ID: 1161578054

View in Genome Browser
Species Human (GRCh38)
Location 19:5065761-5065783
Sequence CGTGCAGAGGAGGGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 610}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161578054_1161578066 -7 Left 1161578054 19:5065761-5065783 CCATCCATCCCCTCCTCTGCACG 0: 1
1: 0
2: 4
3: 50
4: 610
Right 1161578066 19:5065777-5065799 CTGCACGGCCGGGGGCTTCTGGG 0: 1
1: 0
2: 3
3: 21
4: 147
1161578054_1161578073 27 Left 1161578054 19:5065761-5065783 CCATCCATCCCCTCCTCTGCACG 0: 1
1: 0
2: 4
3: 50
4: 610
Right 1161578073 19:5065811-5065833 AGGTTCGCCCACCCGTCGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1161578054_1161578070 7 Left 1161578054 19:5065761-5065783 CCATCCATCCCCTCCTCTGCACG 0: 1
1: 0
2: 4
3: 50
4: 610
Right 1161578070 19:5065791-5065813 GCTTCTGGGGCCCATGGCAAAGG 0: 1
1: 0
2: 3
3: 21
4: 180
1161578054_1161578065 -8 Left 1161578054 19:5065761-5065783 CCATCCATCCCCTCCTCTGCACG 0: 1
1: 0
2: 4
3: 50
4: 610
Right 1161578065 19:5065776-5065798 TCTGCACGGCCGGGGGCTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 116
1161578054_1161578067 -6 Left 1161578054 19:5065761-5065783 CCATCCATCCCCTCCTCTGCACG 0: 1
1: 0
2: 4
3: 50
4: 610
Right 1161578067 19:5065778-5065800 TGCACGGCCGGGGGCTTCTGGGG 0: 1
1: 0
2: 3
3: 9
4: 144
1161578054_1161578069 1 Left 1161578054 19:5065761-5065783 CCATCCATCCCCTCCTCTGCACG 0: 1
1: 0
2: 4
3: 50
4: 610
Right 1161578069 19:5065785-5065807 CCGGGGGCTTCTGGGGCCCATGG 0: 1
1: 1
2: 3
3: 27
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161578054 Original CRISPR CGTGCAGAGGAGGGGATGGA TGG (reversed) Intronic
900489049 1:2937240-2937262 TGTGCAGAGGAGAGGGAGGAAGG + Intergenic
900513389 1:3070512-3070534 CCTGCAGAGGAGGGGGCGGCGGG - Intronic
900524805 1:3123385-3123407 CGTGCAGAGGGGGGTGTGGGTGG + Intronic
900787348 1:4656936-4656958 GGGGCAGAGCAGGGGATGGCAGG - Intronic
900852578 1:5155698-5155720 CCTCCAGAGGAAGGAATGGAAGG + Intergenic
900879310 1:5369149-5369171 TGTGCAGAGAAGGGGCTGAAGGG - Intergenic
900914809 1:5629262-5629284 CCTGCAGAGAATGGGATGGGTGG + Intergenic
901197906 1:7450459-7450481 GCTGGAGGGGAGGGGATGGAAGG + Intronic
901827790 1:11873910-11873932 AGTGCTGAGCAGGGGAGGGAAGG - Intergenic
901987954 1:13091138-13091160 GGAGCAGAGGAGGGCATGGATGG + Intergenic
901993858 1:13135629-13135651 GGAGCAGAGGAGGGCATGGATGG - Intergenic
902353081 1:15873049-15873071 GGTTCAGAGGAGGTGGTGGAGGG + Exonic
902581602 1:17411080-17411102 GATGGAGAGGAGGGGAAGGAAGG - Intronic
902654289 1:17856866-17856888 AGTGCAGAGGAGGGCAGGGGCGG + Intergenic
903166012 1:21520966-21520988 GCTGCAGGGGAGGGGATGGCAGG - Intronic
903180235 1:21601615-21601637 CAGGCAGGGGAGGGGAAGGACGG + Intronic
903331635 1:22599838-22599860 AGAGGAGAGGAGGGGAGGGAAGG + Intronic
903480859 1:23652370-23652392 CCTGCAGAAGAGGGGAAGGTGGG + Intergenic
903549658 1:24149174-24149196 TGTGCAGGTGTGGGGATGGAGGG + Intergenic
903732020 1:25503665-25503687 CGTGCAGAGGAGGACAGGGAAGG - Intergenic
905254449 1:36671215-36671237 CATGCAAAGGATGGGAAGGAAGG - Intergenic
905396444 1:37669647-37669669 GGTGCAGAGGGAGGGAAGGAAGG - Intergenic
905396459 1:37669717-37669739 GGTGCAGAGGGAGGGAAGGAAGG - Intergenic
905593740 1:39187952-39187974 AGGGGAGAGGAGGGGAGGGAAGG - Intronic
905772643 1:40648288-40648310 TTTGTAGAGGAGGGAATGGAGGG - Intronic
906069660 1:43007667-43007689 CGGGGAGGGGAGGGGAAGGAGGG - Intergenic
906137362 1:43508727-43508749 CGTGAGTAGGAGGAGATGGATGG - Intergenic
906524830 1:46488052-46488074 AGTGGAGAGGAGGGGAGGGAAGG - Intergenic
906660458 1:47578070-47578092 CAGGCAGAGGAGGGGTTGGCAGG - Intergenic
906693524 1:47809052-47809074 CGTGCAGAGGAGGGGATCCTGGG - Intronic
907245449 1:53105696-53105718 TGGGCAGTGGAGGGGAGGGAAGG - Intronic
907305325 1:53509858-53509880 TGGGCAGAGGCGGGGGTGGAGGG + Exonic
907726494 1:57025168-57025190 TGGGCAGGGGAGGGGCTGGAGGG + Intronic
907767137 1:57423262-57423284 GGTGCTGGGGAGTGGATGGAGGG + Intronic
907914089 1:58852929-58852951 CTTGTAGAGGAGGGGAGGGCTGG + Intergenic
908269466 1:62409139-62409161 TGCGCAGAGGAGGGAAAGGACGG + Intergenic
912162495 1:107002784-107002806 CTTGTAGATGAGGGGATGTAAGG + Intergenic
912811776 1:112800550-112800572 TGTGCAGGGGAGGGGCTGGTGGG + Intergenic
913117620 1:115711397-115711419 CTTTCAGAGGAGGAGATGAAAGG - Intronic
913464291 1:119123790-119123812 AGAGGAGAGGAGGGGAAGGAGGG - Intronic
915073047 1:153288238-153288260 TGTGAACAGGATGGGATGGAAGG + Intergenic
915361605 1:155289369-155289391 CCTGAAAAGGAGGGGAGGGATGG - Exonic
915662365 1:157414968-157414990 TGTGAAGAGGAGGGTATGGATGG - Intergenic
916289135 1:163144629-163144651 CGTGGAGAGGAGGAGGAGGAGGG + Intronic
916509030 1:165454915-165454937 AGTGCATAGGATGGGATGGGTGG - Intergenic
918050375 1:180968160-180968182 GGTGCAGGGGTTGGGATGGAGGG - Intergenic
918060917 1:181060669-181060691 GGTGCAGGGGTTGGGATGGAGGG - Exonic
918243696 1:182641339-182641361 GGTCCTGTGGAGGGGATGGAAGG - Intergenic
918263499 1:182818543-182818565 CGTGCTGAGGAGTTGTTGGATGG + Exonic
920110907 1:203586436-203586458 CGGGTAGGGGAGGGGATGGAAGG - Intergenic
920311847 1:205053153-205053175 CGGGCAGAGGTGGGGATCGGAGG - Exonic
920419331 1:205820465-205820487 CAGGGAGAGGAGGGGAGGGAAGG - Intergenic
920527694 1:206679932-206679954 AGTGCAGATGAGGGCACGGAGGG + Intronic
920717038 1:208349835-208349857 CAGGCAGAGGAGGGGCTGGGTGG + Intergenic
920742898 1:208598234-208598256 CTTGCTGAGGTGGGGAGGGATGG - Intergenic
922168244 1:223133732-223133754 TTTGAGGAGGAGGGGATGGATGG + Intronic
922534280 1:226368321-226368343 CCTGGAGAGGAGGGGACAGAAGG + Exonic
922695320 1:227728448-227728470 CGGGGAGAGGACGGGATGGGAGG - Intergenic
922855648 1:228773139-228773161 GGTGCAGGGGAGGGGAAGGGAGG - Intergenic
922979315 1:229812242-229812264 AGGGCAGGGGAGGGGAGGGAAGG + Intergenic
923845689 1:237729071-237729093 CTTGAAGAGGTGGTGATGGAGGG - Intronic
924666668 1:246080460-246080482 GGCGGTGAGGAGGGGATGGATGG - Intronic
1062925776 10:1314513-1314535 CGGGCAGTGGGGAGGATGGAGGG - Intronic
1063225740 10:4013326-4013348 GGTGAAGGGGAGGGGAGGGAAGG - Intergenic
