ID: 1161570777

View in Genome Browser
Species Human (GRCh38)
Location 19:5029891-5029913
Sequence CACTCTCAGCACAGGGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161570777_1161570790 23 Left 1161570777 19:5029891-5029913 CCTGAGTCCCTGTGCTGAGAGTG 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1161570790 19:5029937-5029959 TTCCAGATGGAAGGGCTGTCTGG 0: 1
1: 0
2: 1
3: 27
4: 225
1161570777_1161570782 -7 Left 1161570777 19:5029891-5029913 CCTGAGTCCCTGTGCTGAGAGTG 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1161570782 19:5029907-5029929 GAGAGTGGCTCCCGGTGTCACGG 0: 1
1: 0
2: 0
3: 10
4: 120
1161570777_1161570785 10 Left 1161570777 19:5029891-5029913 CCTGAGTCCCTGTGCTGAGAGTG 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1161570785 19:5029924-5029946 TCACGGCTCCACCTTCCAGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
1161570777_1161570791 24 Left 1161570777 19:5029891-5029913 CCTGAGTCCCTGTGCTGAGAGTG 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1161570791 19:5029938-5029960 TCCAGATGGAAGGGCTGTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 241
1161570777_1161570787 15 Left 1161570777 19:5029891-5029913 CCTGAGTCCCTGTGCTGAGAGTG 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1161570787 19:5029929-5029951 GCTCCACCTTCCAGATGGAAGGG 0: 1
1: 0
2: 0
3: 29
4: 271
1161570777_1161570786 14 Left 1161570777 19:5029891-5029913 CCTGAGTCCCTGTGCTGAGAGTG 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1161570786 19:5029928-5029950 GGCTCCACCTTCCAGATGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161570777 Original CRISPR CACTCTCAGCACAGGGACTC AGG (reversed) Intronic
901197404 1:7447780-7447802 CACACTCAGCACAGGAAGGCAGG - Intronic
901251108 1:7781245-7781267 CACCTTCAGCGCAGGGTCTCTGG + Exonic
901648737 1:10730490-10730512 CACTCTCAGCTCAGTCACACGGG - Intronic
903374286 1:22856138-22856160 CCCTCTCCTCCCAGGGACTCTGG - Intronic
903683751 1:25115798-25115820 CCCTCACAGAGCAGGGACTCAGG + Intergenic
904090612 1:27942379-27942401 CGGTCTCAGCTCAGGGACTTGGG + Intronic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
906123423 1:43411008-43411030 AACCCCCAGTACAGGGACTCTGG + Intronic
908820317 1:68078876-68078898 CACACTCTCCACAGGGACCCGGG - Intergenic
909400880 1:75229251-75229273 TATTCTCAACACAGGGACTAGGG + Intronic
909713622 1:78680343-78680365 CACTCACAGTCCAGGGACTATGG + Intergenic
909826040 1:80127888-80127910 TGCACACAGCACAGGGACTCTGG + Intergenic
911575833 1:99576947-99576969 CTCTCTCAGCATTGGGACTAGGG - Intergenic
911732185 1:101302599-101302621 CATTCTGAACACAGGGAATCTGG + Intergenic
912760277 1:112360192-112360214 TACTCTGACCACAGGGACACTGG - Intergenic
924596308 1:245447863-245447885 CACTCTCAGCACACTGCCTATGG + Intronic
1063611873 10:7569667-7569689 GTCTCTGATCACAGGGACTCTGG - Exonic
1063761093 10:9077840-9077862 CACTCTCAGCAAACTGACACAGG + Intergenic
1064154755 10:12894660-12894682 CACACTGAGCTCAGGGACCCAGG + Intergenic
