ID: 1161571730

View in Genome Browser
Species Human (GRCh38)
Location 19:5034566-5034588
Sequence AAGGCTATACAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 258}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161571722_1161571730 28 Left 1161571722 19:5034515-5034537 CCCCCAACCACTTAAAAATGAAA 0: 1
1: 0
2: 10
3: 76
4: 605
Right 1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 258
1161571728_1161571730 -10 Left 1161571728 19:5034553-5034575 CCTTCATAACTCAAAGGCTATAC 0: 1
1: 1
2: 2
3: 7
4: 102
Right 1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 258
1161571725_1161571730 25 Left 1161571725 19:5034518-5034540 CCAACCACTTAAAAATGAAAACA 0: 1
1: 3
2: 14
3: 155
4: 1241
Right 1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 258
1161571724_1161571730 26 Left 1161571724 19:5034517-5034539 CCCAACCACTTAAAAATGAAAAC 0: 1
1: 2
2: 9
3: 88
4: 676
Right 1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 258
1161571726_1161571730 21 Left 1161571726 19:5034522-5034544 CCACTTAAAAATGAAAACAAACA 0: 1
1: 2
2: 23
3: 373
4: 3357
Right 1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 258
1161571723_1161571730 27 Left 1161571723 19:5034516-5034538 CCCCAACCACTTAAAAATGAAAA 0: 1
1: 2
2: 19
3: 127
4: 946
Right 1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161571730 Original CRISPR AAGGCTATACAGAAGCAGGA AGG Intronic
900254492 1:1690906-1690928 AAGGCAAATAAGAAGCAGGAAGG + Intronic
900263243 1:1744181-1744203 AAGGCAAATAAGAAGCAGGAAGG + Intronic
900409776 1:2507344-2507366 AAGGCTACAGAGATGCAGGCTGG + Intergenic
900439379 1:2645747-2645769 AATGCTAACCAGAATCAGGAGGG - Intronic
900822033 1:4897200-4897222 CTGGCTTCACAGAAGCAGGAGGG + Intergenic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
903089258 1:20895625-20895647 AAGGCTATAATGAAGCTGAAAGG + Intronic
903473629 1:23604796-23604818 GAGGTCATACTGAAGCAGGATGG + Intronic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
905019784 1:34801071-34801093 AAGGCTCTGAAGAAGGAGGAAGG + Intronic
905082663 1:35338112-35338134 TGGGCTATACAGAAACAGAAGGG + Intronic
908832627 1:68194312-68194334 AAGGCGATACAAAAGCTGGAGGG - Intronic
912873697 1:113333035-113333057 AGGGCTATAAAGAAGCAGGTAGG - Intergenic
913117977 1:115713969-115713991 AGGGCAATAGAGAGGCAGGAAGG + Intronic
916078591 1:161218025-161218047 AATTCCATACAGAAACAGGATGG - Exonic
917315930 1:173725724-173725746 GAGGCTTTAGAGAAGCATGATGG - Intronic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
918626465 1:186661122-186661144 AGGGTTAAACAGCAGCAGGAAGG - Intergenic
920229506 1:204461222-204461244 AAGGTTATTCACAAGCAGGCAGG - Intronic
920238083 1:204522804-204522826 AAGCCTTTTCAGAAGCATGAGGG + Intronic
921560989 1:216658037-216658059 AAGGATATTCACAAGCAGGCAGG + Intronic
922300688 1:224297280-224297302 AAGGCTACACTGAATAAGGAAGG + Intronic
922378584 1:224996828-224996850 AAGGCCCTGCATAAGCAGGAAGG - Intronic
922484033 1:225959402-225959424 AAGGCCACTCAGAAGCAGGAAGG - Intergenic
922586879 1:226740063-226740085 AAGGGTCTACAGGAGCAAGAGGG - Intergenic
923166556 1:231369437-231369459 AAATCTTTACAGAAGCAGCAGGG + Intronic
923383193 1:233442017-233442039 AATACCATACAGAAGCTGGAAGG + Intergenic
924418867 1:243888196-243888218 AAGGCTTTCCAAAAGCATGAGGG - Intergenic