1063692110 10:8296822-8296844 AGTGGAGAGGAGGGGAGGGGAGG - Intergenic
1063968267 10:11363513-11363535 GGAGCAGAGCAGAGGATGGAGGG - Intergenic
1064057854 10:12112909-12112931 AGTGCGGAAGAGGGGGTGGACGG + Exonic
1065494432 10:26314349-26314371 AGGACAGAGGAGGGGAAGGAAGG - Intergenic
1065656722 10:27959185-27959207 AGTGGAGAGGAGGGGAGGGGAGG + Intronic
1065808045 10:29413083-29413105 CATGCAGAGGTAGAGATGGAAGG - Intergenic
1066253948 10:33660834-33660856 AGAGCAGGGGAGGGGCTGGAGGG - Intergenic
1066428319 10:35329670-35329692 CATGCAGAGGTGGGGAGGAATGG + Intronic
1067440816 10:46308414-46308436 AGTGGAGAGGAGGGGAGGGGAGG - Intronic
1067554308 10:47257479-47257501 ATGCCAGAGGAGGGGATGGAGGG + Intergenic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1068545037 10:58335308-58335330 CGGGGAGAGCAAGGGATGGAAGG + Intronic
1068706419 10:60081089-60081111 CGGGCAGAGGAGGGTAGGGACGG + Intronic
1069619603 10:69828683-69828705 AGTGGGGAGGAGAGGATGGAAGG - Intronic
1069692272 10:70361719-70361741 TCTGCAGAGGATGGGATGGGAGG - Intronic
1070148703 10:73792468-73792490 CGTGGAGAGGACAGGGTGGAGGG - Exonic
1070148801 10:73792846-73792868 CATGGAGGTGAGGGGATGGAAGG + Exonic
1070535360 10:77373325-77373347 AGTCCAGAAGAGGGGAGGGAGGG - Intronic
1070756567 10:78997111-78997133 AGGGTAGAGGAGGGAATGGAGGG - Intergenic
1070803266 10:79255761-79255783 AGTGCAGGGGTGGGGAGGGACGG - Intronic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1071531641 10:86394026-86394048 CGGGGAGGGGAGGGGAGGGAAGG - Intergenic
1072691102 10:97572774-97572796 CCTGCAGAGGCGGTTATGGACGG + Exonic
1073463185 10:103678231-103678253 CACGCAGAGGAGGGGAGGGATGG - Intronic
1073861287 10:107744567-107744589 ACTGCAGGGCAGGGGATGGAAGG - Intergenic
1074224428 10:111470115-111470137 CTTAAAGAAGAGGGGATGGAAGG - Intergenic
1074377535 10:112951726-112951748 CGAGCGGGGGAGGGGAGGGAGGG - Intronic
1074464268 10:113667833-113667855 AGTGCAGAGGAGTGGACGGATGG - Intergenic
1074769037 10:116721658-116721680 AGTGCCGGGGAGGGGAGGGATGG - Intronic
1074886887 10:117700895-117700917 GGTGGAGAGTAGGGGAAGGAAGG + Intergenic
1074982734 10:118632815-118632837 AGTTCAGAGGAGGGATTGGAGGG - Intergenic
1075226285 10:120632497-120632519 TGGACAGAGGATGGGATGGATGG + Intergenic
1076017902 10:127043646-127043668 CGGGCAGAGGGGTGGATAGAAGG - Intronic
1076152219 10:128171973-128171995 GGAGGAGAGGAGGGGAGGGAAGG - Intergenic
1076488532 10:130840347-130840369 AGTGGGGAGGAGGGGATGGTAGG - Intergenic
1076488547 10:130840386-130840408 GGTGGGGAGGAGGGGATGGTAGG - Intergenic
1076488557 10:130840408-130840430 GGTGGGGAGGAGGGGATGGTAGG - Intergenic
1076488579 10:130840452-130840474 CGTGGGGAGGAGGCGATGGTAGG - Intergenic
1076533443 10:131160504-131160526 CTTGCAGATGAGGGAATGAATGG - Intronic
1076799323 10:132813370-132813392 TGTGCAGAGGTGGGGCTGCAGGG - Intronic
1076799334 10:132813416-132813438 TGTGCAGAGGTGGGGCTGCAGGG - Intronic
1076811778 10:132890154-132890176 CGGGCAGAGGAGGCTGTGGAGGG - Intronic
1076811795 10:132890221-132890243 CGGGCAGAGGAGGCTGTGGAGGG - Intronic
1076830581 10:132992362-132992384 GGTGCAGAGGAGGAGGTGGTGGG + Intergenic
1077020108 11:413622-413644 GGTGCAGAGGAGGGTTTGCAGGG - Intronic
1077253296 11:1570136-1570158 CGGGCAGGGCAGGGGATGGGAGG + Intronic
1077268183 11:1662379-1662401 ACTGCTGAGGAGGGGAAGGATGG - Intergenic
1077272699 11:1689239-1689261 ACTGCTGAGGAGGGGAAGGATGG + Intergenic
1077325041 11:1960034-1960056 CGTGCATGGGAAGGGGTGGAGGG + Intronic
1077485864 11:2838175-2838197 CAGACAGAGGTGGGGATGGAAGG + Intronic
1078463047 11:11530079-11530101 GTTGGGGAGGAGGGGATGGAGGG - Intronic
1078606769 11:12784085-12784107 AGTGACAAGGAGGGGATGGATGG + Intronic
1078826538 11:14935514-14935536 AGAGGAGAGGAGGGGAGGGAAGG + Intronic
1078830777 11:14974359-14974381 CGCGCAGAGCAGGGCTTGGATGG + Intronic
1079512589 11:21228729-21228751 AGGGCAGGGGAGGGGAGGGAGGG - Intronic
1079882564 11:25944861-25944883 AGTGCTAAGGAGTGGATGGACGG + Intergenic
1080035166 11:27701966-27701988 CGGGCAGTGGTGGGGGTGGAGGG - Intronic
1080786450 11:35479106-35479128 GGTGCAGGGGAGGGGATTGTGGG + Intronic
1082824398 11:57567502-57567524 AGAGCCGCGGAGGGGATGGAGGG + Intronic
1082849861 11:57754901-57754923 GGGGCAGAGGAGGGGAGGGGAGG - Intronic
1082997207 11:59263706-59263728 CCTGCAGAGGAGGAGAAGGCAGG + Intergenic
1083064764 11:59913439-59913461 TGTGCAGGGGAGTGGATGGGAGG + Intergenic
1083179744 11:60977471-60977493 AGTGCCGAGGACAGGATGGAGGG - Intronic
1083545310 11:63545095-63545117 TGTGCAGAGGAGGGGGTGGATGG + Intronic
1084032050 11:66486951-66486973 GGAGCTGAGGAGGGGATGGCAGG + Intronic
1084040376 11:66539320-66539342 AGTGCAGAGGAGGGTCTGGCAGG - Exonic
1084476100 11:69390624-69390646 GGTGCTGAGGAGGGGTAGGATGG + Intergenic
1085081498 11:73638345-73638367 GTTCCAGAGGAGGGAATGGAGGG + Intergenic
1085809618 11:79668165-79668187 CGTGGAGAGGTGGTGAAGGAGGG + Intergenic
1086532638 11:87803796-87803818 CGTGAAAAGGAGAAGATGGAAGG + Intergenic
1088378359 11:109166698-109166720 TGCACAGGGGAGGGGATGGATGG - Intergenic
1088920388 11:114256687-114256709 TGTGCAGGGGAGGGGATGGGTGG + Intergenic
1089073015 11:115715953-115715975 AGTGAAGAGGAGGGGTGGGATGG - Intergenic
1089254478 11:117187035-117187057 AGTCCAGAGTAGGGGAGGGAGGG + Intronic
1089663839 11:120004047-120004069 CCAGCAGAGGAGGGGTTGGGAGG - Intergenic
1089758624 11:120706519-120706541 CATGTAGAGAATGGGATGGATGG + Intronic
1090197835 11:124832179-124832201 AGTGGAGAGGAAGGGATGAAAGG - Intergenic
1090258221 11:125300675-125300697 GGTGCAGGAGAGGGGAGGGAGGG + Intronic
1090336903 11:125975017-125975039 AGTGCACAGGAGGGAAGGGAGGG - Intronic
1090394145 11:126407863-126407885 AGGGCAGAGGAGTGGAGGGAAGG - Intronic
1090642548 11:128741629-128741651 TCTGCAGAGGAGGGGATAAAAGG + Intronic
1202808023 11_KI270721v1_random:15213-15235 CGTGCATGGGAAGGGGTGGAGGG + Intergenic
1091440545 12:509229-509251 CCCGCCTAGGAGGGGATGGATGG + Intronic
1091849069 12:3680500-3680522 CATGCAAAGGAGGAGAGGGATGG - Intronic
1092260774 12:6952276-6952298 CAGGGAGGGGAGGGGATGGAGGG - Intronic
