29960537-29960559 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
988623030 5:32842903-32842925 CTCTGCCTACGGGAAGTGCATGG - Intergenic
988934288 5:36066879-36066901 CACTGGCTGTGGGTAGAGGTAGG + Exonic
989504781 5:42215236-42215258 CTCTGCCTTTGGAAAGTGGAGGG - Intergenic
991180539 5:63746510-63746532 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
991237813 5:64419298-64419320 CTCTACCTGTGGAAAGGGGACGG + Intergenic
991663689 5:68974842-68974864 CTCTGACTTTGGAAAGGGGAGGG + Intergenic
992311561 5:75506115-75506137 CACTGGGAGTGGGAAGGGGAAGG + Exonic
992692664 5:79256165-79256187 CTCTGCCACTGGGAAGGGGAGGG - Intronic
992925241 5:81577386-81577408 CTCTTGGTGAGGGAAATGGAAGG + Intronic
993245952 5:85453283-85453305 CTGTGGCTGTGGTAAGTTGCAGG + Intergenic
993287298 5:86016092-86016114 CTCTTCCTGTGGAAAGGGGAGGG - Intergenic
993379319 5:87188000-87188022 TGTTGGCAGTGGGAAGTGGAGGG - Intergenic
993981315 5:94546126-94546148 CTCTGCCTGTGGAAAGGGGAAGG + Intronic
994028620 5:95114562-95114584 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
994477571 5:100290449-100290471 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
995803339 5:116023588-116023610 CACTGGCACTGGGAAGGGGAAGG + Intronic
996177557 5:120378454-120378476 CTCTGGCTGTGTGAAGCCTAGGG + Intergenic
996666619 5:126066989-126067011 CTCTGCCTGTGGAAAGAGGAAGG + Intergenic
996764671 5:127023889-127023911 CTTTGGCTGTGGGAGGTTTAGGG - Intronic
997104762 5:131005960-131005982 CTCTGGTTATGGAAAGGGGAGGG + Intergenic
997129095 5:131258616-131258638 CACTGGGGATGGGAAGTGGAAGG - Intronic
997362150 5:133301949-133301971 CCCTGGCTGTGGGCTGAGGAGGG - Intronic
997761498 5:136452598-136452620 GTCTGGCTTTGAGAAGAGGAGGG + Intergenic
997846635 5:137292217-137292239 CTCTGGATGAGGGATGAGGAAGG + Intronic
997969687 5:138391077-138391099 CTTTGACTTTTGGAAGTGGAAGG + Exonic
998142881 5:139709835-139709857 CTCTGGCTGTGGGAAGCTGGCGG + Intergenic
998291140 5:140916028-140916050 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
998383531 5:141742699-141742721 CCTTGGCAGTGGGAAGTGGGAGG + Intergenic
998882464 5:146657402-146657424 GTCTGTCTGTAGGATGTGGATGG + Intronic
998937927 5:147250427-147250449 ATCTAGCTATGGAAAGTGGAAGG + Intronic
999145111 5:149387370-149387392 TTATGGCTGTGGGAGATGGAAGG + Intronic
999311727 5:150555792-150555814 CTCTGGCTATGGGAAGGAGCAGG + Exonic
1000110044 5:158099521-158099543 TGCTGTCTGTGGAAAGTGGAGGG - Intergenic
1000270279 5:159677442-159677464 CTCTGCCTTTGGAAAGAGGAGGG + Intergenic
1001177714 5:169487174-169487196 CTCAGGCTTTGGAAAGGGGAGGG + Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002285452 5:178159806-178159828 CTCTGGCTGGGGGGAGGGGGTGG + Intergenic
1002298768 5:178246138-178246160 CTCTGGCCCTGCGAAGTGCAGGG + Intronic
1003169541 6:3710275-3710297 CTCAGCCTGTGGGCAGAGGAAGG - Intergenic
1004253922 6:14045462-14045484 CTCTGGGTGAGGGTTGTGGATGG + Intergenic
1004282733 6:14294659-14294681 CTGTGCCTGTGGGAAGTAGAGGG - Intergenic
1004397289 6:15256588-15256610 CCCCGGATGTGTGAAGTGGATGG - Intronic
1004437926 6:15614873-15614895 CTCAGGCTGTGGAAAGGGGCTGG - Intronic
1005495385 6:26383487-26383509 CTCGGGGAGGGGGAAGTGGAGGG + Intronic
1005499943 6:26421049-26421071 CTCTGGCTTTGGAAAGAGGGCGG + Intergenic