1063046518 10:2398087-2398109 AAGCTACTACAGAAGCAGGAAGG + Intergenic
1064036967 10:11921963-11921985 AAGGCCATACTGGAGCAGGGTGG + Intronic
1064206031 10:13324567-13324589 AAGGATGTAGAGAAACAGGAAGG - Intronic
1065064789 10:21950226-21950248 AATGTGATACAGAAACAGGAAGG - Intronic
1066398291 10:35048660-35048682 AAGGCAATACTGAAGCAGTAGGG - Intronic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068929898 10:62578861-62578883 AAGAATATGCAGGAGCAGGATGG + Intronic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1069967777 10:72135699-72135721 GAGGCAGGACAGAAGCAGGAAGG + Intronic
1070183495 10:74037401-74037423 AAAGATCTACAGAAGCAGAAAGG - Intronic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1073358838 10:102880078-102880100 AGGGCTATAGAGAAGTAGGATGG + Intronic
1073694895 10:105853783-105853805 AAGGCTTTAGAGAAGAAGTAGGG + Intergenic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1076475300 10:130747599-130747621 AAGGCTAGGAAGAAACAGGAAGG - Intergenic
1078143805 11:8709678-8709700 AAGGTCATACAGAACCAGAAGGG - Intronic
1078197499 11:9148353-9148375 AAGGCTATTCAAATGAAGGAAGG + Intronic
1078839857 11:15068536-15068558 AAGGGTACAGAGAAGCAGGCTGG + Intronic
1079066178 11:17295337-17295359 AAAGCAATACTGTAGCAGGATGG - Exonic
1079471345 11:20781062-20781084 AAGGCAGTATGGAAGCAGGAAGG + Intronic
1080210629 11:29781110-29781132 AAGGGGCTACAGAAACAGGAAGG + Intergenic
1081167340 11:39822305-39822327 AAAACTATACTGAGGCAGGAAGG - Intergenic
1081305396 11:41505535-41505557 GAAGCTACACAGAAACAGGAAGG - Intergenic
1082896938 11:58201774-58201796 TAGCCCATACAGAAGCAGGTGGG + Intergenic
1084413714 11:69018289-69018311 AAGGCGGGACAGAAGCAGGCGGG - Intergenic
1084465323 11:69319973-69319995 AAGGCTACAGAGGGGCAGGAAGG + Intronic
1087294227 11:96350998-96351020 AGGGCTATACAGAAGCTTTAGGG - Intergenic
1088168842 11:106971566-106971588 AAGGATATAGACAAGCAAGAGGG + Intronic
1088851748 11:113708963-113708985 AAGGCTCTGCACAAGCAGGAAGG + Intergenic
1089688633 11:120172484-120172506 CAGGCCACACAGGAGCAGGAGGG - Intronic
1090854600 11:130600657-130600679 AAGGCGAAAGAGAAGCAGGCAGG + Intergenic
1091294148 11:134460912-134460934 AAGGCCTTCCAGAAGCACGAAGG + Intergenic
1091628595 12:2141253-2141275 AAGGCTCCAGAGGAGCAGGAAGG + Intronic
1091906172 12:4190875-4190897 AAGGCCATACTGCAGTAGGATGG - Intergenic
1092489822 12:8935063-8935085 AAAGCTATAGAGAAGCAGAAGGG + Intronic
1092554719 12:9545153-9545175 AAGGGTATAGACAAACAGGACGG - Intergenic
1095351559 12:41220099-41220121 AAGACTTTACAGAGGCAGGTGGG - Intronic
1095528586 12:43157845-43157867 CAGGCTGTACAGAACCATGATGG + Intergenic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1099474587 12:83092856-83092878 AAAGCTGAACAAAAGCAGGAAGG + Intronic
1102121986 12:110449076-110449098 AATGCTATAAAGAAGCTAGATGG - Intronic
1102217815 12:111174043-111174065 AATGCTGTAGAGAAGCAGGCAGG + Intronic
1103017499 12:117507244-117507266 AAGGCCATTCAGCACCAGGATGG + Intronic
1103041602 12:117700277-117700299 AAGGCTATACAGCTACAGGGTGG + Intronic
1103041641 12:117700644-117700666 AAGCACATACAGAGGCAGGAAGG - Intronic
1105567874 13:21569283-21569305 TAGACTATAGAGTAGCAGGAAGG - Intronic
1105583691 13:21724278-21724300 AAGCCGATACAGCAGCAGAAGGG - Intergenic
1106685867 13:32057998-32058020 CAGGCCACACAGAAGCAGAAAGG + Intronic