1092262538 12:6960243-6960265 CGTGCAGAGCAGGGCCTGGGGGG + Intronic
1096264528 12:50112384-50112406 CCTGCAGACTAGGGGATGGGAGG - Intronic
1096994518 12:55830392-55830414 TGTGCAGAGGAGGGGACCGACGG - Intronic
1097134552 12:56840946-56840968 AGTACAGTGCAGGGGATGGATGG - Intergenic
1097462218 12:59875892-59875914 TTTTCAGTGGAGGGGATGGAGGG - Intergenic
1099050636 12:77778157-77778179 AGGGCAGAGGAGGGGAGGGGAGG - Intergenic
1099697893 12:86044494-86044516 CTGGCAGAGGAGGGGAGGCAAGG + Intronic
1100975978 12:100123008-100123030 CGAGCAGAGCATGGGATGGGAGG - Intronic
1100985638 12:100199773-100199795 CGGGCAGAGGAGGGCAGCGACGG - Intronic
1101693058 12:107098475-107098497 AGAGGAGAGGAGGGGAGGGAAGG + Intergenic
1101798983 12:108003949-108003971 AATGCAGAGGAGGGGATGATGGG + Intergenic
1101858368 12:108462955-108462977 AGAGCAGAGGAGGGGAAGGAAGG + Intergenic
1101859159 12:108468666-108468688 AGTGGAGAGGAGGGGAAGGGAGG + Intergenic
1102797114 12:115698257-115698279 AGTGGAGAGGAGGGAAGGGAAGG + Intergenic
1102851244 12:116246918-116246940 TGGGGAGAGGAGGGGAGGGAAGG + Intronic
1103167128 12:118779465-118779487 TGTGCTGACGAGGGGATGGTTGG - Intergenic
1103321776 12:120096439-120096461 CGTGCAGAGATGGGGCTGGCAGG - Exonic
1103506102 12:121443120-121443142 TCTCCAGAGGAGGGGCTGGAGGG + Intronic
1103918139 12:124386383-124386405 CGTGGTGAGCAGGGGATGGGAGG + Intronic
1105471422 13:20698312-20698334 AGGGAAGAGGAGGGGACGGAAGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106106585 13:26738522-26738544 CGTGGAGAGGCCGGGATGCAGGG - Intergenic
1106136362 13:26976597-26976619 TGTGCAGAGGAGGCCATAGAAGG + Intergenic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1107747186 13:43523102-43523124 CTTGCAGAGGATGGGAGTGAGGG - Intronic
1108902489 13:55429418-55429440 CATGCAGAGTAGGAGGTGGAAGG - Intergenic
1109416403 13:62046569-62046591 CCTGCAGAGCAGGGGAGGGTGGG + Intergenic
1110214844 13:73014045-73014067 AGTGGAGGGGAGGGGAGGGAAGG - Intronic
1111891552 13:94088593-94088615 AGAGGAGAGGAGGGGAGGGAAGG + Intronic
1112070718 13:95846411-95846433 CGTGCAGAGGGGAGGAGGGGAGG + Intronic
1112210895 13:97375917-97375939 CGTGAAGAGGAGGATATGGTGGG + Intronic
1112485439 13:99815307-99815329 GGTGTAGATGAGGGGATGGATGG + Intronic
1112562340 13:100525801-100525823 CCTGCAGAGGAAGGGCTGGGTGG + Intronic
1113457475 13:110458749-110458771 CCTGCAGAGGAGGGAGAGGAGGG - Exonic
1114258667 14:21022698-21022720 AGAGAAGAGGAGGGGAAGGAAGG + Intronic
1114636111 14:24187827-24187849 TGTGCAGAGGAAGGTATTGAAGG - Intronic
1119123030 14:72097671-72097693 CCGGCAGAGGAGGGGGAGGAAGG - Intronic
1120335730 14:83151754-83151776 AGGGAAGAGGAGGGGGTGGAAGG + Intergenic
1120723842 14:87916419-87916441 CTGGCAGAGGCGGGGCTGGAGGG + Intronic
1121212017 14:92214240-92214262 CGTGCAGAGGTGAGACTGGAGGG - Intergenic
1121249610 14:92489800-92489822 TTTGCAGAGGAGGGGATGAGCGG - Intronic
1121447476 14:93988058-93988080 AGAGGAGAGGAGGGGATGAAAGG + Intergenic
1122164022 14:99807665-99807687 GGAGCAGTGGAGGGGAAGGAGGG - Intronic
1122425439 14:101602701-101602723 AGGGAAGAGGAGGAGATGGAGGG + Intergenic
1122867506 14:104614046-104614068 CCTGCAGAGGGGTGAATGGATGG + Intergenic
1122958282 14:105082972-105082994 GGTGGAGAGGAGTGGATGGGTGG - Intergenic
1123434899 15:20247793-20247815 AGAGGAGAGGAGGGGAAGGATGG + Intergenic
1124007464 15:25806203-25806225 CGTGCTGAGGAGGAAGTGGAGGG - Intronic
1124420460 15:29516591-29516613 AGAGCAAAGGAGGGGATGGGGGG + Intronic
1125744775 15:41990720-41990742 AGGGAAGAGGAGGGGAGGGAGGG - Intronic
1126531593 15:49716593-49716615 AGAGCAGAGGTGTGGATGGAAGG + Intergenic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1127117010 15:55738845-55738867 TAGGCAGAGGAGGGGAGGGAAGG + Intronic
1128211978 15:65909348-65909370 CCTGCAGAGGGAGGGAGGGAGGG - Intronic
1128311047 15:66631983-66632005 TGTGCAGAGGAAGGAAGGGATGG + Intronic
1128355581 15:66924073-66924095 TGTGAAGAGAAGGGGAGGGAAGG - Intergenic
1128388470 15:67166912-67166934 GGCGAAGAGGAAGGGATGGAAGG - Intronic
1128744370 15:70103202-70103224 TGTGCAGGAGAGGGGAAGGAAGG + Intergenic
1128950042 15:71869664-71869686 AGGGGAGAGGAGGGAATGGAAGG + Intronic
1128987263 15:72230677-72230699 CTTGAAGAGGAGGGGGTGGAAGG + Intronic
1129691647 15:77717353-77717375 CGGGCAGAGGTGGGGGTGGCAGG + Intronic
1129704500 15:77786582-77786604 CATGCAGAGGAGGGAGGGGATGG + Intronic
1130951732 15:88596220-88596242 AGGGAAGAGGAGGGGAGGGAGGG - Intergenic
1131060334 15:89400256-89400278 CGGGCCGGGGAGGGGGTGGAGGG + Intergenic
1131515978 15:93077036-93077058 CGGGCAAGGGAGGGGATGGCAGG + Intronic
1131821337 15:96277538-96277560 CGTGAAGAGGACGGGGTGGATGG - Intergenic
1132563147 16:607906-607928 CGGGCAGTGGAGGGGGAGGAAGG - Intronic
1132567977 16:631841-631863 AGTGGATAGGAGAGGATGGAAGG - Intronic
1132567994 16:631913-631935 AGTGGATAGGAGAGGATGGAAGG - Intronic
1133039761 16:3054303-3054325 TGCACAGAGGCGGGGATGGATGG + Intronic
1133039767 16:3054335-3054357 TGCACAGAGGTGGGGATGGATGG + Intronic
1133039803 16:3054571-3054593 TGCACAGAGGCGGGGATGGATGG + Intronic
1133039819 16:3054675-3054697 TGCACAGAGGTGGGGATGGATGG + Intronic
1133039825 16:3054707-3054729 TGCACAGAGGCGGGGATGGATGG + Intronic
1133039836 16:3054775-3054797 TGCACAGAGGCGGGGATGGATGG + Intronic
1133039842 16:3054807-3054829 TGCACAGAGGCGGGGATGGATGG + Intronic
1133088999 16:3389208-3389230 CTGGCAAAGGAGGGGAGGGATGG + Intronic
1133331846 16:4979805-4979827 GATGCAGGGAAGGGGATGGAGGG - Intronic
1133638419 16:7693220-7693242 TGTACAGATGAGGGGAGGGAAGG - Intronic
1134000699 16:10780658-10780680 TTTGCAGAAGAGGAGATGGAGGG - Intronic
1134332680 16:13265163-13265185 TGGGAAGAGGAGGGGAGGGAAGG - Intergenic
1134415646 16:14041156-14041178 CGGGGAGAGGAGGGGAGGGGAGG + Intergenic
1134799486 16:17071458-17071480 AGGGCAGAGGAGGGGAAAGAGGG - Intergenic
1134925851 16:18159044-18159066 AGAGGAGGGGAGGGGATGGAAGG + Intergenic
1135128343 16:19830393-19830415 CCTGCAGCAGAGGGGCTGGAGGG + Intronic
1135517650 16:23149095-23149117 CGTGCAGAGGAGGGCGAGGAGGG + Exonic
1136139069 16:28277124-28277146 CTTGCAGAGGAGAGGGTCGAAGG + Intergenic
