ID: 1161577278

View in Genome Browser
Species Human (GRCh38)
Location 19:5061258-5061280
Sequence TTCCCTGAGCCGAGGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 237}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161577263_1161577278 30 Left 1161577263 19:5061205-5061227 CCGCTTTGTCGGGCATTCCTGTG No data
Right 1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG 0: 1
1: 1
2: 0
3: 16
4: 237
1161577272_1161577278 -8 Left 1161577272 19:5061243-5061265 CCCAGGCTCCCCATCTTCCCTGA 0: 1
1: 0
2: 2
3: 46
4: 369
Right 1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG 0: 1
1: 1
2: 0
3: 16
4: 237
1161577273_1161577278 -9 Left 1161577273 19:5061244-5061266 CCAGGCTCCCCATCTTCCCTGAG 0: 1
1: 0
2: 2
3: 64
4: 445
Right 1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG 0: 1
1: 1
2: 0
3: 16
4: 237
1161577267_1161577278 13 Left 1161577267 19:5061222-5061244 CCTGTGGGCGGCTCTCCCCATCC 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG 0: 1
1: 1
2: 0
3: 16
4: 237
1161577270_1161577278 -3 Left 1161577270 19:5061238-5061260 CCCATCCCAGGCTCCCCATCTTC 0: 1
1: 1
2: 2
3: 51
4: 441
Right 1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG 0: 1
1: 1
2: 0
3: 16
4: 237
1161577269_1161577278 -2 Left 1161577269 19:5061237-5061259 CCCCATCCCAGGCTCCCCATCTT 0: 1
1: 0
2: 3
3: 48
4: 495
Right 1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG 0: 1
1: 1
2: 0
3: 16
4: 237
1161577271_1161577278 -4 Left 1161577271 19:5061239-5061261 CCATCCCAGGCTCCCCATCTTCC 0: 1
1: 0
2: 9
3: 89
4: 767
Right 1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG 0: 1
1: 1
2: 0
3: 16
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161577278 Original CRISPR TTCCCTGAGCCGAGGCTCCC AGG Intronic
900776792 1:4591688-4591710 TTCCCTGAGCCCAGTCTCGAAGG - Intergenic
901064016 1:6486156-6486178 TCCCCTGGGCTGAGGCTCCGAGG - Intronic
904603125 1:31684388-31684410 GTCACTGAGCGGAGGCTCCTCGG - Intronic
906269478 1:44463854-44463876 CACCCTGAGCCCAGGCTCCAGGG + Intronic
912452744 1:109777248-109777270 CTTCCTGGGCCTAGGCTCCCTGG + Intergenic
912471619 1:109910844-109910866 TTCCCCGGGCCGAGCCTCACTGG - Exonic
914336989 1:146724529-146724551 TTCTCTGAGCAGAGGAACCCAGG - Intergenic
915191801 1:154157144-154157166 TTCCCACAGCGGAGTCTCCCTGG + Intronic
915733324 1:158069111-158069133 TTCCCAGAGCCTGGGCTGCCAGG - Intronic
915789370 1:158651436-158651458 ATCCCTTAGCCGAGGCTCATTGG + Exonic
916268712 1:162918141-162918163 TTCCCTGGGAAGGGGCTCCCAGG - Intergenic
916749906 1:167714404-167714426 TTTCCTCAGCCCGGGCTCCCGGG + Intergenic
920707926 1:208268330-208268352 TTCCATCAGCTGAGGCACCCTGG + Intergenic
921955968 1:220983674-220983696 TTCCCTGATCACATGCTCCCAGG - Intergenic
922222817 1:223621415-223621437 TTCCCTGAGCACCCGCTCCCTGG - Intronic
922675695 1:227547628-227547650 TTCCCTGAGCCCTGTCCCCCTGG - Intergenic