1108565203 13:51689963-51689985 AATTGTATGCAGAAGCAGGATGG + Intronic
1110212873 13:72993525-72993547 AAGGAAATAAAGAATCAGGATGG + Intronic
1112146379 13:96705036-96705058 GAGGCTATACATACACAGGAGGG - Intronic
1112150259 13:96752017-96752039 AAGGATATACAGGAGCACGTGGG - Intronic
1112828205 13:103416862-103416884 AAAGCTAAACAGAACCAGAAGGG - Intergenic
1113074982 13:106459415-106459437 AAGGTTTTGCAGAAGCAAGACGG + Intergenic
1113270287 13:108666029-108666051 AAGGCTTTTCAGAAGCAGGAAGG + Exonic
1114467938 14:22937836-22937858 AAGCCTATAGAGAAGGAGGGAGG - Intergenic
1114782041 14:25548646-25548668 AAGGGTATAGGAAAGCAGGATGG + Intergenic
1115680000 14:35727776-35727798 AAGGATATGTAGAAACAGGAAGG + Intronic
1115931832 14:38505892-38505914 AAGGTTAGACAAAAGCATGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118906420 14:70027042-70027064 AAGCCTATGCAGAGGCAGAAAGG + Intronic
1119065871 14:71525917-71525939 AACGCAATACAGAGGGAGGAAGG - Intronic
1119662138 14:76459742-76459764 AGGGCTAGACAAAAGCAGGTAGG + Intronic
1120091742 14:80340389-80340411 AAGGGTATACAGCTGTAGGAGGG - Intronic
1120843677 14:89108238-89108260 AAGAGGATAGAGAAGCAGGAAGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122721709 14:103725972-103725994 AAAGGTAGACAGAAACAGGAAGG - Intronic
1124244551 15:28058203-28058225 AAGGCAAAACTGCAGCAGGAGGG + Intronic
1124421101 15:29523099-29523121 GAGGCTTTGCACAAGCAGGAAGG + Intronic
1124495800 15:30186097-30186119 GTGGCTATACTGCAGCAGGAAGG - Intergenic
1124495986 15:30187425-30187447 GTGGCTATACTGCAGCAGGAAGG - Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124616241 15:31244472-31244494 AGGGCTCTCCAGGAGCAGGAGGG - Intergenic
1124720039 15:32104016-32104038 GAGGCAACACTGAAGCAGGAAGG - Intronic
1124747588 15:32351222-32351244 GTGGCTATACTGCAGCAGGAAGG + Intergenic
1124747773 15:32352549-32352571 GTGGCTATACTGCAGCAGGAAGG + Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124862378 15:33454852-33454874 AAGGCTATAGAGAAGAGGGCAGG + Intronic
1126018031 15:44372299-44372321 ATGGCTATAGAGAAGGAGTATGG - Intronic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1131303650 15:91222029-91222051 AAGGCTATGCAGAGGCATGGAGG - Intronic
1137518897 16:49174916-49174938 TAGGCTATACAAAAACAGGAAGG + Intergenic
1138444407 16:57054627-57054649 AAGGCAATAGGGAAGCAGGCAGG - Intronic
1139252778 16:65512025-65512047 AGGGTTATTCAGAAGCAGAAAGG - Intergenic
1140653578 16:77115900-77115922 CAGGCTGTACAGAATTAGGAAGG - Intergenic
1140873019 16:79124090-79124112 AAGGCTATAGTTAATCAGGAGGG - Intronic
1141271007 16:82541289-82541311 TAGGCTAGACAGAGCCAGGAAGG + Intergenic
1142050483 16:87954891-87954913 AAGGCCACAAGGAAGCAGGAAGG - Intronic
1142368160 16:89661580-89661602 AAGCATATACAGAAGTAGTAGGG - Intronic
1142749822 17:1980534-1980556 AACGCTATAAAGAAGTGGGAGGG - Intronic
1145245831 17:21268751-21268773 AAACCTATACAGAGGCTGGAGGG - Intergenic
1146367331 17:32239022-32239044 AAGCCTACATTGAAGCAGGAGGG - Intronic
1146951865 17:36912556-36912578 AAGGCCACACAGATGAAGGAGGG - Intergenic
1151073296 17:71242242-71242264 ATGGCTTTCCTGAAGCAGGATGG - Intergenic
1151924383 17:77183798-77183820 AAAGATAAACAGAAGCAGCAAGG - Intronic
1157419156 18:47531056-47531078 AGGGGTATAGGGAAGCAGGATGG - Intergenic