1005504415 6:26457544-26457566 CTCTGGCTTTGGAAAGGGGGCGG + Intergenic
1005682476 6:28220320-28220342 CTCTGGATGTGGCCAGAGGAAGG - Intergenic
1005790449 6:29295328-29295350 GTCTGGCTGTCGGGAGTGGCAGG - Intergenic
1006037946 6:31228812-31228834 CTGTGGCTGTAGGTAGAGGACGG - Intergenic
1006068065 6:31476798-31476820 CTGTGGCTGTAGGTAGAGGACGG - Intergenic
1006963783 6:37961262-37961284 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
1007001586 6:38318994-38319016 CTCTGGCTGGGGCAAGGGGTGGG - Intronic
1007170232 6:39857512-39857534 CTCTGGATGGGGCAAGTGGTGGG + Intronic
1007663012 6:43497884-43497906 CTGTGGCTAAAGGAAGTGGAGGG + Exonic
1007914347 6:45547018-45547040 CTCTGGCTTTGGGAAGAGCCGGG - Exonic
1008115603 6:47545867-47545889 CTCTGTCAGAGGGAAGTGTAGGG - Intronic
1008314754 6:50026147-50026169 CTCTGACTGTTGAAAGGGGAGGG + Intergenic
1008326448 6:50187819-50187841 CAATGGCGGTGGGAAGGGGAGGG - Intergenic
1009687748 6:66986229-66986251 CTCTGCCTTTGGGAAGGGGAGGG - Intergenic
1009893841 6:69721968-69721990 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1010264697 6:73853006-73853028 CTATGCCTGTGGAAAGGGGAAGG - Intergenic
1010502252 6:76615318-76615340 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1010560227 6:77340423-77340445 CTCTGCCTGTGGAAAGGGAAGGG - Intergenic
1010676716 6:78753950-78753972 CTCTGCCTGTGGAAAGGGGATGG + Intergenic
1011033255 6:82944872-82944894 TTCTGCCTGTGGAAAGGGGAGGG + Intronic
1011211457 6:84960149-84960171 CTCTGGCTGTGGGAATTGAGGGG + Intergenic
1012003673 6:93685355-93685377 CTCTGCCTATGGAAAGGGGAGGG + Intergenic
1012224552 6:96689053-96689075 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1012288043 6:97417331-97417353 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1012288352 6:97421497-97421519 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1012715305 6:102661096-102661118 CTCTGCCTGTGAAAAGAGGAGGG + Intergenic
1012892169 6:104908625-104908647 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
1013687510 6:112601941-112601963 CTCTGCCTGTGGAAAGAGGAGGG + Intergenic
1014865194 6:126520994-126521016 CTCTGCCTTTGGAAAGTGGATGG - Intergenic
1014968866 6:127790791-127790813 GCCTGGCTGTGGGCAGTGGCTGG - Intronic
1015964327 6:138683051-138683073 CTCCTGCCGTGGGAACTGGAGGG - Intronic
1016135269 6:140532819-140532841 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1016438204 6:144059200-144059222 CTGTGGCTTTGGGGAGTGCAAGG - Intronic
1016823127 6:148364379-148364401 CATTAGCTGTGGGAAGTCGATGG + Intronic
1017312360 6:152988719-152988741 CTCTTGTTCTGGGAAGAGGACGG - Exonic
1017575024 6:155792765-155792787 CTCTGGCTCTGGCAAGTGCTTGG - Intergenic
1019367856 7:644525-644547 CCCTGGCAGCGGGGAGTGGAGGG - Intronic
1019571785 7:1716259-1716281 CTCTGGCTGTGGGACCAGCAGGG - Intronic
1019773714 7:2899621-2899643 CTCTGGCTGCAGGAGGAGGAAGG - Intergenic
1020624276 7:10558426-10558448 CGCTGGCTGTGGAAAGGGAAAGG + Intergenic
1020812711 7:12865185-12865207 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1021333479 7:19368719-19368741 CTCGGGCAGTGGGATGAGGACGG - Intergenic
1021353792 7:19628561-19628583 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1021586170 7:22211170-22211192 CTTTTGCAGTGGGAAGTGGGTGG - Intronic