1136343814 16:29662923-29662945 GGTGCAGAGGAGGAGGTGGGAGG - Intergenic
1136610574 16:31362804-31362826 GGGGCAGAGGAGAGGATGGAGGG + Intronic
1136672925 16:31874109-31874131 CTTGCAGCGGAGGGGACCGAGGG - Intronic
1137402116 16:48162419-48162441 GGAGCAAAGGAGAGGATGGATGG + Intergenic
1137633119 16:49962050-49962072 CCTGCAGAGAAGGGAATGCAGGG - Intergenic
1138008517 16:53358055-53358077 GGGGCAGGGGAGGGGATGGGAGG - Intergenic
1138460588 16:57145526-57145548 CGTGTTGAGTAGGGAATGGAGGG + Intronic
1138756366 16:59490942-59490964 CCTGCAGGGGAGGGGGAGGAAGG - Intergenic
1139004232 16:62551423-62551445 AGGGGAGGGGAGGGGATGGAAGG - Intergenic
1139363638 16:66419324-66419346 TGTGGAGAGGAGGGGAGGGAAGG + Intergenic
1139443128 16:66979112-66979134 CGTGCAGAAGTGGAGATGGGGGG - Intergenic
1140588769 16:76326406-76326428 CTTGCCCAGCAGGGGATGGACGG + Intronic
1140600696 16:76471641-76471663 CATGGAGAAGAGGGGAGGGAAGG - Intronic
1140914568 16:79482835-79482857 AGGGGAGGGGAGGGGATGGAGGG - Intergenic
1140931855 16:79635129-79635151 CGAGAAGAAGAGGGGAAGGACGG - Intergenic
1141263678 16:82476245-82476267 ACTGCAGAGGAGGAGAAGGAGGG - Intergenic
1141888596 16:86910743-86910765 AGGGCAGGGGAGGGGGTGGAGGG - Intergenic
1142605530 17:1079026-1079048 CGTGGCGAGGAGAGGAGGGAAGG + Intronic
1142614707 17:1127545-1127567 GAAGCACAGGAGGGGATGGAAGG + Intronic
1143410199 17:6704056-6704078 CCTGCAGAGGAGGGGCAGGGAGG + Exonic
1143671220 17:8397434-8397456 TGTGCTGAGGTGGGGATGGGGGG - Intronic
1144004563 17:11088556-11088578 CCTGCAGAGCAGGTAATGGATGG + Intergenic
1144582425 17:16466420-16466442 AGTGCACAGGAGGGGCTGCAGGG - Intronic
1144685255 17:17221827-17221849 CTTGGAGGGGAGGGGATGCAAGG + Intronic
1144877778 17:18411367-18411389 GGTGGAGAGAAGGAGATGGAAGG - Intergenic
1145154443 17:20533022-20533044 GGTGGAGAGAAGGAGATGGAAGG + Intergenic
1146402534 17:32511150-32511172 CGTGAAGAGAAGGGGAGGAAAGG - Intronic
1146581820 17:34045203-34045225 GGTAAAGAAGAGGGGATGGAGGG - Intronic
1147668356 17:42162947-42162969 CTTGCAGAGGAGGGGATGCTTGG - Intronic
1148335124 17:46835816-46835838 GGTGCAGAGGTGGGGAGTGAAGG - Intronic
1148340683 17:46871848-46871870 TGGGGAGAGAAGGGGATGGAAGG - Intronic
1149289382 17:55201406-55201428 AGGGGAGAGGAGGGGAGGGAAGG + Intergenic
1149571281 17:57674096-57674118 GGTGGAGAGAAGGGGATGGAGGG - Intronic
1150703714 17:67469298-67469320 TGTGCAGAGAAGGGGGAGGATGG - Intronic
1151153830 17:72110613-72110635 AGAGCTGAGGAGTGGATGGAAGG + Intergenic
1151192409 17:72408109-72408131 GGTGGAGGGGAGGGTATGGAAGG - Intergenic
1151393103 17:73801227-73801249 CAGGCAGGGGAGGGAATGGAAGG - Intergenic
1151441247 17:74130583-74130605 CGTGCAGAGCAGGAGCTGGACGG + Intergenic
1152018121 17:77765367-77765389 TGTGCAGATGGGCGGATGGAGGG + Intergenic
1152067047 17:78117699-78117721 GGTGCAGAGGACGGGCTGGGAGG - Intronic
1152115213 17:78382218-78382240 GGTACCGAGTAGGGGATGGAGGG + Intronic
1152795601 17:82304640-82304662 GGGGGAGGGGAGGGGATGGATGG - Intergenic
1153489917 18:5636206-5636228 CGTGCTGAGGAGGGGACAGGTGG - Intergenic
1155746559 18:29361976-29361998 CGCGCAGGGGAGGGGCTGGGGGG - Intergenic
1155830223 18:30507666-30507688 CCTGCAAAGGAGCTGATGGAGGG - Intergenic
1157194081 18:45606224-45606246 AGGGGAGAGGAGGGGAGGGATGG - Intronic
1157452846 18:47801200-47801222 CCTGCAGTGGGGGGGTTGGAGGG - Intergenic
1157553055 18:48594586-48594608 GGGGCAGAGGCCGGGATGGAGGG - Intronic
1157579038 18:48762884-48762906 CATGCAGAGGAGAGGGTGGGTGG - Intronic
1157831368 18:50859779-50859801 CCTGCAGAGGAGGAGATGGAAGG - Intergenic
1158259135 18:55588239-55588261 CGGGGAGGGGAGGGGACGGAGGG + Intronic
1158642984 18:59219495-59219517 AGTGGAGAGGAGGGGAAGGGAGG + Intergenic
1158873201 18:61708890-61708912 GGTAAAGAGGAGGGGATGAAGGG - Intergenic
1159078124 18:63704289-63704311 TGTGCAGAGGTGTGTATGGATGG - Intronic
1159857208 18:73603440-73603462 CGTGCATAGGAAGGGAAGGAAGG - Intergenic
1159946857 18:74450443-74450465 AGTGCTGAGGAGGGGAGGGCGGG + Intronic
1160659450 19:291424-291446 CGCGGAGAGGAGGGGAGGGGCGG + Intronic
1160874050 19:1289049-1289071 CGTGCAGCGGTGGGGAAGGGTGG + Intronic
1160975449 19:1790340-1790362 TGGGCAGTGGAGGGGAAGGATGG - Intronic
1161039343 19:2101717-2101739 CGTCCGGGGGAGGGGAAGGAAGG - Exonic
1161274307 19:3407011-3407033 CGAGGGGAGGAGGGGAGGGAGGG + Intronic
1161419966 19:4171334-4171356 CTTGCAGGGGAGGGGAGGGAGGG + Intronic
1161578054 19:5065761-5065783 CGTGCAGAGGAGGGGATGGATGG - Intronic
1161635897 19:5388701-5388723 CGGGCAGGGGAGGGGAGGCAAGG + Intergenic
1162053444 19:8049360-8049382 TGTGCAAAGGAGGAGATTGAGGG - Intronic
1162752664 19:12838444-12838466 CGGGCAGGGGAGGGCAGGGAAGG - Intronic
1162798478 19:13098545-13098567 AGTGCAGAGACGGGGGTGGAGGG - Intronic
1162876811 19:13626659-13626681 AGGGGAGAGGAGGGGAGGGAAGG + Intergenic
1162936625 19:13984598-13984620 CATGGAGGGGATGGGATGGATGG - Intronic
1163104378 19:15115112-15115134 CTCCCTGAGGAGGGGATGGAGGG - Exonic
1163784850 19:19269766-19269788 CTTCCTGAGCAGGGGATGGAGGG + Exonic
1165101382 19:33440524-33440546 CGGGCAGAGGAGAGGACTGAAGG - Intronic
1165379441 19:35467933-35467955 TCTGCAGAGGAGGTGATGGAAGG - Intergenic
1165927540 19:39336143-39336165 CTGGCAGATGAGGGGAAGGAAGG - Exonic
1166731635 19:45062254-45062276 GGTGCTGAGGAGGGGATGGGAGG + Intronic
1166755616 19:45189143-45189165 GTGGCAGAGGAGGGGATGGATGG - Intronic
1166791746 19:45402810-45402832 GGTGCAGAGGAGGCCAGGGAAGG - Intronic
1167250533 19:48396449-48396471 GAGGCAGAGGAGGGGCTGGAGGG + Intronic
1168018955 19:53594962-53594984 CGCACTGAGGAGGGGATGGATGG - Intergenic
1168248063 19:55124269-55124291 TGGGGAGAGGAGGTGATGGAAGG - Intergenic
1168299614 19:55396572-55396594 AGTGGAGGGGAGGGGAGGGATGG - Intronic
925326302 2:3024480-3024502 GGTGCAGAGGAGGGGAAGAGAGG + Intergenic
925363281 2:3294563-3294585 TGTGCAGAGGATCGGCTGGATGG - Intronic
925363606 2:3296154-3296176 CAGGGAGAGGAGGGGCTGGATGG - Intronic
925363675 2:3296473-3296495 TGTGGAGAGGATGGGTTGGATGG - Intronic
925881067 2:8353008-8353030 AGAGGAGAGGAGGGGAGGGAAGG + Intergenic
925881076 2:8353028-8353050 AGGGGAGAGGAGGGGAGGGAAGG + Intergenic