922759198 1:228115373-228115395 TTCCATGATCCGGGGCTGCCGGG + Intergenic
1064602733 10:17009784-17009806 GGCCCTGAGCCCAGGCTTCCTGG + Intronic
1067057774 10:43062255-43062277 ATCCCTGGGCCCAGACTCCCTGG + Intergenic
1067060525 10:43075988-43076010 TGCCCTGGGCCCAGGTTCCCTGG + Intergenic
1067068231 10:43115418-43115440 TTGCCTGAACGGAGGCTCCAGGG - Intronic
1067807722 10:49404652-49404674 CTCCCTGAGCCCAAGCTGCCGGG - Intergenic
1069846717 10:71377262-71377284 TCCCCTGGGCTGAGGCTACCTGG + Intergenic
1070166107 10:73899229-73899251 TTCCCAGAACCCAGGCTCTCTGG + Intergenic
1074228017 10:111506329-111506351 GTCTCTGAGCAGGGGCTCCCAGG + Intergenic
1076133862 10:128031328-128031350 ACCCCTGAGCGGAGGCTCCGTGG + Intronic
1076653162 10:132003851-132003873 TTCCCTGAGCCTCGGCTTTCGGG + Intergenic
1077007550 11:365442-365464 TTCCCAAAGCCGGGGCTCACTGG + Intergenic
1077138522 11:1013310-1013332 TGCCCTGGGCCGTGGCTCCCTGG - Exonic
1077183473 11:1226537-1226559 TCCCCTGGGCCGAGGCACCCTGG - Intronic
1077367190 11:2166019-2166041 TTTCCTCATCCGAGGCCCCCAGG + Exonic
1077807627 11:5605225-5605247 TTTCCTGGGCCAAGCCTCCCAGG - Intronic
1080592054 11:33733029-33733051 TTCCCTAAGCCAAGGCACACAGG + Intronic
1083343046 11:61971345-61971367 TTCCCTGAGCCAAGGAGCACAGG + Intergenic
1084430228 11:69106822-69106844 TACCCAGAGGCCAGGCTCCCAGG + Intergenic
1085276236 11:75302025-75302047 CTCCCTGAGCCCAAGCTTCCTGG - Intronic
1085399881 11:76229650-76229672 ATCCCAGAGCCCTGGCTCCCAGG + Intergenic
1085439292 11:76543655-76543677 ATCCCAGAGCCCTGGCTCCCAGG - Intronic
1090120698 11:124023783-124023805 TTACCTGAGACCAGGCTCCAGGG + Exonic
1090121810 11:124038209-124038231 TTACCTGAGGCCAGGCTCCAGGG - Exonic
1090409725 11:126499450-126499472 TCGCCTGATCCGAGGGTCCCAGG - Intronic
1094495870 12:30989017-30989039 CCCCCTGGGCGGAGGCTCCCAGG - Intronic
1094735211 12:33226571-33226593 TGCCCTGGGCCAATGCTCCCTGG - Intergenic
1095841791 12:46701610-46701632 ATCCCTGAGCCCAGGGTCTCTGG + Intergenic
1096599349 12:52718366-52718388 TTCCCTGAGTGGGAGCTCCCAGG - Intergenic
1096694312 12:53339021-53339043 CTCCCTCAGCCCAGCCTCCCAGG + Intronic
1100700196 12:97139207-97139229 TTCCCAGAGCCCTGACTCCCAGG + Intergenic
1102648627 12:114420337-114420359 TTCCCTGGGTGGAGGCTCCCAGG + Intergenic
1104801458 12:131557542-131557564 TTCCCTGACACGAGGTTGCCTGG - Intergenic
1105481310 13:20779319-20779341 TTTTCTGAGCCCAGGCTTCCTGG - Exonic
1106788290 13:33129333-33129355 CGCCATGAGCCGGGGCTCCCTGG + Exonic
1107467436 13:40664397-40664419 TCCCCGGAGCCGAGGGCCCCCGG + Intronic
1110190843 13:72727465-72727487 TTCCCAGAGCCAAGGCCCCCAGG - Intronic
1112722293 13:102258637-102258659 ATCCCTGAGCCCAAGCTCCCTGG + Intronic
1113368652 13:109702429-109702451 GTCCCTTAGCCGAGGCACACTGG - Intergenic
1113756167 13:112812518-112812540 TTCACTGAGCCCAGGCTGGCTGG - Intronic