1064248887 10:13691727-13691749 CCCCCTTAGCACAGGGAATCTGG - Intronic
1064420326 10:15185269-15185291 CACCCTCAGGCCAGGGTCTCGGG + Intergenic
1065233542 10:23623143-23623165 TACCTACAGCACAGGGACTCAGG - Intergenic
1065490157 10:26274692-26274714 CACCCTCTGCACAGCCACTCTGG - Intronic
1066298874 10:34079476-34079498 CACTCTCAGCTCAGGGTGTGGGG + Intergenic
1067716068 10:48691969-48691991 CATTCTCAGGGCAGAGACTCTGG - Intronic
1068318370 10:55377933-55377955 CACTCTCAGCAAACTGACACAGG + Intronic
1071516010 10:86298487-86298509 CACCCCCAGCACAGGGGTTCTGG - Intronic
1073214085 10:101827094-101827116 CACTCTCAACACTGGGTGTCAGG + Intronic
1073993974 10:109294899-109294921 TACACACAGCACAGGGACCCTGG - Intergenic
1077166135 11:1139900-1139922 GACTCTCAGGCCAGGGACTGAGG + Intergenic
1077218182 11:1403802-1403824 CACTCTCTGCACAGGCCCTGTGG - Intronic
1077942912 11:6862813-6862835 TAATCTCAGCACTGGAACTCTGG - Intergenic
1079181980 11:18201716-18201738 TACACACAGCACAGGGACCCTGG + Intronic
1083133331 11:60647374-60647396 CCCTCTTAGCACAGGGACAGGGG - Intergenic
1083234256 11:61341766-61341788 CACTCTTAGCACTGGGCATCAGG - Intronic
1083993853 11:66262557-66262579 CACTCTGTACACAGGGACACAGG + Intronic
1084109160 11:67002381-67002403 CACCCGCAGCACAGAGACACTGG + Intergenic
1084170073 11:67396781-67396803 CACTTTCAGCACAGGAAGTTGGG + Intronic
1084174488 11:67416234-67416256 CACTCTCTGCCCAGGGACTTGGG - Intronic
1084705714 11:70814984-70815006 CACTCCCAGAGCAGGGACTCAGG + Intronic
1087496317 11:98894416-98894438 CACACACAGCACAGGGACCCTGG + Intergenic
1087956858 11:104299239-104299261 CAGTCTCAGCAAAGGAACACAGG - Intergenic
1090039941 11:123281904-123281926 CAGTCTCAGCCCATGGACTTTGG - Intergenic
1090573030 11:128068415-128068437 TGCACACAGCACAGGGACTCTGG + Intergenic
1090794021 11:130118864-130118886 CACTGCTAGCACAGGGACTTTGG - Intronic
1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG + Intronic
1093552724 12:20434548-20434570 CCCTCTCAGCACAGGGATCAGGG - Intronic
1096333350 12:50733968-50733990 CACTCTTATCACGGGGACTGTGG - Intronic
1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG + Exonic
1097278994 12:57832940-57832962 AATTCTAAGCTCAGGGACTCAGG + Intronic
1098819391 12:75209017-75209039 GACTTTCAGCTCAGGGACCCAGG - Intronic
1102842550 12:116141643-116141665 CACCCTCACCACAGGGACTCTGG + Intronic
1103707009 12:122880854-122880876 CACCATCATCACAGGGAGTCTGG + Intronic
1104678560 12:130732406-130732428 CAATCCCTTCACAGGGACTCAGG + Intergenic
1104835218 12:131785864-131785886 GCCTCTCAGCACAGATACTCAGG - Intronic
1105745256 13:23372124-23372146 CACTCTTTGCACAGGTACTTCGG - Intronic
1106225581 13:27783950-27783972 CAGGCTCAGCTCACGGACTCAGG + Intergenic
1109286197 13:60410528-60410550 CACTCTCAGCACAGACACAAAGG - Intronic
1109810678 13:67509227-67509249 TACACACAGCGCAGGGACTCTGG - Intergenic
1110735920 13:78936575-78936597 CTCTTCCAGCACAGGGACTCAGG + Intergenic
1112218439 13:97460813-97460835 GATGTTCAGCACAGGGACTCTGG + Intronic
1112341036 13:98553175-98553197 CACGCACCCCACAGGGACTCTGG - Intronic
