ID: 1161573548

View in Genome Browser
Species Human (GRCh38)
Location 19:5043331-5043353
Sequence TTATCCTGCGCAGCATTTAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161573538_1161573548 20 Left 1161573538 19:5043288-5043310 CCACCTTATCCCGTGCTGTGTTT No data
Right 1161573548 19:5043331-5043353 TTATCCTGCGCAGCATTTATCGG 0: 1
1: 0
2: 1
3: 6
4: 100
1161573541_1161573548 11 Left 1161573541 19:5043297-5043319 CCCGTGCTGTGTTTATCGGAGTG 0: 4
1: 1
2: 1
3: 28
4: 129
Right 1161573548 19:5043331-5043353 TTATCCTGCGCAGCATTTATCGG 0: 1
1: 0
2: 1
3: 6
4: 100
1161573542_1161573548 10 Left 1161573542 19:5043298-5043320 CCGTGCTGTGTTTATCGGAGTGG 0: 4
1: 1
2: 7
3: 18
4: 92
Right 1161573548 19:5043331-5043353 TTATCCTGCGCAGCATTTATCGG 0: 1
1: 0
2: 1
3: 6
4: 100
1161573539_1161573548 17 Left 1161573539 19:5043291-5043313 CCTTATCCCGTGCTGTGTTTATC No data
Right 1161573548 19:5043331-5043353 TTATCCTGCGCAGCATTTATCGG 0: 1
1: 0
2: 1
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161573548 Original CRISPR TTATCCTGCGCAGCATTTAT CGG Intronic
903330011 1:22592533-22592555 GAATCCTCAGCAGCATTTATTGG + Intronic
904270553 1:29347232-29347254 TTATCATGTGTAGCATTTACAGG - Intergenic
904951448 1:34243192-34243214 TTATCCTGTTCCGAATTTATGGG + Intergenic
908824000 1:68116111-68116133 TTCTCCAGCTCAGCATTAATGGG - Intronic
908883326 1:68758617-68758639 TTTTCCTGAGCAGAATTCATGGG + Intergenic
912483594 1:110005578-110005600 TTATCCTGATCACCATTTCTTGG + Intronic
912589146 1:110797079-110797101 TTATCCAGTCTAGCATTTATGGG - Intergenic
919361881 1:196607067-196607089 TTATCTTGAGCATCAATTATGGG - Intronic
1064172231 10:13043740-13043762 TTATCCAGTACAGCATTGATGGG + Intronic
1066082693 10:31947774-31947796 TCATCCTGCTCAGCCATTATGGG + Intergenic
1066497573 10:35957030-35957052 TTATCCAGTCCACCATTTATGGG + Intergenic
1068875786 10:61995281-61995303 ATATCTTACACAGCATTTATTGG + Intronic
1069398954 10:68021094-68021116 TTATCCTGCGTAGAATTCATTGG - Intronic
1070406193 10:76099049-76099071 TTATCCTGAGGAGCAATTTTGGG + Intronic
1079555596 11:21754658-21754680 TTATCCAGTGCATCATTGATGGG + Intergenic
1084772827 11:71355153-71355175 TCATCCTGATCACCATTTATGGG + Intergenic
1087108983 11:94442210-94442232 TTAGCCTGCTTAGCAATTATTGG - Intronic
1087999863 11:104864751-104864773 TTATCCAGCGTACCATTGATGGG + Intergenic
1089359964 11:117879179-117879201 TTATCCTGGGAAGCACTGATGGG + Intergenic
1092187629 12:6493013-6493035 TTATACTACGAAGCAGTTATCGG + Intronic
1093288403 12:17294925-17294947 TTATTCTGTTCAGCATTTGTGGG + Intergenic
1098801938 12:74971590-74971612 TTATCCTGCCCACCACTGATAGG - Intergenic
1099895472 12:88641163-88641185 TTTTCCTGCCTAGCATCTATTGG - Intergenic
1102906315 12:116678116-116678138 TTATCCAGCCCACCATTGATGGG + Intergenic
1105036451 12:132927002-132927024 TTCTCCTGTGCCACATTTATGGG + Exonic
1107690010 13:42944275-42944297 TTATCCAGCCCAACATTGATGGG - Intronic