1113908552 13:113831323-113831345 GTCCCTGAGCCCTGGCTCCCAGG - Intronic
1114459836 14:22879257-22879279 TTCCCTGAGCCAAGGTGCCAGGG - Exonic
1115027311 14:28760147-28760169 TTCGCGGAGCTGGGGCTCCCAGG - Intergenic
1117072279 14:52068282-52068304 TTCCCTGAATCCAGACTCCCTGG - Intronic
1117105609 14:52394691-52394713 TTCCCAGGTCAGAGGCTCCCAGG + Intergenic
1120979683 14:90278947-90278969 GTCCATGAGCCGAGCATCCCCGG + Intronic
1121271132 14:92638985-92639007 ATCGCTGAGCAGAGGTTCCCTGG + Intronic
1122071513 14:99208324-99208346 TTCCCTGAGCCCCAGATCCCAGG + Intronic
1122072864 14:99215987-99216009 TTCCCTGGGCGGAGGCTTTCCGG - Intronic
1124608732 15:31193153-31193175 TTCCCTGTGCTGAGGCCCCTTGG - Intergenic
1124641471 15:31398940-31398962 TTCCCTGGGCACAGGCTCCAGGG - Intronic
1127267702 15:57375018-57375040 TTTCCTGAGCAGAGGCTGCCTGG - Intergenic
1127292132 15:57580391-57580413 ATGCCAGAGCCCAGGCTCCCTGG + Intergenic
1127988451 15:64093667-64093689 TTCCATGATCCGGGGCTGCCGGG + Exonic
1128773323 15:70300444-70300466 TTCCTTGTGCCGTGGCTGCCTGG - Intergenic
1129656598 15:77528942-77528964 TTTCCTGAGCTGGGGCCCCCAGG + Intergenic
1131277622 15:90994892-90994914 TTCCCTGAGTCCCGGCTGCCGGG + Intronic
1131827972 15:96334908-96334930 TTTCCTGAGCCCAGGCCCCCCGG + Intronic
1133417272 16:5616404-5616426 TCCTCTGAGCCAAGGCTCTCAGG - Intergenic
1137670426 16:50275200-50275222 TACCCTGAGCTTAGCCTCCCAGG - Intronic
1137785858 16:51137275-51137297 TTCCCACTGCCGAGGCTTCCAGG + Exonic
1138084887 16:54124425-54124447 TTCCCTAAGCCTTGGCACCCAGG - Intergenic
1139997280 16:70992790-70992812 TTCTCTGAGCAGAGGAACCCAGG + Intronic
1141589970 16:85061891-85061913 TCCCATGAGCGGTGGCTCCCCGG + Intronic
1142037163 16:87869451-87869473 CTCGCTGGGCCGCGGCTCCCGGG - Exonic
1142138960 16:88464142-88464164 TTCCTTGAGACGCGGCACCCAGG - Intronic
1143022234 17:3922887-3922909 TTCCCTGAGCCCCGGCTTCCAGG + Intergenic
1143118435 17:4593316-4593338 TTCCCTTAGCCCATCCTCCCGGG + Intronic
1144843593 17:18203980-18204002 TTCCCTGAACATGGGCTCCCTGG + Intronic
1146670906 17:34736815-34736837 TTCCCTGGGCTGAGCGTCCCTGG + Intergenic
1147420100 17:40318313-40318335 GCCCCTGAGCCGCGGCCCCCTGG + Intronic
1147900061 17:43778307-43778329 TTCCCTGATCCGGGACTGCCGGG + Intronic
1147975990 17:44248343-44248365 TTCCCAGAGTCGGGGGTCCCGGG - Intergenic
1148164942 17:45476874-45476896 TTTACTGAGCTGAAGCTCCCTGG - Intronic
1150224146 17:63513830-63513852 CTGCCTGAGCGGAGGCTCCTTGG - Intronic
1150396160 17:64823537-64823559 TTTACTGAGCTGAAGCTCCCTGG - Intergenic
1150650426 17:67006354-67006376 TGCCATCAGCCGAGGCGCCCTGG - Intronic
1151207097 17:72515793-72515815 TTCCCTGCACCGTGGATCCCTGG + Intergenic
1151560966 17:74869330-74869352 TTCCCTGATCAGAGTCTCCCGGG - Intronic
1151896266 17:76982856-76982878 TTCTCTGAGCAGAACCTCCCAGG - Intergenic