1022366916 7:29730435-29730457 CTCTGCCTGGGGAAAGGGGAAGG - Intergenic
1024178355 7:46863336-46863358 CTCTGTGTGTGTGAAGTGGTGGG - Intergenic
1024629072 7:51232383-51232405 ATCTGGCTGTGGGCTCTGGAAGG + Intronic
1024662371 7:51510772-51510794 CTCTGCCTGTGTAAAGGGGAGGG - Intergenic
1024891730 7:54211270-54211292 CTCTGCCTTTGGAAAGCGGAGGG + Intergenic
1025138033 7:56436890-56436912 TTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1026926276 7:74196121-74196143 CTCTGGCTGGGTGCAGTGAATGG + Exonic
1027219118 7:76202599-76202621 CTCTTGCACTGGGAAGAGGATGG + Intronic
1027604944 7:80288382-80288404 CTCTGCTTGTGGAAAGGGGAAGG + Intergenic
1027996168 7:85427517-85427539 CTCTGTCTGTGGAAAGGGGAAGG + Intergenic
1028153959 7:87408084-87408106 CAGTGGCTGTGGGAAGAGCACGG - Exonic
1028487114 7:91372182-91372204 CGGTGGCTGTGGGAACTGCAAGG - Intergenic
1028521948 7:91741996-91742018 CTCTGCCTGTGGAAAGGAGAGGG - Intronic
1028622096 7:92836368-92836390 CTGTGGGTGGGGTAAGTGGAGGG - Intronic
1028947250 7:96594318-96594340 CTCTTGGTGTGGGAAGTGGGTGG - Intronic
1029825348 7:103187020-103187042 CTCTGCCTGGGGAAAGGGGAAGG + Intergenic
1029986372 7:104927005-104927027 ATCTGGCTTTGGGAAGTGTGAGG - Intergenic
1030042471 7:105464526-105464548 ATCTGGCTCTGGGAAGGAGAGGG - Intronic
1030598932 7:111570979-111571001 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1030739112 7:113086793-113086815 CGCTGCCTTTGGGAAGAGGATGG - Intronic
1030973090 7:116086251-116086273 AACTGGGTGTGGGAAGAGGAAGG - Intronic
1032263788 7:130356478-130356500 CTGGGGCTGGGGGAAGGGGATGG - Intronic
1032658211 7:133954807-133954829 ATCTGGCTGTGAGCAGTGGCTGG - Intronic
1032939183 7:136768624-136768646 CTCTGCCTGTGGTAAGGGGAAGG + Intergenic
1033485939 7:141789360-141789382 CTCTGGCTGTAGGCTATGGAGGG - Intergenic
1034281251 7:149855962-149855984 CTCTGACTGTGGGGAGTGGTGGG - Intronic
1034408379 7:150921829-150921851 GGATGGCTGGGGGAAGTGGAGGG + Intergenic
1034440596 7:151083714-151083736 CCCTGGCTGTTGGCAGGGGAGGG - Intergenic
1034730360 7:153381792-153381814 GTCTCGCTGTGGGAACTGGAAGG + Intergenic
1035084467 7:156246650-156246672 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1035314894 7:157991550-157991572 CTCTGGCTGAGGGAGGGTGAGGG + Intronic
1035550860 8:523706-523728 CTCTGCTTGTGGAAAGGGGAGGG + Intronic
1037839289 8:22232422-22232444 CTCTGATTGGGGGAAGGGGAGGG + Intergenic
1037931134 8:22880965-22880987 CTCTGCCTGGGGGAAGAGGTGGG + Intronic
1038003489 8:23410328-23410350 ATCTGGCCTTGGGAAGGGGATGG + Intronic
1038871835 8:31503747-31503769 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
1039238385 8:35527955-35527977 ATTTGGCAGTGGGAAGGGGAAGG + Intronic
1039282055 8:35996936-35996958 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
1040688807 8:49910240-49910262 CCCGGGCTGTGGGAAGGGGCCGG - Intronic
1041173268 8:55167102-55167124 GACTGGATGTGGGAAGTGGAAGG + Intronic
1041851866 8:62402155-62402177 CTCTGCATGTGGAAAGTGAAGGG - Intronic
1042005034 8:64170103-64170125 GTCTGACTGTGTGCAGTGGATGG + Intergenic
1042015247 8:64302177-64302199 CTCTCAGTGTGTGAAGTGGAGGG - Intergenic
1042162683 8:65912791-65912813 CTCTGCCTATGGAAAGGGGAGGG + Intergenic
1042392409 8:68251043-68251065 CAGGGGCTGTGGGAAGGGGATGG + Intergenic
1042803365 8:72745103-72745125 CTCTGGATCAGGGAGGTGGAGGG - Intronic