1112470694 13:99685997-99686019 CACTCTTATCACAGGGACGCAGG - Intronic
1113587550 13:111475683-111475705 CACTCTCAGCCCAGAGCTTCTGG - Intergenic
1114393335 14:22333660-22333682 GAATCTGAGCCCAGGGACTCTGG - Intergenic
1116275209 14:42824229-42824251 TACACACAGCACAGGGACCCTGG - Intergenic
1116623275 14:47233817-47233839 CACTCCCACCACAAGGACTGGGG + Intronic
1117513261 14:56473715-56473737 CGGCCTCAGCACAGGGAGTCAGG - Intergenic
1118534360 14:66743162-66743184 AACTCTCTACACAGGGAATCAGG - Intronic
1118653863 14:67925960-67925982 CGCACACAGCACAGGGACCCTGG + Intronic
1119569367 14:75656722-75656744 CACTCTCAGTAGAGAGGCTCAGG + Intronic
1123151404 14:106185257-106185279 CTCTCTCAGCCCTGGGACTGGGG + Intergenic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1125097134 15:35867726-35867748 CAATATCACCACAGGAACTCAGG - Intergenic
1127402705 15:58606097-58606119 CACTCTCAGCAAATGCATTCTGG + Intronic
1127847683 15:62885824-62885846 CACTCTCATGAAAGGGAGTCTGG + Intergenic
1127897255 15:63312341-63312363 AACTCTCAGCCCAGGGATTCAGG - Intergenic
1129782806 15:78285089-78285111 CAGACTCTGCACAGGAACTCTGG + Intronic
1131250563 15:90827526-90827548 CACTCTAAACACAGGAGCTCAGG - Intergenic
1131409142 15:92191467-92191489 CATTCACAGCCCAGGGACTTTGG + Intergenic
1132660907 16:1061137-1061159 CACTCTCACTACCGGGGCTCGGG + Intergenic
1135536678 16:23300067-23300089 CACTCTCAGCAAACTGACACAGG + Intronic
1138349081 16:56336924-56336946 CCCTCTGAGCACTGGGCCTCGGG + Intronic
1139292265 16:65869714-65869736 TAATCTCAGCACAAGAACTCAGG + Intergenic
1140482081 16:75267231-75267253 CACTGCCAGAACAGGGACTTGGG - Intronic
1140508694 16:75491927-75491949 CACTCTCAACACCAGGACTGTGG + Intronic
1140854339 16:78964798-78964820 TACACACAGCACAGGGACCCAGG - Intronic
1141895032 16:86953830-86953852 CGCTCTCAGCTCAGGGTGTCCGG - Intergenic
1142855611 17:2727878-2727900 CACACTCATCCCAGTGACTCAGG + Intergenic
1143462626 17:7114012-7114034 CACTCTGTGAACAGGGACTGAGG - Intronic
1147132735 17:38418768-38418790 CACCCAGAGCACTGGGACTCAGG - Intergenic
1147189015 17:38728316-38728338 CACTCTCAAAAAAGGGACTGAGG - Exonic
1147846914 17:43410943-43410965 CACAGTCAGCACCGGGAATCTGG + Intergenic
1151036863 17:70810676-70810698 CACTCCCAGAACAGGGAAACTGG + Intergenic
1151651933 17:75475551-75475573 TGCTCTCAGCACAGGCACCCTGG - Intronic
1152292270 17:79446737-79446759 CGCTCTCAGCACACGGCCTATGG + Intronic
1152612585 17:81322963-81322985 CCTTCTCAGCATTGGGACTCCGG - Intronic
1152900999 17:82941126-82941148 CACGCCCAGCGCAGGGACTGCGG - Intronic
1155359377 18:24984839-24984861 CGATGTCAGCACAGGGACTCTGG - Intergenic
1155675612 18:28425617-28425639 CACACACAGCACGGGGACCCTGG - Intergenic
1155851671 18:30782460-30782482 TACACACAGCACAGGGACCCTGG - Intergenic
1156193483 18:34746628-34746650 TAGTCTCCCCACAGGGACTCTGG + Intronic
1156493748 18:37512261-37512283 CACGCTCAGCACATGGACATTGG - Intronic
1156903241 18:42325719-42325741 CACCCTGAGCACATGAACTCAGG + Intergenic