1152274797 17:79349906-79349928 TTCCCTGAGCCTAGGCCACGTGG + Intronic
1152560217 17:81074876-81074898 TTCACTTCGCCGAGGTTCCCTGG - Intronic
1152686437 17:81696013-81696035 GCCCCTGAGCCGAGGCCCCGTGG - Intronic
1153808699 18:8733146-8733168 TGCCCTGCGCCCTGGCTCCCAGG - Intronic
1155906527 18:31458740-31458762 TTCCCTCAGGCGAGGCTCTGTGG - Intronic
1156469988 18:37371396-37371418 TCCCCTGAGGCCAGGATCCCTGG - Intronic
1156522630 18:37734663-37734685 TTCCCTGAGCAAAGCTTCCCAGG + Intergenic
1157779019 18:50420890-50420912 CTCCCTGAGAGGAAGCTCCCAGG - Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161124429 19:2547793-2547815 TTCCCAGGACAGAGGCTCCCAGG + Intronic
1161446973 19:4323940-4323962 TTCACTGAGCTGAGGGTCACTGG + Intergenic
1161554542 19:4933153-4933175 TTCCCTGGGCAGAGGCACTCAGG - Intronic
1161574420 19:5047859-5047881 CCCCCAGAGCCGAAGCTCCCAGG + Intronic
1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG + Intronic
1161594793 19:5145705-5145727 TCCCCTGGCTCGAGGCTCCCGGG + Intronic
1161856879 19:6771041-6771063 TTCCCTGACCTCAGCCTCCCAGG - Intergenic
1162391566 19:10393245-10393267 CTCCCTGAGGTGGGGCTCCCCGG - Exonic
1162935980 19:13981828-13981850 TTCCCTGAGCTGGAGCTGCCAGG + Intronic
1164643194 19:29841292-29841314 TTCCCTGAGCCTGTGCTCTCTGG - Intergenic
1164705090 19:30313856-30313878 TTCTCGGAGCCCAGGCTTCCAGG - Intronic
1165302136 19:34976965-34976987 TTCCCTGAGAGCTGGCTCCCAGG + Intergenic
1165810964 19:38611448-38611470 TTCCCTTAGGAGAGGCACCCTGG - Intronic
1167441885 19:49513455-49513477 TCACCTGCGCCCAGGCTCCCAGG - Exonic
1167485661 19:49761620-49761642 TTTCCTGAGCCCAGCCTCACTGG + Intronic
925741452 2:7008799-7008821 TGCCCAGAGCCCCGGCTCCCTGG - Intronic
926086425 2:10023103-10023125 TGCCCTCAGCCGTGGCTCCAGGG + Intergenic
927054812 2:19358307-19358329 TTTGCTGAGCCCAGGCGCCCAGG + Intronic
927550752 2:23997004-23997026 TTCCCTGAGCCCAGGATTTCCGG - Intronic
927937987 2:27086169-27086191 CTCCCTGAGCCGGCGCGCCCCGG - Exonic
930229233 2:48826961-48826983 CTCCCTGAGGCGGAGCTCCCAGG + Intergenic
932191142 2:69742201-69742223 TTCCCTGAGCCCAGGACCCCCGG - Intronic
932733196 2:74234948-74234970 TTTCCTGAACACAGGCTCCCAGG - Intronic
938178823 2:129161623-129161645 TTCCCTGAGCCTCGGCATCCTGG + Intergenic
938477390 2:131628738-131628760 TTCCCTGAGTCAGGGCTGCCAGG + Intergenic
940884139 2:158974219-158974241 TTCCCTGTGCCTAGGCTCACTGG + Intronic
946616903 2:221519668-221519690 ATCCATGAGCAGAGTCTCCCAGG - Intronic
947125102 2:226860521-226860543 TTCCTAGAGCCGTGCCTCCCTGG + Intronic
947808356 2:232983537-232983559 CTTCTTGAGCCAAGGCTCCCTGG - Intronic
947909988 2:233794515-233794537 TGCCCAGAGCCGTGGCTGCCTGG - Intronic
948118520 2:235511542-235511564 TGCCCTGAGCTCAGGCTGCCAGG - Intronic
948781856 2:240326455-240326477 TTCTCAGGGACGAGGCTCCCAGG - Intergenic