925881085 2:8353048-8353070 AGGGGAGAGGAGGGGAGGGAAGG + Intergenic
925881102 2:8353088-8353110 AGGGGAGAGGAGGGGAGGGAAGG + Intergenic
925900106 2:8503107-8503129 AGCGCAGAGGAGGGGAAGCAGGG - Intergenic
926337491 2:11875231-11875253 AGGGAAGAGGAGGGGAAGGAAGG - Intergenic
926440364 2:12882692-12882714 AGGGGAGAGGAGGGGAGGGAAGG - Intergenic
926715212 2:15918958-15918980 CGGGCAGGGTTGGGGATGGAGGG + Intergenic
926861404 2:17313608-17313630 CGTTTGGAGGAGGGGGTGGATGG + Intergenic
927209365 2:20629383-20629405 AGTGCAGAGGGCGGGCTGGAGGG - Intronic
927843913 2:26461674-26461696 GGTGCAGAGCAGGGCAGGGATGG - Exonic
928033181 2:27798620-27798642 AGTGTAGAGGATGGGCTGGAAGG - Intronic
928115597 2:28543337-28543359 CGTGCTGAGGAGGGGCTGCAGGG + Intronic
928238750 2:29568617-29568639 CTTACAGAGCAGGGGAGGGAAGG - Intronic
928264741 2:29802290-29802312 AGAGAAGAGGAGGGGAGGGAAGG + Intronic
928879199 2:36078181-36078203 CGTGCAGAGGAGAGGAGTGTTGG + Intergenic
929451140 2:42038260-42038282 AGTGAAGGGGAGGGGATGGGGGG + Intergenic
929539977 2:42811589-42811611 CGTTCAGAGAAATGGATGGAGGG + Intergenic
929800213 2:45093295-45093317 CAGGTAGAGGAGGGCATGGAGGG + Intergenic
929892744 2:45932082-45932104 TGAGCAGAAGAGAGGATGGAGGG - Intronic
931939925 2:67241005-67241027 GGTTGAGAGGAGGGGAGGGATGG + Intergenic
932574720 2:72956315-72956337 TGGGCAGTGGAGGGGCTGGAGGG - Intronic
932697434 2:73968526-73968548 CAAGCAGAGGAGGGTTTGGAAGG - Intergenic
933179990 2:79216627-79216649 CATGCAGAGAAGGGGTTGGGGGG + Intronic
933748614 2:85588760-85588782 CAGGCAGAGGATGGGAGGGATGG - Intronic
933795275 2:85914605-85914627 GGTGGAGAGGAGGGTCTGGAGGG - Intergenic
934555829 2:95286660-95286682 AGGGGAGAGGAGGGGAGGGAAGG - Intronic
935231528 2:101102044-101102066 AGTGGAGAGGAGGGGAGGGAAGG + Intronic
935307837 2:101754870-101754892 TGTGAAGATGAGGGGAAGGAAGG + Intronic
936855123 2:116948367-116948389 GAGGGAGAGGAGGGGATGGAGGG + Intergenic
937435280 2:121874938-121874960 AGTACAGAGGAGGGAATGAATGG - Intergenic
937989877 2:127656362-127656384 TGTGCTGAGGAGAGGATGTAAGG - Intronic
938221942 2:129576573-129576595 CTTGCAGAGGAGGAGGAGGAGGG - Intergenic
938957703 2:136314602-136314624 AGGGGAGAGGAGGGGAGGGAAGG - Intergenic
938957712 2:136314622-136314644 AGGGGAGAGGAGGGGAGGGAAGG - Intergenic
938957721 2:136314642-136314664 AGGGGAGAGGAGGGGAGGGAAGG - Intergenic
938957730 2:136314662-136314684 AGGGGAGAGGAGGGGAGGGAAGG - Intergenic
938957739 2:136314682-136314704 AGGGGAGAGGAGGGGAGGGAAGG - Intergenic
938957760 2:136314727-136314749 AGGGGAGAGGAGGGGAGGGAAGG - Intergenic
939237268 2:139512210-139512232 TGGATAGAGGAGGGGATGGATGG - Intergenic
939306782 2:140421912-140421934 CCTGCAGACGAAGGGATGAAGGG + Intronic
940177491 2:150894844-150894866 GGTGCAGAGGATGGGAAAGAAGG + Intergenic
940240727 2:151560537-151560559 AGAGCAGGGGAGGGGAGGGAGGG + Intronic
942655274 2:178208661-178208683 AGGGGAGAGGAGGGGATGGGAGG - Intronic
942784896 2:179689464-179689486 CGTGCAGAGCAGCGCATGGAGGG + Intronic
942927845 2:181455652-181455674 CATGCAGATGGGGGCATGGATGG - Intergenic
943404386 2:187461677-187461699 CGTCCAGAGGAGGGGATCAGCGG + Intergenic
946165057 2:217858712-217858734 CGTGCAGGAGAGTGGAGGGAGGG - Intronic
946331237 2:219010275-219010297 AGTGAAGAGGGTGGGATGGAGGG + Intronic
946558771 2:220889527-220889549 AGTGAGGAGGAGGGGCTGGAGGG - Intergenic
946589820 2:221232885-221232907 AGGGAAGAGGAGGGGAGGGAAGG + Intergenic
947679832 2:232020386-232020408 GATGGAGAGGAGTGGATGGATGG + Intronic
948458374 2:238117774-238117796 TGAGCAGAGGAAGGGATGGATGG + Intronic
948506143 2:238427981-238428003 GGTGCAGAGGGAGGGATGGATGG - Intronic
948601579 2:239110801-239110823 CCTGCAGGGGAGAGGAGGGAAGG - Intronic
948657397 2:239485143-239485165 CATGGCGAGGAGGGGAGGGAGGG + Intergenic
948683878 2:239658696-239658718 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948683889 2:239658728-239658750 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948683900 2:239658760-239658782 GGAGCAGAGGAGAGGAGGGAAGG - Intergenic
948683919 2:239658822-239658844 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948683931 2:239658854-239658876 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948683942 2:239658886-239658908 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948683954 2:239658918-239658940 GGAGCAGAGGAGAGGAGGGAAGG - Intergenic
948683973 2:239658980-239659002 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948683985 2:239659012-239659034 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948683996 2:239659044-239659066 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948684007 2:239659076-239659098 GGAGCAGAGGAGAGGAGGGAAGG - Intergenic
948684026 2:239659138-239659160 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948684038 2:239659170-239659192 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948684050 2:239659202-239659224 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948684061 2:239659234-239659256 GGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948684073 2:239659266-239659288 GGAGCAGAGGAGAGGAGGGAAGG - Intergenic
948684092 2:239659328-239659350 AGAGCAGAGGAGAGGAGGGAGGG - Intergenic
948768814 2:240236913-240236935 GGTGCAGGGGAGGGGCAGGAGGG - Intergenic
948857670 2:240737593-240737615 AGAGCAGAGGAGGGGAGGGATGG + Intronic
948862642 2:240760350-240760372 GGTGCAGTGGAGGGGAGGGCAGG - Intronic
1169310271 20:4532133-4532155 CTTGCAAAGAAGAGGATGGAAGG - Intergenic
1169344215 20:4817625-4817647 CCTGGAGAGGTGGGGAGGGAGGG - Intronic
1170126327 20:12968188-12968210 AGTGGAGAGTAGGGGATGGGAGG - Intergenic
1170451017 20:16483816-16483838 CTTGGAGAGGAGGGGGTGGTTGG - Intronic
1170834548 20:19872479-19872501 CGTGCATAGGAGTGTATGGTAGG - Intergenic
1170927748 20:20741351-20741373 CATGCAGAGGCTGGGCTGGAAGG - Intergenic
1171249725 20:23638307-23638329 AGGGGAGGGGAGGGGATGGATGG - Intronic
1171384792 20:24763028-24763050 CTGGCAGAGGAGGGGAAGGTGGG + Intergenic
1171990081 20:31689274-31689296 AGGGCAGGGGAGGGGAGGGAAGG + Intronic