1157517675 18:48322220-48322242 CAATCTCAGCACTGACACTCTGG + Intronic
1159587931 18:70299585-70299607 CACTCTAGGCACTGGGTCTCTGG + Intronic
1159873742 18:73787514-73787536 CTCTCTCAGGGCAGGGAATCTGG + Intergenic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1161961804 19:7527501-7527523 CAGTCTAAGGACAGGGAGTCAGG - Exonic
1163127562 19:15252535-15252557 CACTCGCAGCAGAGTGACTGGGG - Intronic
1164414760 19:28037819-28037841 CACTCACAGCAAAGGGATTAAGG + Intergenic
1166798640 19:45443076-45443098 CACACACAGACCAGGGACTCAGG + Intronic
1167262533 19:48467272-48467294 CTCTCTCAGCTCAGGGTGTCTGG + Intronic
1168013774 19:53555142-53555164 CCATCTCAGCACAGAGACGCTGG - Intronic
1168013796 19:53555294-53555316 CCATCTCAGCACAGAGACGCTGG - Intronic
925145950 2:1583449-1583471 CAGGCTTAGCACAGGGACTGGGG - Intergenic
926059070 2:9794011-9794033 CACTCTCCTCACAGGCAGTCAGG + Intergenic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
929341779 2:40827811-40827833 GACTGCCAGCACAGGGACTGGGG + Intergenic
930801945 2:55451968-55451990 CACTTCCAGGCCAGGGACTCAGG + Intergenic
931300522 2:60973929-60973951 AGCTCTCAGCAGAGAGACTCTGG - Intronic
932847546 2:75151347-75151369 TACACACAGCACAGGGACCCTGG - Intronic
935815205 2:106841081-106841103 TAATGTCAGCACAGGGACACAGG + Intronic
936192789 2:110345062-110345084 CAAGCTCAGGACAAGGACTCAGG + Intergenic
936345378 2:111671709-111671731 CACTCTCAGTTCAGGGCCACTGG + Intergenic
937910541 2:127073565-127073587 CACTGGGAGCACAGGGACTTGGG - Intronic
939224983 2:139353688-139353710 CACACACAGCACGGGGACCCTGG - Intergenic
939474266 2:142666318-142666340 CACCATCAGCACAGGGATTGTGG - Intergenic
939578057 2:143919469-143919491 TGCACACAGCACAGGGACTCTGG - Intergenic
943491332 2:188559189-188559211 TACACACAGCACAGGGACCCTGG - Intronic
944331477 2:198471737-198471759 CACTATCAGCCTAGGGACTGGGG - Intronic
946707986 2:222478012-222478034 AACTCTCAGCACAGGGGGACTGG - Intronic
947137168 2:226987053-226987075 CATTCTCAGCACAGTAACACAGG + Intronic
948641835 2:239379815-239379837 CACACTCACCACAGGGTCACAGG + Intronic
948672582 2:239578014-239578036 AAATCCCAGCACAGGCACTCGGG + Intergenic
1169482222 20:5994637-5994659 CACTGTAATCACAGTGACTCAGG + Exonic
1169529378 20:6467673-6467695 AAATCTCAGCACAGGATCTCTGG - Intergenic
1170634629 20:18093586-18093608 CACTCCCAGCCCAGGGGATCAGG + Intergenic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1173497201 20:43528400-43528422 CACTGTCAGCAGAAGTACTCTGG - Intronic
1175228689 20:57460229-57460251 CACTCTGAGCTCAGGGCCTGTGG + Intergenic
1175370385 20:58484361-58484383 AAGGCACAGCACAGGGACTCTGG + Intronic
1175445631 20:59017752-59017774 ATCTCTCAGGACAGGGACTCAGG - Intergenic
1178273586 21:31216207-31216229 CACAGTCAGCTAAGGGACTCAGG + Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1180034239 21:45235113-45235135 CACACACAGCACAGAGGCTCTGG - Intergenic
1180731241 22:17984172-17984194 CACTCTCAACACCTAGACTCAGG + Intronic
1181021801 22:20107455-20107477 CCCTCTGAGCACAGAGCCTCAGG - Intronic