948853332 2:240718857-240718879 GTCCCTGAGCCCAGCCTCCGTGG + Intronic
1168998175 20:2147772-2147794 TTGCCAGGGCCGAGACTCCCAGG - Exonic
1170430575 20:16272906-16272928 TTCCCTGAGCCCAGCCAGCCTGG - Intronic
1172005326 20:31815644-31815666 TTCCAGGAGCCTAGGCTTCCAGG - Intergenic
1172184062 20:33020479-33020501 CTCCCTACGCCCAGGCTCCCTGG - Intronic
1174170735 20:48616686-48616708 TTCCCTCATGCCAGGCTCCCCGG - Intergenic
1174536166 20:51253190-51253212 ATCCCTGAGCCCAGGCTTCTTGG - Intergenic
1174857289 20:54058364-54058386 TCCCCTGAGCTGAGGCACCATGG - Intronic
1175084581 20:56447721-56447743 TTCCCTGAGCCATTCCTCCCTGG + Intronic
1176422341 21:6526361-6526383 AGCCCTGAGCTGAGGCTGCCAGG + Intergenic
1177273558 21:18877830-18877852 CTCCCTGAGATGGGGCTCCCAGG - Intergenic
1178504148 21:33149568-33149590 CTCCCTGAGCCTCAGCTCCCTGG - Intergenic
1179697832 21:43134677-43134699 AGCCCTGAGCTGAGGCTGCCAGG + Intergenic
1179954109 21:44728269-44728291 TTTCCTGAGCCCTGGCTGCCAGG - Intergenic
1183788479 22:40045444-40045466 GTCCCCGCGCCGAGGCCCCCCGG - Intronic
1184089251 22:42283715-42283737 TGCCCTGGCCCGAGGCTCCCCGG - Intronic
1184667452 22:45996474-45996496 TTCCCTGGACCGGGGCACCCTGG - Intergenic
1185208364 22:49553093-49553115 GTACCTCAGACGAGGCTCCCAGG - Intronic
1185234976 22:49706894-49706916 CTCTTTGGGCCGAGGCTCCCTGG + Intergenic
949926995 3:9049318-9049340 TTCCATGGTCCTAGGCTCCCAGG + Intronic
950426467 3:12927306-12927328 GTCCCTGGGCCTATGCTCCCTGG + Intronic
953908642 3:46881381-46881403 TCCCCTAAGTCGAGGGTCCCAGG + Intronic
954543101 3:51409189-51409211 TTCCCTGACCCAAGCCTTCCTGG + Intronic
955271674 3:57505827-57505849 TTGCTTGAGCCCAGGATCCCAGG - Intronic
961332811 3:126153114-126153136 GGCCCTGAACCCAGGCTCCCTGG + Intronic
961783481 3:129335373-129335395 TTCCCTGAGACAAGTCTCCTTGG - Intergenic
962168701 3:133077851-133077873 TTCCCTGAGCTCTTGCTCCCAGG + Intronic
962378505 3:134877975-134877997 TTCCCTCAGCCACCGCTCCCAGG - Intronic
963053022 3:141158468-141158490 TTCCCTGAGCAGAGCCTCCAGGG + Intergenic
965493302 3:169366537-169366559 TTCCCTTAGGTGAGGCTTCCAGG + Intronic
966573790 3:181477042-181477064 TTCCCTGGGTCAAAGCTCCCAGG - Intergenic
967983250 3:195077992-195078014 CTCCCAGGGCCGAGGCTCCGGGG - Intronic
968490476 4:888337-888359 TTCCGTGAGCAGAGGCTGCCGGG + Intronic
968594901 4:1477226-1477248 GCCCCTGAGGCCAGGCTCCCTGG - Intergenic
968616563 4:1580272-1580294 GTCCCTGGGGCGAGGCTGCCTGG - Intergenic
968728946 4:2260908-2260930 GACCCTGGGCCGGGGCTCCCCGG - Intronic
969620375 4:8275861-8275883 TGCCCTGAGCCCAGGTCCCCTGG + Intronic
969689184 4:8694855-8694877 GACCCTGAGCCAAGGCTACCCGG + Intergenic
975596859 4:76055591-76055613 TTCCCAGACCCAAGCCTCCCTGG + Intronic
977258104 4:94762531-94762553 TTGCCTGAGTCCAGCCTCCCTGG - Intronic
985901954 5:2803442-2803464 TCCCCTGAGGTGTGGCTCCCAGG - Intergenic