1042898431 8:73695778-73695800 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1043080140 8:75755890-75755912 CTCTGCCTGAGGAAAGGGGAGGG + Intergenic
1043366899 8:79543281-79543303 CTCTGCCTTTGGAAAGGGGAAGG + Intergenic
1043441540 8:80280864-80280886 CAGGGGCTGTGGGAAGTGGCAGG + Intergenic
1043998067 8:86843454-86843476 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1045041258 8:98227001-98227023 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
1045172474 8:99686591-99686613 CACTGCTTGTGGAAAGTGGAGGG - Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1045590001 8:103582696-103582718 CTCTGCCTTTGGAAAGAGGAGGG + Intronic
1045621273 8:103980836-103980858 TTCTGCCTGTGGTAAGGGGAGGG + Intronic
1046384053 8:113486249-113486271 CTCTCCCTGTGGAAAGAGGAGGG - Intergenic
1047246720 8:123152483-123152505 CTCTGGAGCTAGGAAGTGGAGGG - Intergenic
1047529998 8:125665801-125665823 ATCAGGCTCTGGGAGGTGGAAGG - Intergenic
1048426979 8:134332154-134332176 CTTTGGCAGTGGAAAGTGGGTGG - Intergenic
1048577907 8:135707307-135707329 CTCAGGCTGGGGGAGGTGGGAGG + Intergenic
1048591204 8:135822226-135822248 CTGTGGCTGTGGGAAAGGGGTGG + Intergenic
1050280243 9:4043118-4043140 GTGGGGCTGTGGGAAGGGGAGGG - Intronic
1050355928 9:4782457-4782479 CTCTGCCTGTGGAAAGTACAGGG + Intergenic
1050705071 9:8387227-8387249 CTCTGGCTGAGGGGAGTTGGGGG + Intronic
1050865137 9:10488693-10488715 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
1051745575 9:20291910-20291932 CTCTGGGTGGGGAAAATGGAGGG + Intergenic
1051916797 9:22217856-22217878 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1051921814 9:22275329-22275351 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1052063364 9:23987379-23987401 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1052361971 9:27571818-27571840 CTCCTGTTGTGGAAAGTGGACGG - Intronic
1052863736 9:33452742-33452764 CTCTGGCTGGAGGAAGGGGAAGG + Intergenic
1053199879 9:36145094-36145116 GACTGGCTGTGGGTAGTGGCAGG - Intronic
1053266104 9:36714583-36714605 CTCAGGGTGGGGGAAGTGGCAGG + Intergenic
1053438039 9:38090278-38090300 CTCTGCCTGGGGGATGGGGACGG + Intergenic
1053618676 9:39794514-39794536 CTCTGGCTGTGGGCACAGAAGGG - Intergenic
1053876853 9:42553876-42553898 CTCTGGCTGTGGGCACAGAAGGG - Intergenic
1054265479 9:62912915-62912937 CTCTGGCTGTGGGCACAGAAGGG + Intergenic
1054809258 9:69421917-69421939 CTACCGCTGCGGGAAGTGGAAGG - Intergenic
1055051400 9:71984917-71984939 CTCTGCCTTTGGGAGGTGGCTGG + Intronic
1055302108 9:74892447-74892469 CTCTGCCTGTGGCAAGTTGAAGG + Intergenic
1055488240 9:76777971-76777993 CTATAGCAGTGGGAGGTGGAAGG + Intronic
1055554468 9:77460805-77460827 CACAGGCTGTGGGGCGTGGATGG + Intronic
1055692244 9:78845644-78845666 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1055699946 9:78933115-78933137 CTCTGCCTGTAGGAAGAGGATGG + Intergenic
1055886412 9:81069148-81069170 GTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1056424639 9:86464706-86464728 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1057041027 9:91847497-91847519 CTCTTTATGTGGGAAGTGGGGGG - Intronic
1057270052 9:93645503-93645525 CTGTGGCTGTGGGAGGTGGGTGG + Intronic
1057282027 9:93720159-93720181 CTGGGGCTGTGGGAGGTGGCAGG - Intergenic