1181038508 22:20181282-20181304 CACCCCCAGCACAGGCACTGGGG - Intergenic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1183085312 22:35483472-35483494 CTCCCTAAGCACAGGGACTTTGG + Intergenic
1184551691 22:45207876-45207898 GACTCTCAGCTCAGGGGCTCGGG - Intronic
1184827991 22:46966007-46966029 TACCCTCAGCACAGGGCCCCAGG - Intronic
1184945545 22:47801533-47801555 CTCCCACAGCACAAGGACTCAGG - Intergenic
1185104514 22:48859674-48859696 CCCTCTCTGCACAGAGACACCGG + Intergenic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
950640810 3:14346958-14346980 CACACTCAGGACAGAGACTCTGG + Intergenic
952519786 3:34145207-34145229 CACTCTGAGAAGAGGGACTTGGG + Intergenic
954605463 3:51905985-51906007 TGCACACAGCACAGGGACTCTGG - Intergenic
955057789 3:55471787-55471809 CACTCACACCACGTGGACTCTGG - Intronic
957250168 3:77762407-77762429 CATTCTCAGCAAAGTAACTCAGG + Intergenic
964520717 3:157563635-157563657 CACACACAGCACAGGGACCCTGG + Intronic
968501603 4:952742-952764 CACACACAGCACAGGGCCCCGGG - Intronic
968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG + Intergenic
968957786 4:3728017-3728039 CTCTCCCTGCACAGGGACTGGGG + Intergenic
969456616 4:7303859-7303881 CACTCTCAGGACAGGTCCACAGG - Intronic
969506485 4:7591334-7591356 CCCTCCCAGCCCTGGGACTCTGG - Intronic
969688351 4:8689440-8689462 CACCCTCAGCTCATGGGCTCTGG + Intergenic
969691928 4:8708634-8708656 CACTCTCCCCACTGGGGCTCTGG + Intergenic
970446310 4:16125943-16125965 CACTCTGAGGACAGAAACTCAGG - Intergenic
971691990 4:29848829-29848851 TAATCCCAGCACAGGGAGTCCGG + Intergenic
972370586 4:38419594-38419616 CACACACAGCACAAGGACCCTGG + Intergenic
972479607 4:39485291-39485313 CACTGTCAGCGAAGGGACACTGG - Intergenic
973878101 4:55241576-55241598 CCCTCTGAGCACAGGGCCTGCGG - Intergenic
974594928 4:64002157-64002179 CACTCTGAGCACATGTTCTCAGG - Intergenic
975489761 4:74975879-74975901 CACCTTCAGCACAGGTATTCAGG + Intronic
975738137 4:77401614-77401636 CTCCCTCACCACTGGGACTCAGG - Intronic
976838423 4:89402768-89402790 CACTCTCAGCACATGGCTTTGGG + Intergenic
976917628 4:90397587-90397609 CACTGTCATCACAGGGGCTATGG - Intronic
978654737 4:111052011-111052033 CACACACAGCACAGGGACCCTGG - Intergenic
982732825 4:158974572-158974594 CATTCTCAGCAAAGTAACTCAGG - Intronic
984929912 4:184837821-184837843 CACTCTCCGTACAGGGACCAAGG - Intergenic
985038615 4:185866205-185866227 TAATCTCAGCACTGGTACTCAGG - Intronic
986670527 5:10139357-10139379 CACTAGCAGCCCAGGGACTCGGG - Intergenic
986725040 5:10589112-10589134 GAGACTCAGCACAGGAACTCGGG - Intronic
987283439 5:16434610-16434632 CACTCTCAGGACAGGTTCCCAGG + Intergenic
987344038 5:16963196-16963218 CATTTTCAGCACAGGTACTGTGG - Intergenic
988668962 5:33360506-33360528 CACACACAGCACAGGAACCCTGG + Intergenic
989362736 5:40622412-40622434 CACTCTCATCACAGGACCTGTGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994305222 5:98195080-98195102 CTCTCTAAGCACTGGGTCTCTGG - Intergenic
995790092 5:115877466-115877488 CACTCTCAGCAAACGAACACGGG - Intronic