986336730 5:6760897-6760919 TTCCCTGCGCCGGGCCTACCAGG - Intergenic
990967120 5:61461168-61461190 TTCCCTGAGCCAAAGCCACCAGG + Intronic
991669538 5:69033933-69033955 TACCTTCAGCCCAGGCTCCCTGG - Intergenic
995611264 5:113913005-113913027 ATCCCTGGGCCCTGGCTCCCTGG + Intergenic
996963447 5:129279458-129279480 TCCACTAAGCCGAGGCTCCTCGG - Intergenic
997626373 5:135333932-135333954 TTCCCTCTGCCGAGGCTGCTGGG - Exonic
998881606 5:146650986-146651008 TCCCCTGAGATGAGGCTACCTGG - Intronic
999756172 5:154666117-154666139 CTCTCTGAGCCTTGGCTCCCAGG + Intergenic
1001257303 5:170193654-170193676 TTCCCTGAGCCAATCCTCTCTGG + Intergenic
1004602275 6:17161852-17161874 CTCCCTGATCTGAGGCTCCCAGG - Intergenic
1006363361 6:33599850-33599872 TTCCCCGAGGCCAGGATCCCTGG - Intergenic
1007069912 6:39028968-39028990 TTCCCTGATCCGATCCTCACTGG + Intronic
1007902384 6:45423341-45423363 TTCCCGGGGGCGAGGATCCCCGG + Intronic
1009596688 6:65745525-65745547 CTCCCTGGGCAGAGCCTCCCAGG + Intergenic
1012393966 6:98774472-98774494 TTCCCTGTGACTTGGCTCCCAGG - Intergenic
1013232280 6:108169240-108169262 ACCTCTGAGCCGCGGCTCCCGGG - Intronic
1018668799 6:166163027-166163049 TTGCCTGAGGCCAGGCTCCTGGG - Intronic
1018898723 6:168039980-168040002 TTCCCTGAGCCGAGGAGTCTTGG + Intronic
1019160059 6:170063538-170063560 TGCCCTGAGCGGGGCCTCCCTGG + Intergenic
1019504645 7:1384942-1384964 GTCCCTGAGCTGGGGCTCGCAGG - Intergenic
1022396104 7:29989412-29989434 GTCCCCGAGCCGAGTCACCCCGG + Intronic
1022559777 7:31336373-31336395 CTTCCTGAGCCGAGGCTGCGAGG - Intergenic
1023923124 7:44645395-44645417 TCCCCTGAGCCGAGGCTCCCTGG + Exonic
1024596520 7:50941859-50941881 TAGCCTGAGCCTAAGCTCCCAGG - Intergenic
1024854135 7:53757263-53757285 TTGGCTTAGCCTAGGCTCCCCGG - Intergenic
1029423006 7:100481083-100481105 TTCCCTGAGGCCAGGCACCATGG - Intergenic
1029752117 7:102548833-102548855 TTCCCAGTGCCCAGGCTCTCAGG - Intronic
1029770069 7:102647927-102647949 TTCCCAGTGCCCAGGCTCTCAGG - Intronic
1030068771 7:105680650-105680672 TTCCCTGATCCCAGGCTAGCAGG + Intronic
1031674664 7:124594729-124594751 GTCCCTAAGCCTATGCTCCCAGG - Intergenic
1032548006 7:132759547-132759569 TTGCCAGAGCCTAGGCCCCCAGG - Intergenic
1033226068 7:139563364-139563386 TGCCCTGGGCCAAGGCACCCAGG - Exonic
1034291725 7:149937827-149937849 TTCCCTCAGCCCAGGCACCTGGG + Intergenic
1034814360 7:154159071-154159093 TTCCCTCAGCCCAGGCACCTGGG - Intronic
1037768191 8:21784478-21784500 TCCCCTGAGCAGGGCCTCCCGGG - Intronic
1038407912 8:27335708-27335730 TGCCCTGAGCCTAGGAGCCCTGG + Intronic
1039951282 8:42174681-42174703 TTCCCTGAGCAGAATCTCCATGG + Intergenic
1043800921 8:84608485-84608507 TTCCTTGAGCCTGGACTCCCTGG + Intronic
1047216901 8:122883267-122883289 TTCCCTGAGCCAGGGAACCCGGG - Intronic
1052860639 9:33435857-33435879 TCCCCTAAGCCCAGGCTGCCTGG + Intergenic
1056933760 9:90899998-90900020 TTGGCTGGGCCAAGGCTCCCTGG + Intergenic