1057996748 9:99825863-99825885 CCCTGGCTGAGGGAAGTGGGTGG + Intronic
1058103106 9:100938225-100938247 CAGTGGGTATGGGAAGTGGATGG + Intergenic
1058205524 9:102101041-102101063 CTATGGCTGATGGAAGTTGAAGG + Intergenic
1058408172 9:104700805-104700827 CCCTGGCAGTGGAAAGTGGTTGG - Intergenic
1058785424 9:108381854-108381876 CTCTGGCTGTGGGACAGGGGAGG + Intergenic
1059285536 9:113168744-113168766 CTCTGGCTGTAGGTTCTGGAGGG - Intronic
1059692990 9:116703759-116703781 CTCTGTAGGAGGGAAGTGGAAGG + Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060252773 9:121999435-121999457 CTCTGGCTTGGGGACATGGATGG - Intronic
1060304553 9:122398812-122398834 CTCTGCCTGTGGGAAGGGGAGGG + Intergenic
1060659727 9:125397764-125397786 CTCTTGCCCTGGTAAGTGGAGGG + Intergenic
1060712962 9:125889262-125889284 CTCTGGCTGTGGGCTGTTGAAGG + Intronic
1061411271 9:130423076-130423098 CTCAGGCTGATGGAAGTGGAGGG + Intronic
1061579670 9:131529353-131529375 CACTGACTGTGGGAAGGGGTGGG + Intronic
1061601265 9:131671719-131671741 ATCTGGCTGTGGAAAGTGCAGGG + Intronic
1061638347 9:131929673-131929695 TTCTGCCTGTGGAAAGGGGAGGG + Intronic
1061881884 9:133572844-133572866 CTCTGCCCCTGGGGAGTGGATGG - Intronic
1062261798 9:135666606-135666628 CTCAGGCTCTGGGAAGGGAAGGG - Intergenic
1062394088 9:136345724-136345746 CGCTGGGTGTGGTAAGTGAAGGG + Intronic
1062699375 9:137890992-137891014 CTCTGCCTGTGGGTGGGGGATGG + Intronic
1062707381 9:137953064-137953086 CTCTGGGAGTGGGATGTGGTAGG + Intronic
1185596759 X:1311831-1311853 TTCTAGATGTGGGAAATGGAGGG - Intergenic
1186343682 X:8669072-8669094 CTCTGTGTGTGGGAAGTTGAAGG + Intronic
1186911620 X:14173928-14173950 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
1187579269 X:20591452-20591474 CTCTGCCAGTGGAAAGGGGAGGG - Intergenic
1187630464 X:21164139-21164161 CTCTGTCTGAGGGCAGTAGATGG + Intergenic
1188881891 X:35499634-35499656 CTCTGTCCTTGGGCAGTGGATGG - Intergenic
1188930117 X:36098594-36098616 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
1189319257 X:40077765-40077787 CGGTGGCTGTGAGAAGTTGAGGG + Intronic
1189411828 X:40779539-40779561 CTCTGCTTGTGGAAAGTGGAGGG - Intergenic
1189593904 X:42543877-42543899 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1189681165 X:43518227-43518249 CACTGCAAGTGGGAAGTGGAGGG - Intergenic
1189858391 X:45247485-45247507 CTCTGCCTTTGGAAAGGGGAAGG - Intergenic
1190015179 X:46820272-46820294 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1190374284 X:49774368-49774390 CTCTGCCTGTGGAAGGAGGAGGG - Intergenic
1190415037 X:50172564-50172586 CTTGGGCTGTGGGATGTGGAGGG + Intergenic
1191059279 X:56277887-56277909 CTCTGGCTGTGGAAAGTGAAGGG - Intronic
1191207375 X:57849304-57849326 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1192397342 X:70795240-70795262 CTCTGCTTGTGGAAAGAGGAGGG + Intronic
1192529014 X:71870558-71870580 CTCTGTCCGTGGGGTGTGGAAGG + Intergenic
1192640766 X:72859745-72859767 CTCTTCCTGTGGAAAGGGGAGGG + Intergenic
1192640945 X:72861031-72861053 CTCTTCCTGTGGAAAGGGGAGGG - Intergenic
1192676261 X:73199737-73199759 CTCTGCCTTTTGAAAGTGGAAGG + Intergenic
1192836178 X:74801970-74801992 CTCTGCCTGTGGAAATGGGAGGG + Intronic
1192838408 X:74827353-74827375 CTTTAGCTGTGGGAATTAGAAGG - Intronic