997056699 5:130452302-130452324 CACACACAGCACAGGGTCTCTGG + Intergenic
997255921 5:132427888-132427910 CACTCTCAGCATAGGGATATGGG + Intronic
998087013 5:139334737-139334759 CACACCCAGCACAGTGGCTCAGG + Intergenic
998566435 5:143220043-143220065 CACCCACAGCACAGGTACTGGGG - Intronic
999473664 5:151878599-151878621 CGCACACAGCACAGGGACCCTGG - Intronic
1000729739 5:164818697-164818719 CTCTCTCAGCACTGCGGCTCTGG + Intergenic
1002046605 5:176544902-176544924 CACTCTCAGCCCAGACTCTCCGG + Intronic
1003062459 6:2874435-2874457 CATTCTCAGACCAGGGTCTCTGG + Intergenic
1003543967 6:7042749-7042771 CACTCTAAGGAGAGGGAGTCAGG - Intergenic
1003585791 6:7388134-7388156 CACTCTCAGCTCTGGAGCTCTGG - Intronic
1003600672 6:7514301-7514323 CAGTCTCAGCACAAGGCATCTGG - Intergenic
1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG + Intergenic
1005019327 6:21402430-21402452 CACTCTCACCCCCAGGACTCTGG - Intergenic
1005744709 6:28825606-28825628 AACTCTCAACACAGACACTCAGG - Intergenic
1007513336 6:42391527-42391549 CAGTCTCAGCAGATGGCCTCAGG + Intronic
1007736114 6:43983307-43983329 CACTGTGAGCAGAGGGACTCAGG - Intergenic
1009346071 6:62614166-62614188 TGCACACAGCACAGGGACTCTGG - Intergenic
1009817002 6:68749047-68749069 TACACACAGCACAGGGACCCTGG + Intronic
1010884332 6:81217975-81217997 TACACACAGCACAGGGACCCTGG - Intergenic
1011693972 6:89895476-89895498 CACTGCCAGCCCAGGGACACGGG - Exonic
1014068172 6:117150899-117150921 TACACACAGCACAGGGACCCAGG + Intergenic
1015969646 6:138731000-138731022 TACACACAGCACAGGGACCCGGG + Intergenic
1016355385 6:143212491-143212513 CACTCTTAGAACAGGGTCTAAGG + Intronic
1016882055 6:148921176-148921198 GAAGCTCAGCCCAGGGACTCTGG - Intronic
1017712090 6:157179697-157179719 AAATCTCAGCCCAGTGACTCTGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018224676 6:161616676-161616698 CACTCTCAGCAAACTGACACAGG - Intronic
1019150454 6:170001971-170001993 TGCACACAGCACAGGGACTCTGG + Intergenic
1019187621 6:170230015-170230037 CCCCATCAGCCCAGGGACTCAGG + Intergenic
1019388767 7:773760-773782 CACCCTCGGCCCAGGGCCTCTGG + Intronic
1019389948 7:780715-780737 CACTCACAGCACAGGGCCTGAGG + Intronic
1019671043 7:2278526-2278548 CTAGCTCAGCACATGGACTCTGG + Intronic
1021926317 7:25537756-25537778 CACTCACAGCTCAGTGACTGTGG + Intergenic
1022390626 7:29940866-29940888 CACTCTCTGCAGAGGGAGTGAGG - Exonic
1024212005 7:47214124-47214146 TCCTCTTAGCACAGGGACTATGG - Intergenic
1025247923 7:57331496-57331518 CACTCTGAGGACAGGGACTTGGG + Intergenic
1027946289 7:84749372-84749394 CTTTCACAACACAGGGACTCAGG + Intergenic
1031630024 7:124033590-124033612 CCCACTCAACACAGGGGCTCCGG + Intergenic
1034266218 7:149782278-149782300 CACATCCAGCTCAGGGACTCAGG + Intergenic
1034479559 7:151308983-151309005 TCCTCTCAGCACATGGACACGGG - Intergenic
1035737775 8:1901231-1901253 TACACTCAGCACACGGACTACGG - Intronic
1036500716 8:9311462-9311484 CCTTCTCTGCAAAGGGACTCAGG + Intergenic
1036587300 8:10136169-10136191 CACGCTGGGCACAGGGACCCCGG + Intronic
1037048794 8:14342933-14342955 CACACACAGCCCAGGGACCCTGG - Intronic