1159135830 18:64335757-64335779 AAGGCTAAAAATAAACAGGATGG + Intergenic
1160982017 19:1820546-1820568 AAGGCAAGACAGGAGCAGCAGGG + Intronic
1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG + Intronic
1164409824 19:27992534-27992556 AAGACATTACAGAAGCATGAGGG - Intergenic
1166295421 19:41887148-41887170 ACGGAGCTACAGAAGCAGGAAGG + Intronic
1166546660 19:43638459-43638481 GTGGCTAGGCAGAAGCAGGAGGG - Intronic
927099033 2:19773222-19773244 AATGCTAAACAGAAGAAAGATGG + Intergenic
928010145 2:27599815-27599837 AAGGGTATAATGAGGCAGGATGG - Intronic
928342262 2:30454842-30454864 AAGGCAGTGGAGAAGCAGGATGG + Intronic
930465423 2:51742111-51742133 AAGTCTGTACACAAGAAGGAAGG - Intergenic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
931460808 2:62448616-62448638 AAGGCTAAACCCATGCAGGATGG + Intergenic
931892731 2:66692375-66692397 AAGGACATACAGAAGCGGGCAGG + Intergenic
932688953 2:73896385-73896407 TAGGCCATACAGAAACAGGCCGG + Intronic
933168643 2:79100470-79100492 ATAGCTAAACATAAGCAGGAGGG - Intergenic
934761708 2:96860240-96860262 AAGACTTGACAGAAACAGGAAGG + Exonic
935013515 2:99157722-99157744 ACGGACATACAGAAGAAGGAGGG - Intronic
935360228 2:102240193-102240215 GAGGCTATAGAGAAACATGAGGG + Intergenic
935827593 2:106966990-106967012 AGGCCTAGACAGAAGCAGGGTGG + Intergenic
937859950 2:126699853-126699875 AAGGCTTTAGAGAAGAAGGGAGG + Intergenic
938733301 2:134163248-134163270 AAGGCCCTCCAGAATCAGGAAGG - Intronic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
941581058 2:167294971-167294993 AATGCTATAGAAAATCAGGAGGG + Intergenic
941977299 2:171419421-171419443 AAGGCTATAGACAAGCAAGAAGG - Intronic
942677649 2:178445659-178445681 CAGGCTATACAGAAACAGCATGG + Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946409787 2:219510247-219510269 AAGGCGGCACAGCAGCAGGAGGG - Intergenic
948403432 2:237700938-237700960 AATTCTACACAGAAGCTGGAAGG - Intronic
948428959 2:237906439-237906461 GAGGCTATACAGAAAAAGTAGGG - Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170219840 20:13930182-13930204 AAATCTCTTCAGAAGCAGGAAGG - Intronic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1173190305 20:40870890-40870912 GAGGTTATACAGAAGTAGGTTGG - Intergenic
1175152207 20:56943907-56943929 AGGGCTATGCAGAACCATGAAGG - Intergenic
1175524558 20:59624551-59624573 CAGGCTACACAGGAGCAGCATGG - Intronic
1177180696 21:17741862-17741884 ACAGCCATACAGAAACAGGATGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179638904 21:42734021-42734043 AAGGCAACGGAGAAGCAGGAGGG - Intronic
1181333170 22:22110300-22110322 ATAGCTAGACAGAAGCAGGAGGG - Intergenic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1182869346 22:33632589-33632611 GAGGCAACACAGAGGCAGGAAGG - Intronic
1183097321 22:35560849-35560871 AAGGCTAACCAGAAGAATGAGGG + Intergenic
949238972 3:1846837-1846859 AAGGCTATAGAGAAGCAAAGGGG + Intergenic
949610140 3:5695896-5695918 AAGGACTTACAGAACCAGGAAGG - Intergenic
950398797 3:12754346-12754368 ATGGCTGTACAGAAAGAGGATGG + Intronic
952006519 3:28847757-28847779 AAGCATATACAGAAGTAGGTTGG - Intergenic
952814239 3:37433053-37433075 AATTATATACAGAAGAAGGATGG + Intronic
953988295 3:47462867-47462889 AAGCCTATGGGGAAGCAGGAAGG - Intronic
955358346 3:58250547-58250569 TAGCCTTTACAGAAACAGGAGGG + Intronic
955421803 3:58745758-58745780 AAGGCTTCATAGAGGCAGGAAGG + Intronic