1057156607 9:92847164-92847186 TATCCTGAGCCGAGACTTCCAGG + Exonic
1057282591 9:93723454-93723476 TGCCCTGACCCCAGGCTTCCTGG - Intergenic
1058150365 9:101457152-101457174 TTCCCTGAGCAAACTCTCCCAGG - Intergenic
1059408366 9:114116426-114116448 TGCCCTGGGCCGTGGCCCCCAGG + Intergenic
1060412363 9:123408243-123408265 TTCCATATGCCGAGTCTCCCCGG + Intronic
1061188740 9:129070002-129070024 TGCCCTGAGCACAGGCGCCCTGG + Intronic
1061242611 9:129383302-129383324 GTCCCTGCGCTGCGGCTCCCGGG - Intergenic
1061452101 9:130673262-130673284 ATCACTGTGCAGAGGCTCCCGGG - Intronic
1061482510 9:130903911-130903933 ATCCCTGACACGAAGCTCCCTGG - Exonic
1061704280 9:132440760-132440782 CTCTCTGAGCCTCGGCTCCCTGG - Intronic
1061895331 9:133644020-133644042 CTCCCTGACCCGAGTCTCACAGG + Intronic
1190362758 X:49665006-49665028 TTCCCAGTGTCGAGGCTTCCAGG + Intergenic
1194947903 X:100091106-100091128 TTCCCTGAGATGGAGCTCCCAGG + Intergenic
1195454351 X:105051369-105051391 TTGGCTGAGCAGAAGCTCCCTGG - Intronic
1196442309 X:115728269-115728291 GGCCCCGAGCCCAGGCTCCCTGG + Intergenic
1196443248 X:115732635-115732657 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196444274 X:115737302-115737324 GGCCCCGAGCCCAGGCTCCCTGG + Intergenic
1196445569 X:115844550-115844572 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196446240 X:115847531-115847553 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196446911 X:115850512-115850534 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196447580 X:115853495-115853517 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196448250 X:115856474-115856496 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196448919 X:115859465-115859487 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196449590 X:115862456-115862478 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196450259 X:115865439-115865461 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196450929 X:115868424-115868446 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196451600 X:115871403-115871425 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196452271 X:115874390-115874412 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196452941 X:115877359-115877381 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196453611 X:115880352-115880374 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196454280 X:115883361-115883383 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196455361 X:115888433-115888455 GGCCCCGAGCCCAGGCTCCCTGG - Intergenic
1196457066 X:115898393-115898415 GCCCCTGAGCCCAGGCTCCTTGG + Intergenic
1199816042 X:151397463-151397485 TTCCCTGAGGCCAGGTCCCCGGG - Intronic
1200175785 X:154115409-154115431 TTCTCTAGGCCAAGGCTCCCAGG + Intergenic
1201446592 Y:14063441-14063463 TTGCCTGAGGCTGGGCTCCCTGG - Intergenic