1037915697 8:22771907-22771929 TACTCTCAGCACAGTGCCTATGG + Intronic
1039121913 8:34157326-34157348 CACACACAGCACAGGGATCCAGG - Intergenic
1040275249 8:46010525-46010547 CAGTCTCTGCACAGGGTCTAGGG - Intergenic
1041216968 8:55610518-55610540 TGCTCTCAGCACAGGGCCTAGGG - Intergenic
1041479819 8:58307408-58307430 TGCACACAGCACAGGGACTCTGG + Intergenic
1042048168 8:64678142-64678164 CACTCTCAGTATAGGGACTATGG + Intronic
1045727885 8:105196697-105196719 CAGTCTCAGCACATGCATTCTGG + Intronic
1045732288 8:105256123-105256145 GACACACAGCACAGGGACCCTGG + Intronic
1048404552 8:134106704-134106726 CACACACAGCATAGGGACCCTGG - Intergenic
1048925093 8:139264445-139264467 CACCCTCAGGACAGGGACAGTGG + Intergenic
1049246954 8:141567917-141567939 CACATTCAGCCCAGGGAGTCAGG - Intergenic
1049403430 8:142440967-142440989 CACGCTCAGCACAGAGTCCCCGG - Intergenic
1049579014 8:143402495-143402517 CACTCTCACCACACGGGGTCTGG - Intergenic
1050090691 9:2015127-2015149 CTCGCTCAGCTCAGCGACTCCGG - Intergenic
1050989228 9:12126527-12126549 CACTCTAATCCCAGGTACTCGGG - Intergenic
1051588644 9:18753243-18753265 CATTCTCTGCACAGGTACTAAGG + Intronic
1052007068 9:23361308-23361330 TACACACAGCACAGGGACCCAGG + Intergenic
1054929627 9:70622503-70622525 CACCATCAGCACAGGCCCTCTGG - Intronic
1055363945 9:75524663-75524685 TGCACTCAGCACAGGGACCCTGG - Intergenic
1055430446 9:76238132-76238154 CACACTCAGCACAAAAACTCCGG + Intronic
1056378785 9:86038576-86038598 CATTCACAGCCAAGGGACTCAGG + Intronic
1056464613 9:86841567-86841589 CAAGCTCAGAAGAGGGACTCAGG + Intergenic
1057799774 9:98183437-98183459 CACTCACAGCATAAGGACTTTGG - Intronic
1059941293 9:119362273-119362295 CAATAAGAGCACAGGGACTCAGG - Intronic
1059955906 9:119515742-119515764 CACCCTCAGCACAGGGCTTGTGG + Intronic
1060588171 9:124799674-124799696 CACAGTCAGCACAGGGAATGGGG + Intronic
1062154854 9:135041503-135041525 CATTCTCAGCACAGAGACTATGG - Intergenic
1186589890 X:10918828-10918850 CACTCTCAACTCAGAAACTCTGG + Intergenic
1186796363 X:13050409-13050431 GACTCTCAGCTCAGGGACATGGG + Intergenic
1187871947 X:23771824-23771846 TAGTCTCAGCCCAGGTACTCAGG + Intergenic
1188122164 X:26320560-26320582 CACTGTCAGTATAGGGAATCTGG - Intergenic
1190043666 X:47094020-47094042 CAGTCTCAGCCCAGCTACTCGGG - Intergenic
1190249123 X:48708809-48708831 CACTCTGGGCACAGGTAGTCAGG - Exonic
1190734417 X:53246442-53246464 CTCTCTCAGAACAGGGAGTATGG + Intronic
1193793761 X:85848020-85848042 CACTCTCAGCAAACTGACACAGG + Intergenic
1193918725 X:87400023-87400045 TACACACAGCACAGGGACCCTGG - Intergenic
1194335399 X:92640433-92640455 TGCACACAGCACAGGGACTCTGG - Intergenic
1197975638 X:132163267-132163289 CACACACAGCTGAGGGACTCTGG - Intergenic
1199686920 X:150273250-150273272 CACTCTCATCACAGGCCCTAAGG + Intergenic
1200045892 X:153400937-153400959 CCCTCTCCGCCCAGGGACCCAGG + Intergenic
1200073515 X:153540323-153540345 CTCCCTCAGCACCGTGACTCCGG + Intronic
1200643870 Y:5757467-5757489 TGCACACAGCACAGGGACTCTGG - Intergenic