1172056073 20:32155204-32155226 CTTGCTGGGGAGGGGCTGGAAGG - Intronic
1172193840 20:33078445-33078467 GGTGATGAGGAGGGGATGGAAGG + Intergenic
1173427842 20:42958287-42958309 AGGGGAGAGGAGGGGAGGGAAGG + Intronic
1173509971 20:43619591-43619613 AGTGGAGAGGAGGGGCTGGTAGG + Intronic
1173546097 20:43899504-43899526 GGTGCAGAGGAGGGGCAGGAGGG - Intergenic
1173892172 20:46521064-46521086 AGGGCAGAGGAGGGGAGGGGAGG + Intergenic
1174146306 20:48455037-48455059 CGTGGGGAGGAAGGGAGGGAGGG + Intergenic
1174178556 20:48659992-48660014 CATGCTGACGAGGAGATGGAGGG - Exonic
1174279735 20:49430514-49430536 TGTGTAGATGAGTGGATGGATGG - Intronic
1174358144 20:50011730-50011752 CGAGGAGGGGAGGGGAGGGAAGG + Intergenic
1174426318 20:50433991-50434013 CCTGCAGGGGAGGGGAGGGGAGG - Intergenic
1174468035 20:50732000-50732022 CTTGCCGAGGAGGGGGTGGCGGG + Intronic
1174804748 20:53594690-53594712 CTTGCAGAGGAGGGGGCGGCGGG - Intronic
1175278575 20:57788004-57788026 GGTGGAGAGGAGGGGATGGAGGG + Intergenic
1175315595 20:58044521-58044543 GGAGCAGAGAAGGGGAAGGACGG + Intergenic
1175831652 20:61967816-61967838 GGTGCAGGGAAGGGGAAGGAGGG - Intronic
1176733293 21:10521210-10521232 CTTGCAGAGGAGGGGGCGGCGGG + Intergenic
1178370544 21:32023509-32023531 AGTGCACAGTAGGGGATGAAGGG + Intronic
1178484619 21:33010828-33010850 CATGGAGAAGAGGGGAGGGATGG - Intergenic
1178922774 21:36749571-36749593 CATGCAGCGAAGGGGCTGGATGG + Exonic
1179008074 21:37531767-37531789 AGGGCAGAGGAGGGGAGGAAGGG + Intergenic
1179338971 21:40486507-40486529 AGAGGAGAGGAGGGGATGGCAGG + Intronic
1179427639 21:41294652-41294674 AGTGCAGGGGAGGGGCTGGAAGG - Intergenic
1180748912 22:18111111-18111133 CGTGCAGACGAGGGGGAGGGAGG + Intronic
1181282244 22:21728236-21728258 CATGGAGAGGAGGGGAAGGAAGG - Intronic
1181325201 22:22039659-22039681 CATGCTGAGGAGGGGCTGGTAGG - Intergenic
1181497372 22:23295165-23295187 CGGGCAGGGGAGGGTAGGGATGG - Intronic
1182362060 22:29752461-29752483 TGGGCAGAGGAGGGCATGGGTGG - Intronic
1182737637 22:32542235-32542257 TGTGTAGAGGATGGAATGGATGG + Intronic
1183225519 22:36547290-36547312 AGAGCAGTGGAGGAGATGGAGGG + Intergenic
1183314370 22:37128894-37128916 AGTCCAGAGGAAGGGGTGGAGGG - Intronic
1183325328 22:37188287-37188309 GGGAGAGAGGAGGGGATGGAGGG + Exonic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183535720 22:38399235-38399257 CTTGCAGAGGAGGGGGCGGCGGG - Intergenic
1183730304 22:39614772-39614794 CATGCAAAGGAGGGCAGGGAGGG - Intronic
1183834660 22:40442513-40442535 CGGGCAGATGGAGGGATGGATGG - Intronic
1184028817 22:41878771-41878793 CTTGCAGAGGTGGGGAGGGCAGG - Intronic
1184211071 22:43035832-43035854 TGTGCAAAGGAGGTGAAGGATGG + Intergenic
1184557475 22:45240998-45241020 CGTTCAGAGGCGGGGCGGGAGGG - Intergenic
1184883959 22:47330816-47330838 GGAGAAAAGGAGGGGATGGAAGG - Intergenic
1184964628 22:47962195-47962217 TGTGCAGATGTGTGGATGGATGG + Intergenic
1185024199 22:48398317-48398339 GGTGGAGCTGAGGGGATGGATGG - Intergenic
1185031702 22:48447003-48447025 CGAGCTGAGGAAGGAATGGATGG - Intergenic
1185099358 22:48829448-48829470 CCTGGAGAGGAGGGTGTGGACGG - Intronic
1185103684 22:48855300-48855322 TGGACAGATGAGGGGATGGATGG - Intergenic
949601834 3:5607770-5607792 GGTGCAGAGCAATGGATGGAAGG + Intergenic
950199720 3:11034500-11034522 GGTGGAGGGGAGGGGAGGGAGGG - Intronic
950640505 3:14345382-14345404 GGTGCAGCGGAGCGCATGGAAGG + Intergenic
951164449 3:19467951-19467973 GGTGGGGAGGAGGGGAGGGAGGG - Intronic
953740853 3:45537896-45537918 CTCTCAGAGGAGGGGAAGGAAGG + Intronic
954070914 3:48142347-48142369 TGAGCGGAGGAGGGGATGGGTGG - Intergenic
954646706 3:52136025-52136047 AGTGCAGAGGTGGGGAAAGAGGG + Intronic
954795598 3:53160076-53160098 AGGGCAGAGGAGAGGCTGGATGG - Intronic
955514015 3:59708881-59708903 CGGGTAGAGGAGGGTATTGATGG + Intergenic
955856629 3:63279101-63279123 CGTGGGGATGAGGGGATGGGTGG + Intronic
957740727 3:84265003-84265025 AGGGCAGGGGAGGGGATGGAGGG - Intergenic
958814575 3:98901543-98901565 AGCGCAGGGGAGGGGAGGGAAGG + Exonic
959010860 3:101074406-101074428 CATGTAGTGGAAGGGATGGAAGG + Intergenic
960222355 3:115128723-115128745 AGGGCAGTGGAGGGGAGGGAAGG + Intronic
961402034 3:126654604-126654626 CGGGGAGAGGAGAGGACGGACGG + Intronic
961409364 3:126707523-126707545 TGTGGAGAGGAGGAGAGGGAAGG - Intronic
961742391 3:129040835-129040857 GGGGCAGAGGAGGAGGTGGAGGG + Intergenic
962368020 3:134798370-134798392 GGGGCAGAGGAGGGGAGGGGAGG + Intronic
962453378 3:135540755-135540777 GGTGGAGAGGAAGGGAAGGAAGG - Intergenic
962600024 3:136984643-136984665 AGAGCAGAGGAGGGAAGGGATGG + Intronic
965485443 3:169272903-169272925 AGGGCAGAGGAGGGGAGGCAGGG + Intronic
967326992 3:188250973-188250995 AGGGCAGGGGAGGGGAGGGAAGG - Intronic
968131165 3:196193772-196193794 CATGCAGAGGAATGGCTGGAGGG - Intergenic
968178693 3:196573536-196573558 CGAGGAGAGAAGGGGATGGCTGG + Intronic
968199480 3:196740046-196740068 CGGGGAGGGGAGGGGAGGGAAGG - Exonic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968763531 4:2455974-2455996 AGTTCAGAGGAGGAGATGAAAGG - Intronic
969175957 4:5399302-5399324 CCTGCAGAGGTGGGGAAGGAGGG - Intronic
969291329 4:6241810-6241832 AATGCAGAGGAAGGGAGGGAGGG + Intergenic
969568772 4:7995842-7995864 GGTGCCGAGGAGGGGCTGGGAGG - Intronic
969717964 4:8877533-8877555 CATGGAGAGGAGGGGAGGGATGG + Intergenic
969978999 4:11135036-11135058 GGGGGAGAGGAGGGGAGGGAAGG - Intergenic
969979029 4:11135104-11135126 AGTGGAGGGGAGGGGAGGGAGGG - Intergenic
970888802 4:21018506-21018528 CCTGTAGAGGATGCGATGGAAGG + Intronic
973611812 4:52643161-52643183 CAGCCAGAGGAGGAGATGGAGGG - Intronic
973708376 4:53601901-53601923 TATGCAGAAGAGGGGATGCAGGG - Intronic
973982233 4:56316170-56316192 CGTGGAGAGAAAGAGATGGAGGG + Exonic
974192391 4:58523040-58523062 AGTGCAGGGGAGGGGAGGGGAGG - Intergenic
974941248 4:68471277-68471299 AGTGAAGAGAAGGGAATGGAGGG - Intronic
975867395 4:78738041-78738063 AGTGAAGAGGAGGGGAGGGGAGG + Intergenic
976281632 4:83332585-83332607 GGTGCAGAGGAGGGGAAAAAAGG + Intronic
976387667 4:84480190-84480212 CCTGCAGAGGCAGGGAGGGAAGG + Intergenic
976818939 4:89182837-89182859 CCTGGAGATGAGGGGATGGATGG - Intergenic