1107774651 13:43825157-43825179 TTATCCAGTCCACCATTTATAGG - Intronic
1109580099 13:64319209-64319231 TTATCCAGTGCAGCATTGATGGG + Intergenic
1114873088 14:26681518-26681540 TTATCCAGCCTATCATTTATAGG + Intergenic
1114962212 14:27907584-27907606 TTATCCTTTGCAGCATTTATAGG - Intergenic
1115042557 14:28948978-28949000 TTATCCAGCGTATCATTGATGGG + Intergenic
1116926334 14:50641964-50641986 TTATCCAGCCCACCATTGATGGG - Intronic
1126489732 15:49223774-49223796 TTATCCAGCCCACCATTGATGGG + Intronic
1128407029 15:67352784-67352806 TTATCCTGCTTTGTATTTATTGG + Intronic
1139097489 16:63722263-63722285 TTATCCTGCCTATCATTGATGGG + Intergenic
1141311695 16:82919595-82919617 TTATCCAGCTCACCATTGATGGG + Intronic
1148516525 17:48223478-48223500 ATATACTGCGCAGCATATAATGG - Intronic
1156810799 18:41248430-41248452 TTATCCTGCTTGGAATTTATAGG - Intergenic
1161573496 19:5043101-5043123 TTATCCCGCACGGCGTTTATCGG + Intronic
1161573548 19:5043331-5043353 TTATCCTGCGCAGCATTTATCGG + Intronic
1161573575 19:5043447-5043469 TTATCCCGCGCTGTGTTTATCGG + Intronic
1164106798 19:22114272-22114294 TTAACCTGAGCTGAATTTATTGG + Intergenic
1164531646 19:29052964-29052986 TTATCCAGCTCACCATTGATAGG - Intergenic
1167828714 19:51999983-52000005 TTATCCTGTTCACCATTGATGGG - Intronic
925691459 2:6528363-6528385 TTATCCAGTGCATCATTGATGGG - Intergenic
930182474 2:48376142-48376164 AGATCCTGCATAGCATTTATTGG + Exonic
930455275 2:51600400-51600422 TTATCCAGCCTATCATTTATGGG + Intergenic
933358982 2:81253197-81253219 TTATTCTGCCCACCACTTATGGG + Intergenic
940630262 2:156229636-156229658 TTTTCCTGAGCAGAATCTATGGG + Intergenic
942752805 2:179307024-179307046 TTATTCTGCACAGCATTTGTTGG + Intergenic
947508799 2:230731943-230731965 TTATCCTGCACTGATTTTATTGG + Intronic
1169330820 20:4714728-4714750 TTATACTGAGCAGGATTCATAGG - Intergenic
1170402629 20:16004393-16004415 GCATCCTGAGCAGCATATATTGG + Intronic
1174652462 20:52139260-52139282 TTATCCAGCCCACCATTGATGGG - Intronic
1175522677 20:59612075-59612097 TTAGCCAGGGCAGCATATATGGG + Intronic
1177309703 21:19374455-19374477 TTACCCTGATCAGGATTTATAGG + Intergenic
951856171 3:27199714-27199736 TTATCCAGCCTAGAATTTATGGG - Intronic
952132464 3:30381851-30381873 TTATCCAGTGCATCATTGATGGG + Intergenic
956026760 3:64991257-64991279 TTTTCATGCACAGAATTTATTGG - Intergenic
958050620 3:88339801-88339823 TTAACCAGAGCAGCAATTATGGG + Intergenic
960560633 3:119079638-119079660 TTATCCAGCCCACCATTGATGGG - Intronic
968871854 4:3246418-3246440 TCATCCTGCTCAGCATTTCTGGG - Intronic
974761660 4:66284872-66284894 TTATCTTGCCCAGTTTTTATTGG + Intergenic
976334036 4:83864887-83864909 ATATCCTGCGCAGCAGTTTGGGG + Intergenic
978379779 4:108114902-108114924 TTATCCCGAGCAGCACTTATGGG + Intronic
980128748 4:128798862-128798884 TTTTCCTTAGGAGCATTTATGGG + Intergenic
980514071 4:133830919-133830941 TTATCCAGTGCACCATTGATAGG - Intergenic