955512722 3:59697582-59697604 AAAGCTATACAGTGGCAGAATGG - Intergenic
957230629 3:77509740-77509762 AAGGCTGTACACGTGCAGGAAGG - Intronic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
959570781 3:107881018-107881040 AAGGCTATATAGAATCAATATGG + Intergenic
960252573 3:115472667-115472689 AAGGTCATACAGGTGCAGGATGG - Intergenic
960414522 3:117368289-117368311 AGGGCTCCACAGAAGTAGGATGG + Intergenic
963353155 3:144177174-144177196 AAGAATATAAAGAAACAGGAAGG - Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964848712 3:161070771-161070793 AAAACTCTACAGCAGCAGGAGGG - Exonic
965680935 3:171250538-171250560 ATGGCTTTAGAGAAGTAGGATGG - Intronic
966974910 3:185074877-185074899 AAGGCCACACAGTACCAGGAGGG - Intergenic
969447468 4:7253458-7253480 AAGGCACTACAGAAGAGGGATGG + Intronic
970939685 4:21616796-21616818 GAGGCCATACTGAAGTAGGATGG - Intronic
972745646 4:41930033-41930055 ATGACTATACAGGAGAAGGATGG - Intergenic
972826142 4:42761361-42761383 TAGGCAAAATAGAAGCAGGAAGG - Intergenic
975170399 4:71226021-71226043 AAACCTATAAAGAAGCTGGATGG - Intronic
975869971 4:78769314-78769336 AGGGCTATAAAGAAGAGGGAGGG + Intergenic
975912202 4:79280223-79280245 AAGGCTTTAAAGAGGCAGTAAGG + Intronic
976498069 4:85753698-85753720 ATTGCTATACAGAAGAATGACGG - Intronic
978829250 4:113063886-113063908 AATGAAATAAAGAAGCAGGAAGG - Intronic
979278567 4:118839455-118839477 AAGGCTGTACAAAAACAGGTGGG - Intergenic
980101937 4:128550564-128550586 AAGGCTTTACAGAAGCAGCAGGG + Intergenic
980674216 4:136053539-136053561 TAGGATATACAGAAGTAGGTGGG + Intergenic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
987287343 5:16469798-16469820 CAGGCTGTACAGAAGCATGGTGG - Intergenic
989256233 5:39368538-39368560 AAGGCTACACAGAAGAGGCAGGG + Intronic
989693472 5:44171734-44171756 AAGGGCATTCAGGAGCAGGAGGG - Intergenic
990954384 5:61329215-61329237 AAGGCTATACAGACACACCAGGG + Intergenic
992123509 5:73618053-73618075 AAGGCTTTACAAAGGCAGAAAGG - Intergenic
994678296 5:102853101-102853123 AAAACTATACAGAAGCAGTCTGG - Intronic
995840501 5:116439189-116439211 AGGGCTCTGCAGACGCAGGAAGG + Intergenic
995862289 5:116653656-116653678 AAGACTATAGAAAAGCTGGAAGG + Intergenic
997715901 5:136042597-136042619 AAGGTTAGAAAGAAACAGGATGG + Intronic
998606846 5:143644209-143644231 AAGCCTATAGAGAAGCAGTTTGG - Intergenic
998916778 5:147021591-147021613 AAGGCTATACCTTAGCAGCAGGG + Intronic
999536902 5:152527531-152527553 AAGGCAATGCTGAAACAGGAAGG - Intergenic
1001461820 5:171922521-171922543 AAGGCAATTCAGAAGGAAGAAGG + Intronic
1001793741 5:174483986-174484008 AAAGCTATAAAGAAACAGGATGG - Intergenic
1001801293 5:174546466-174546488 AAGGCTAGACAGAAACAAGAAGG + Intergenic
1003112309 6:3260244-3260266 AAGGTTATACTGGAGTAGGATGG - Intronic
1003192467 6:3886649-3886671 AAGGCCCTGCAGAAACAGGACGG + Intergenic
1003770750 6:9296970-9296992 AAGGCCCGACAGAACCAGGAAGG - Intergenic
1004812718 6:19277252-19277274 AAGTCCTTACAGAATCAGGAAGG + Intergenic
1007595011 6:43045915-43045937 AGGGCCAGATAGAAGCAGGAGGG + Intronic
1007655080 6:43446823-43446845 AAAGCAACAGAGAAGCAGGAGGG - Intronic
1007848767 6:44783146-44783168 AAGGCTTGACTGAAGCTGGATGG - Intergenic
1009023516 6:57970685-57970707 AATTCTATACAGAAGGAGGGTGG + Intergenic