980638078 4:135535878-135535900 AGAGGAGAGGAGGGGAGGGAAGG + Intergenic
980873874 4:138641034-138641056 CTTGAAGAGAAGGGGCTGGAAGG - Intergenic
981762567 4:148210046-148210068 CCAGGAGAGGAGGGAATGGAAGG - Intronic
984628912 4:182039914-182039936 AGGGGACAGGAGGGGATGGAAGG + Intergenic
985693522 5:1326766-1326788 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693603 5:1327259-1327281 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693616 5:1327346-1327368 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693621 5:1327375-1327397 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693635 5:1327462-1327484 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693646 5:1327520-1327542 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693755 5:1328245-1328267 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693760 5:1328275-1328297 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985890244 5:2709866-2709888 GCTGGAGAGGAGGTGATGGAGGG - Intergenic
985928452 5:3035896-3035918 CGGGCAGAGGAGGGGAGGAGAGG - Intergenic
986201105 5:5579481-5579503 TGGGCAGAGGAGGGAATGGAGGG + Intergenic
986254137 5:6087861-6087883 TGGGCCGGGGAGGGGATGGATGG - Intergenic
986278645 5:6304479-6304501 GGTCCAGAGGAGGGAAGGGAAGG + Intergenic
986924913 5:12734907-12734929 CGTGCAGAGGAAGGGCCTGAGGG - Intergenic
987087514 5:14484034-14484056 GGTGCAGTGCAGGGGATGGGTGG - Intronic
987493236 5:18608629-18608651 CGTGCAGAGGTTGAGATGGGAGG - Intergenic
988680633 5:33481023-33481045 AGGGGAGGGGAGGGGATGGAGGG - Intergenic
988680735 5:33481311-33481333 GATGAAGGGGAGGGGATGGAAGG - Intergenic
988915964 5:35893317-35893339 AGTGCAGTGGAGGGGCTGAAGGG + Intergenic
989190602 5:38666466-38666488 GTAGTAGAGGAGGGGATGGAGGG + Intergenic
990333067 5:54746211-54746233 CTTGCTGAGGAGTGGATGGGTGG + Intergenic
995822317 5:116250689-116250711 AGTGCAGAGGAGGAGATGGGAGG + Intronic
996603769 5:125296727-125296749 AGTGTGGAGGAGGGGATGGAGGG + Intergenic
996623217 5:125536266-125536288 AGGGCAGAGGAGGAAATGGAGGG - Intergenic
997592879 5:135086422-135086444 GGTGCAGTGAGGGGGATGGAGGG + Intronic
998203991 5:140146249-140146271 AGGGCAGCGGAGGGGAGGGAGGG - Intergenic
998359653 5:141573875-141573897 CAGGCAAAGGAGGGGGTGGAGGG + Exonic
998425548 5:142025134-142025156 CGAGCAGCGGAGGGGACCGAGGG + Intergenic
999062411 5:148650677-148650699 GGTGCAGGGGAGAGGAAGGATGG - Intronic
999726868 5:154445422-154445444 CATGCGGAGGAGGTGATGGGGGG - Intergenic
1001031344 5:168265591-168265613 CGAGCACAGGAGAGGATGGCAGG + Intergenic
1001131754 5:169069967-169069989 CGTGCAGTGCAGAGGATGGTGGG + Intronic
1001306539 5:170578496-170578518 TGTGCACATGAGGAGATGGAAGG + Intronic
1001529800 5:172454089-172454111 CGGGGAGGGGAGGGGAGGGAGGG + Intronic
1001813469 5:174648227-174648249 TGTGCAGTGGAGTGGATGGTGGG + Intergenic
1002188617 5:177467668-177467690 CGTGCTGGGGTGGGGATGGCGGG - Intronic
1002375577 5:178786641-178786663 CTTCCAGAGGCGGGGATGGCTGG + Intergenic
1002496711 5:179619255-179619277 AGGGCACAGGTGGGGATGGATGG - Exonic
1002842406 6:917617-917639 TGTCAAGAGGAGGAGATGGATGG + Intergenic
1004185334 6:13416512-13416534 TGTGGAGAGGAGGGGCTTGATGG + Intronic
1004511203 6:16285851-16285873 GGTGCAGAGGGAGGGAAGGAAGG + Intronic
1004632296 6:17433523-17433545 AGGGCAGAGGAGAGGGTGGAAGG + Intronic
1005155771 6:22804685-22804707 CGAGAAGAGGAGGGGAGGGGAGG + Intergenic
1005310681 6:24556169-24556191 AGGGCAGAGGAGGGGAGGGGAGG - Intronic
1006337365 6:33427752-33427774 CCTGCTCAGGAGGGGATGGTGGG + Intronic
1007071977 6:39044715-39044737 AGTGGAGAGGAGGAGAGGGAAGG - Intergenic
1007593718 6:43038734-43038756 AGTGGAGAGAAGAGGATGGAGGG + Intronic
1007959628 6:45947030-45947052 GGTGGAGAGGAGGGAGTGGAGGG + Intronic
1007995612 6:46304698-46304720 GGTGGAGAGGAGGGGAAGGGAGG + Intronic
1008003308 6:46383906-46383928 AGGGCAGAGGAGGGGAAGGCAGG - Intronic
1008401781 6:51071712-51071734 CATGCAGTGGAGGAGATAGAAGG - Intergenic
1010927845 6:81765110-81765132 CATGCAGAGGAAGGGAGAGATGG + Intergenic
1014416439 6:121190365-121190387 TGTGCAGAGGAGAGGTGGGAAGG - Intronic
1014494355 6:122102165-122102187 AGTGGAGAGGAGGGAAGGGAAGG + Intergenic
1014677002 6:124379174-124379196 AGGGAAGAGGAGGGGAGGGAGGG + Intronic
1016372951 6:143393297-143393319 CCTGGAGAGGAGGAGAAGGAAGG + Intergenic
1017432270 6:154382630-154382652 AGGGCAGGGGAGGGGAGGGAAGG + Intronic
1017797936 6:157864656-157864678 CGGGCAGGGGACGGGCTGGAAGG - Intronic
1018628818 6:165805102-165805124 CGAGCAGAGGGGCGCATGGAGGG + Intronic
1018707759 6:166475441-166475463 CGTGCAGAGTAGTGGGAGGAAGG - Intronic
1018851057 6:167590425-167590447 CCTGCATAGGAGGTGATGGTGGG - Intergenic
1019155271 6:170034288-170034310 CCTGGAGAGAAGGGGAGGGAAGG + Intergenic
1019274709 7:169939-169961 CGGGCTGAGGAGGGGCTGGCAGG - Intergenic
1019343937 7:520589-520611 CGGGAAGTCGAGGGGATGGAAGG + Intergenic
1019564399 7:1672229-1672251 GGACCAGAGGAGGGGAGGGAGGG + Intergenic
1021439390 7:20660858-20660880 AATGGAGAGGAGGGGATGGAAGG - Intronic
1022339637 7:29456192-29456214 CGTTCAGAGGAGCAGATGGGAGG - Intronic
1023062718 7:36343536-36343558 AGGGGAGAGGAGGGGAGGGAAGG + Intronic
1023852417 7:44157814-44157836 GGAGCAGAGGCGGGGAGGGAGGG + Intronic
1024164837 7:46720618-46720640 ACTGCAGAGAAGGGCATGGAAGG - Intronic
1025170679 7:56753876-56753898 ACTGGAGAGGAAGGGATGGATGG + Intergenic
1025231651 7:57206841-57206863 GGTGGAGGGGAGGGGAGGGAGGG - Intergenic
1025701205 7:63821823-63821845 ACTGGAGAGGAAGGGATGGATGG - Intergenic
1026788455 7:73316815-73316837 TGTGCAGGGGAGGGGATGATGGG - Intronic
1027261125 7:76465319-76465341 GGTATAGATGAGGGGATGGAAGG + Intronic
1027312507 7:76963427-76963449 GGTATAGATGAGGGGATGGAAGG + Intergenic
1027500899 7:78950051-78950073 GATGCAGAGGAGGGGAAAGAAGG - Intronic
1028581361 7:92412930-92412952 CGTGCGGAGAAGAGGAAGGAGGG - Intergenic
1028730879 7:94147025-94147047 AGTGTAGAGGAGGGGTTGTAGGG - Intergenic
1029433036 7:100544558-100544580 GTGACAGAGGAGGGGATGGAGGG - Intronic
1029442806 7:100596575-100596597 TGTGCAGAGGAGGCCAAGGAGGG + Intronic