1193012896 X:76697339-76697361 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1193683677 X:84552426-84552448 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1193894895 X:87100876-87100898 CTCTGACTGTGGAAAGGGGAAGG + Intergenic
1193930317 X:87544230-87544252 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
1193957874 X:87885510-87885532 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
1194157824 X:90415306-90415328 CTCTGCCTTTGGAAAGAGGAAGG - Intergenic
1194219572 X:91174950-91174972 CTCTGGCTATGTAATGTGGATGG - Intergenic
1194327652 X:92540294-92540316 CTCTGCCTGTGGAAAGAGGAGGG - Intronic
1194338652 X:92682049-92682071 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1194495531 X:94613028-94613050 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1194586159 X:95736613-95736635 TTCTGTCTGTGGAAAGGGGAGGG + Intergenic
1194780732 X:98022896-98022918 CTCTGCCTGTGGAAAGGGGTGGG - Intergenic
1194783791 X:98057663-98057685 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1194823457 X:98532517-98532539 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1194857809 X:98956157-98956179 CTCTGCCTTTGGAAAGGGGAAGG - Intergenic
1195014599 X:100766073-100766095 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1195090062 X:101450302-101450324 ATCTGCCTGTGGGAAGGGGAGGG - Intronic
1195115824 X:101696767-101696789 CTCTGCATGTGGAAAGGGGAGGG + Intergenic
1195543283 X:106087334-106087356 CTCTGTCTATGGAAAGGGGAGGG - Intergenic
1195917282 X:109948149-109948171 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
1196145916 X:112316731-112316753 CTCTGGTTGGGAGAAGTGGGAGG - Intergenic
1196258803 X:113554142-113554164 TTCTTGCTGTGTTAAGTGGAAGG - Intergenic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1196552568 X:117046078-117046100 TTCTGTCTGTGGAAAGGGGAGGG + Intergenic
1196660582 X:118264611-118264633 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1197053967 X:122094533-122094555 CTCTGCCTGGGGAAAGGGGAAGG + Intergenic
1197449490 X:126594287-126594309 CTCTGCCTTTGGGAAGGGGAGGG - Intergenic
1197458392 X:126707056-126707078 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1197810773 X:130441416-130441438 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1198697180 X:139354682-139354704 CTCTGCCTGTGGAAATTAGAAGG - Intergenic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1198927401 X:141814591-141814613 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1199205789 X:145146712-145146734 CTCTGTCTCTGGGGAGAGGATGG + Intergenic
1199441034 X:147867615-147867637 CTCTGCCTCTGGAAAGAGGAGGG + Intergenic
1199995670 X:153024234-153024256 CTCCCTCTGTGGGAAGTGGGGGG - Intergenic
1200315933 X:155132999-155133021 CTCTGCCTGTGGAAGGGGGAGGG + Intronic
1200504156 Y:3992275-3992297 CTCTGCCTTTGGAAAGAGGAAGG - Intergenic
1200556085 Y:4638714-4638736 CTCTGGCTATGTAATGTGGATGG - Intergenic
1200592000 Y:5087136-5087158 CTCTGCCTTTGGAAAGTAGAGGG - Intronic
1200636363 Y:5659512-5659534 CTCTGCCTGTGGAAAGAGGAGGG - Intronic
1200647043 Y:5798831-5798853 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1201568010 Y:15386334-15386356 CTCTAGGTGTGGGAGGTGGCAGG + Intergenic
1202340010 Y:23853948-23853970 GCCTAGCTGTGTGAAGTGGATGG + Intergenic
1202530756 Y:25816134-25816156 GCCTAGCTGTGTGAAGTGGATGG - Intergenic