1009199088 6:60722250-60722272 AATTCTATACAGAAGGAGGGTGG + Intergenic
1012221231 6:96651832-96651854 AAGCTTATACAGAAGAAGAAGGG - Intergenic
1013036757 6:106392483-106392505 AAGGCAAAAGAGAATCAGGAAGG + Intergenic
1013969487 6:115999817-115999839 AAGGCTATACAGGAGAAAAATGG - Intronic
1013977649 6:116095354-116095376 AAGTATTTACAGAATCAGGAAGG + Intergenic
1015031587 6:128601995-128602017 AAGCCTATGCAAAAGAAGGAAGG - Intergenic
1019136404 6:169911406-169911428 AAGGCTGTGGAGAAGCAGGGTGG + Intergenic
1020655581 7:10924808-10924830 AAGTATTTACAGAACCAGGAAGG + Intergenic
1021356119 7:19654968-19654990 AAGTATGTACAGAATCAGGAAGG - Intergenic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023588251 7:41753437-41753459 AGAGCAATAAAGAAGCAGGAGGG + Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1028967422 7:96817666-96817688 AAGGCAATACAGAAAAAGGAAGG + Intergenic
1033613874 7:142992517-142992539 ATGGCAATATAGAAGCAAGATGG + Intergenic
1034015882 7:147586033-147586055 AAGGTGAAACTGAAGCAGGAAGG + Intronic
1034142714 7:148837157-148837179 AAGATTATTCAGAGGCAGGACGG - Intronic
1035969362 8:4229735-4229757 TATGCTATGTAGAAGCAGGACGG - Intronic
1038670735 8:29580965-29580987 ATGGCTATTCAGAAAAAGGAAGG - Intergenic
1039995073 8:42525170-42525192 AAGGAAATACAGAAAAAGGAAGG + Intronic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042525573 8:69761443-69761465 AAGGAAAGACGGAAGCAGGAGGG - Intronic
1044081317 8:87888502-87888524 AAAGCTCTACAGGTGCAGGAAGG + Intergenic
1046942560 8:119944979-119945001 AAGGTGATACAGAAGCAGAGAGG - Intronic
1054979353 9:71186177-71186199 GAGGCCATACTGGAGCAGGATGG - Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055116608 9:72612010-72612032 AAATCCAAACAGAAGCAGGAGGG - Intronic
1055259280 9:74413960-74413982 AAGGCTATAAAATAACAGGAAGG + Intergenic
1056172147 9:83996754-83996776 CAGGCTGTACAGGAGCAGGCTGG + Intronic
1057169088 9:92950114-92950136 AAGGATAAAAAGAAGCAGGTGGG + Intronic
1058191530 9:101922723-101922745 AAGACTATAATGAAGCTGGAGGG - Intergenic
1059263408 9:113002255-113002277 TAGGATATACAGAAGCAATACGG + Intergenic
1059421535 9:114195505-114195527 CAGGCCACACAGGAGCAGGAGGG - Intronic
1203383278 Un_KI270435v1:84059-84081 AAAGCTAGACAGAAGCATTATGG - Intergenic
1186522758 X:10220663-10220685 AACGCCAGACAGAGGCAGGAGGG + Exonic
1186657632 X:11632376-11632398 AAGGCTTTCTAGCAGCAGGATGG - Intronic
1188107861 X:26164862-26164884 AAGGCTGTACATAAGCAGACAGG + Intergenic
1188111258 X:26198114-26198136 AAGGCTGTACATAAGCAGACAGG + Intergenic
1188776718 X:34229241-34229263 AGGGCTAGAGAGAAGCAGGCTGG - Intergenic
1192272981 X:69600990-69601012 TAGTCTCTACAGAAGTAGGAGGG + Intergenic
1192801179 X:74466057-74466079 AAGCCTAGAAAGAAGCAGGCAGG + Intronic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193745551 X:85275339-85275361 AAGGCTTTAGAGAAGCTGCAGGG + Intergenic
1194934577 X:99932660-99932682 AAGGCAAGACAGAAGAAAGAAGG - Intergenic
1197465616 X:126801337-126801359 AAGTCTATATAGAAGCATAAAGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1201453283 Y:14140168-14140190 AAGGCTTTCCTGAAGAAGGATGG + Intergenic
1202074411 Y:21023966-21023988 AAGTACATACAGAATCAGGAAGG - Intergenic
1202337491 Y:23826923-23826945 AAGATTCTACAGGAGCAGGAGGG - Intergenic
1202533275 Y:25843148-25843170 AAGATTCTACAGGAGCAGGAGGG + Intergenic