1029604646 7:101591121-101591143 CATTTAGAGGAGGGGATGGGGGG - Intergenic
1029654611 7:101915967-101915989 TTGGCAGAGGAGGGGCTGGAGGG - Intronic
1030028653 7:105349172-105349194 AGGGGAGGGGAGGGGATGGAGGG + Intronic
1030235321 7:107253691-107253713 CGAGCAGAGCAGGGGTTGGGTGG - Intronic
1030380023 7:108800887-108800909 AGGGGAGAGGAGGGGAGGGAAGG - Intergenic
1031063223 7:117075514-117075536 CATCCAGAGGAGTGGATGGCAGG - Intronic
1032123800 7:129176112-129176134 AGAGGAGAGGAGGGGAGGGAAGG + Intergenic
1033138583 7:138804822-138804844 CTTGCAGAGGAGGAGAGGGCAGG + Exonic
1033912733 7:146285660-146285682 AGGGAAGAGGAGGGGAGGGAGGG - Intronic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1034200990 7:149282725-149282747 AGTGGAGTGGAGTGGATGGATGG + Exonic
1034291132 7:149932715-149932737 AGTGGAGGGGAGGGGAGGGAAGG + Intergenic
1034366286 7:150551420-150551442 AGTGCAGATCAGGGGAGGGATGG - Intergenic
1034867007 7:154650352-154650374 AGGGCAGAGGAGGGGAGGGGAGG + Intronic
1035226730 7:157438023-157438045 AGGGGAGAGGAGGGGAAGGATGG - Intergenic
1035226750 7:157438082-157438104 AGGGGAGAGGAGGGGAAGGATGG - Intergenic
1035305484 7:157928843-157928865 AGTGCAGAGGATAGGATGGGGGG + Intronic
1035371100 7:158379385-158379407 GGAACAGAGGAGGGGAGGGAAGG + Intronic
1035389535 7:158496229-158496251 GGTGCAGGGAAGGGGAGGGAAGG - Intronic
1035464411 7:159065277-159065299 ACTGCAGGGGAGGGGAGGGAGGG - Intronic
1035765343 8:2100703-2100725 CTTGCAGAGCAGGGTAAGGAGGG - Intronic
1037833959 8:22205344-22205366 TGTGCAGAGCCGGGGATGCAGGG + Intronic
1038421704 8:27437872-27437894 CGTGCACAGGTAGGGGTGGAGGG + Exonic
1039450920 8:37674540-37674562 GGTGGAGAGGAGGGGGAGGAAGG - Intergenic
1039486767 8:37916253-37916275 AGGGCAGAGGAAGGTATGGAAGG - Intergenic
1040355878 8:46617695-46617717 CGTGCAGAGGCGGGGCTCGCGGG + Intergenic
1040681908 8:49820748-49820770 AGGGGAGAGGAGGGGAGGGAAGG + Intergenic
1041780034 8:61568036-61568058 AGTGCAGTGGAGGGGAGGAAAGG + Intronic
1042912671 8:73844158-73844180 CGTGCAGAGGGGGAGGGGGAGGG - Intronic
1043379526 8:79687697-79687719 GGTGCAGAGGTGGAGGTGGAGGG + Intergenic
1043937332 8:86156563-86156585 CATGCTGTGGAGGGGGTGGAGGG - Intergenic
1044890234 8:96827313-96827335 AGTACAGAGGAAGTGATGGAGGG - Intronic
1045170055 8:99655633-99655655 GGGGCAGAGGATGGGAAGGATGG - Intronic
1045528428 8:102961505-102961527 AGAGCAGGGGAGGGGAGGGAAGG - Intronic
1045941917 8:107749300-107749322 TGTGCAGAGGAGGACAGGGAAGG - Intergenic
1046380540 8:113444278-113444300 GGAGCAGAGGAGGGGAGGGGAGG - Intergenic
1048465814 8:134664070-134664092 CCTGCACAGGAGGTCATGGAAGG + Intronic
1048902386 8:139051190-139051212 CGTGAAGAAGATGGAATGGAAGG + Intergenic
1049015414 8:139916503-139916525 CGTTCCGAGGAGTGGATGGAGGG - Intronic
1049073099 8:140372368-140372390 CGCGGAGGAGAGGGGATGGAGGG - Intronic
1049191298 8:141289184-141289206 GGGGCAGAGGCGGGGATGGCGGG + Intronic
1049283782 8:141763640-141763662 TGGGCAGTGGAAGGGATGGAGGG - Intergenic
1049454610 8:142680640-142680662 CACGGAGAGGAGGGGAAGGAAGG + Intronic
1049474767 8:142791732-142791754 TGGGCAGATGAGTGGATGGATGG - Intergenic
1050151312 9:2621896-2621918 GCTGCAGAGGAGGGGAGGCAAGG - Exonic
1053014527 9:34654430-34654452 CGGGGAGGGGAGGGGAGGGAAGG - Intronic
1053442990 9:38131088-38131110 AGGGCAGAGGAAGGGAGGGATGG - Intergenic
1053467350 9:38318589-38318611 GGTCCAGAGGTGGGCATGGAGGG - Intergenic
1055280715 9:74671089-74671111 AGTGAAGGAGAGGGGATGGAGGG + Intronic
1056610893 9:88125454-88125476 GGTGGAGAGGGGGGGTTGGAAGG + Intergenic
1056850117 9:90076624-90076646 GTTCCAGAGGAGGGGAGGGATGG - Intergenic
1057037276 9:91820563-91820585 TGTGGAGGGGAGGGGAGGGAGGG - Intronic
1057138980 9:92715503-92715525 CGAGCAGAGGAGGGCAGGGCAGG + Intronic
1057928019 9:99170216-99170238 CGTGCAGAGGAGGGGAGTGCAGG - Intergenic
1058944228 9:109841688-109841710 AGGGAAGAGGAGAGGATGGAGGG + Intronic
1059701011 9:116775542-116775564 AGGGGAGGGGAGGGGATGGAAGG + Intronic
1059975811 9:119715755-119715777 GGTGGAGAGGTGGGGAGGGAGGG + Intergenic
1060992544 9:127857192-127857214 CGTGGAGGGAAGGGGAGGGAGGG - Intergenic
1061226182 9:129282317-129282339 GGTCAAGAGGAGGGGGTGGACGG + Intergenic
1061662459 9:132139265-132139287 AGGGGAGAGGAGGGGAGGGAAGG + Intergenic
1061922646 9:133790643-133790665 GGTGCAGAGGAGGCCAAGGACGG - Intronic
1062023647 9:134330603-134330625 GGGGCAGAGGAGAGGAAGGAAGG - Intronic
1062051812 9:134451327-134451349 AAGGCAGAGGAAGGGATGGAGGG - Intergenic
1062076576 9:134593108-134593130 GGTGGAGAAGAGGGGATGGATGG - Intergenic
1062318178 9:135978311-135978333 GCTGCTGAAGAGGGGATGGAGGG - Intergenic
1062318227 9:135978450-135978472 GCTGCTGAGGAGGGGATGGGGGG - Intergenic
1062318284 9:135978610-135978632 GCTGCTGAGGCGGGGATGGAGGG - Intergenic
1062504423 9:136865936-136865958 CGGACCCAGGAGGGGATGGACGG - Intronic
1185581317 X:1213135-1213157 AGGGGAGGGGAGGGGATGGAGGG - Intergenic
1185726593 X:2426701-2426723 AGTGAAGAGGAAAGGATGGAAGG - Intronic
1185880564 X:3736261-3736283 TGCGCAGAGGAGGGGGTGCATGG - Intergenic
1185915035 X:4025778-4025800 AGGGAAGGGGAGGGGATGGATGG - Intergenic
1187553815 X:20332192-20332214 CTTGCAGAGGAGAGGAGGGGAGG - Intergenic
1187606249 X:20886276-20886298 CATCCAAAGGAGGGGATGGAAGG + Intergenic
1189141708 X:38613875-38613897 CGTGCAGAGGCTGGAAAGGAAGG - Intronic
1189641370 X:43075552-43075574 GGGTAAGAGGAGGGGATGGAAGG + Intergenic
1190107386 X:47570084-47570106 AGTGCAAAGGAGGGGATGTGGGG - Intronic
1190461905 X:50685089-50685111 AGTGCAGAGAATGGGTTGGAGGG + Intronic
1190581794 X:51897408-51897430 CATGGAAAGGAGGGGATAGAAGG - Intronic
1191062224 X:56310682-56310704 GGTGAAGAGCAGGGGATCGAGGG + Intergenic
1195169655 X:102253913-102253935 GGTGGGGAGGAGGGGATGGGAGG - Intergenic
1195189202 X:102433186-102433208 GGTGGGGAGGAGGGGATGGGAGG + Intronic
1196845903 X:119896479-119896501 AGGGGAGAGGAGGGGAGGGAAGG + Intronic
1197110994 X:122774809-122774831 TGAGCAGAGAAGGGGATGGTAGG - Intergenic
1201495756 Y:14590234-14590256 AGTGCAGTGGAGGGGCTGAAGGG + Intronic
1202032685 Y:20594256-20594278 CGGGAAGGGGAGGGGAGGGAAGG - Intergenic