980637504 4:135527103-135527125 TTATCCAGCCTATCATTTATGGG - Intergenic
980786894 4:137567498-137567520 TTATCCAGTGTATCATTTATGGG + Intergenic
982694476 4:158583825-158583847 TTATCCTGGGCATCCTTTAAAGG - Intronic
992672392 5:79073361-79073383 TATTCCTGTGTAGCATTTATTGG + Intronic
993460544 5:88176312-88176334 TTATCCAGCCTACCATTTATGGG + Intergenic
994687052 5:102968845-102968867 TTATCCAGTGCAGCATTGATGGG - Intronic
996619386 5:125481545-125481567 TTCTCCTGAGTGGCATTTATGGG - Intergenic
996928588 5:128858844-128858866 TTATCCAGTTCAGCATTGATAGG + Intronic
998289132 5:140896128-140896150 TTATCCAGTGCACCATTGATGGG + Intronic
1001356801 5:171034757-171034779 TTTTCCTGCCCAGCATCTTTTGG + Intronic
1003369306 6:5509266-5509288 TTCTCCTGCCCAGCATTCCTTGG + Intronic
1005425740 6:25701037-25701059 TTATCCTTGGCAGCATTTGGTGG + Intronic
1008225204 6:48906303-48906325 TTATCCAGCCCATCATTGATGGG + Intergenic
1011632795 6:89343682-89343704 TTACCATGCGCAGCCTTTAGAGG - Exonic
1012753900 6:103199299-103199321 TTATTCTGTGAAGCATTTCTTGG - Intergenic
1016249951 6:142028782-142028804 TTATCCAGTGCATCATTGATGGG + Intergenic
1022308893 7:29176273-29176295 TTATCCTGCTCAGGACCTATTGG - Intronic
1022527340 7:31046852-31046874 TTATCCTGAGCTGCTTTTCTGGG + Intergenic
1022985792 7:35652175-35652197 TTTTCCTTAGGAGCATTTATAGG - Intronic
1024049170 7:45607828-45607850 TTATCCAGCCCACCATTGATGGG + Intronic
1030430040 7:109433735-109433757 TTATCCAGCCTAGCATTGATGGG + Intergenic
1030530438 7:110705949-110705971 TTATCCTATGCATCATTGATGGG + Intronic
1032457031 7:132080929-132080951 TTCTCCTGGGCTGCATGTATGGG + Intergenic
1032956602 7:136978835-136978857 TTATCCAGTGTAGCATTGATGGG + Intronic
1035655935 8:1304833-1304855 TTATCCTGTGCAGTATTGAAGGG - Intergenic
1039677699 8:39687857-39687879 TTATCCAGCCCACCATTAATGGG + Intronic
1041744181 8:61188946-61188968 TTATCCTGCTTAGGATTTCTTGG - Intronic
1051729073 9:20120311-20120333 TTATCCAGGCCACCATTTATGGG - Intergenic
1052696907 9:31889508-31889530 TTATAGTGCTCAGCATTTACGGG - Intergenic
1054914621 9:70484403-70484425 TTCTCCTGTACATCATTTATGGG + Intergenic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1059321000 9:113469379-113469401 TCATACTCCTCAGCATTTATTGG + Intronic
1060001221 9:119960294-119960316 TTCTCCTGCCCTGCGTTTATGGG - Intergenic
1187933803 X:24316825-24316847 ATATGCTGTGCAGCACTTATGGG - Intergenic
1188605458 X:32023694-32023716 TTATCCTGTCCACCATTAATGGG - Intronic
1191766087 X:64699644-64699666 TTATCCAGCCCATCATTGATGGG + Intergenic
1193364412 X:80614039-80614061 TTATCCAGCTCACCATTGATGGG - Intergenic
1193378030 X:80784771-80784793 TTATCCTGCCTATCATTGATGGG + Intronic
1197000583 X:121434326-121434348 TTATCCTGTCCACCATTGATGGG + Intergenic
1199402338 X:147413090-147413112 TTATCCAGCGTATCATTGATGGG - Intergenic
1202096397 Y:21252754-21252776 TTATTCTGCATTGCATTTATTGG + Intergenic