ID: 1161579955

View in Genome Browser
Species Human (GRCh38)
Location 19:5075266-5075288
Sequence GGCCCCCGGAACCAACACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161579955_1161579968 29 Left 1161579955 19:5075266-5075288 CCCTGGTGTTGGTTCCGGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1161579968 19:5075318-5075340 AGGGATTGTGTTGCACACTGAGG 0: 1
1: 0
2: 0
3: 15
4: 208
1161579955_1161579958 -10 Left 1161579955 19:5075266-5075288 CCCTGGTGTTGGTTCCGGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1161579958 19:5075279-5075301 TCCGGGGGCCCGGCTGCTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 139
1161579955_1161579960 -9 Left 1161579955 19:5075266-5075288 CCCTGGTGTTGGTTCCGGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1161579960 19:5075280-5075302 CCGGGGGCCCGGCTGCTTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 149
1161579955_1161579963 3 Left 1161579955 19:5075266-5075288 CCCTGGTGTTGGTTCCGGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1161579963 19:5075292-5075314 CTGCTTCAGGGAAGTCCCTTTGG 0: 1
1: 0
2: 0
3: 15
4: 179
1161579955_1161579969 30 Left 1161579955 19:5075266-5075288 CCCTGGTGTTGGTTCCGGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1161579969 19:5075319-5075341 GGGATTGTGTTGCACACTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 132
1161579955_1161579964 9 Left 1161579955 19:5075266-5075288 CCCTGGTGTTGGTTCCGGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1161579964 19:5075298-5075320 CAGGGAAGTCCCTTTGGCACAGG 0: 1
1: 0
2: 2
3: 17
4: 177
1161579955_1161579965 10 Left 1161579955 19:5075266-5075288 CCCTGGTGTTGGTTCCGGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1161579965 19:5075299-5075321 AGGGAAGTCCCTTTGGCACAGGG 0: 1
1: 0
2: 3
3: 21
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161579955 Original CRISPR GGCCCCCGGAACCAACACCA GGG (reversed) Intronic
900186392 1:1335082-1335104 GGACCCCGGAGCCAGCACCATGG + Exonic
900989537 1:6091993-6092015 GGCCCCAGGACCCCACCCCAAGG + Intronic
901526762 1:9828049-9828071 AGCACCCAGAACCACCACCAGGG + Intergenic
901633782 1:10660255-10660277 GGCCCCCAGCACCAAGACCGAGG - Exonic
902626904 1:17682077-17682099 GGACCCAGGAGCCAACACGAAGG - Intronic
904390566 1:30182879-30182901 GGCCCCCATCACCACCACCAAGG - Intergenic
904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG + Exonic
906837611 1:49100755-49100777 GGCTCCAGGAAGTAACACCAAGG + Intronic
919740287 1:200977137-200977159 GTCCCCCTGAACCAAGACCTGGG + Intronic
922773991 1:228206770-228206792 GGCCCCAGCTACCAGCACCAGGG - Intronic
1064242957 10:13647210-13647232 GGCCCCCAGAATCCACACAAAGG + Intronic
1065935186 10:30514979-30515001 GGCCTCCAGACCAAACACCAGGG + Intergenic
1070509217 10:77145175-77145197 GGTCCCTGGAACCAGCAGCAGGG + Intronic
1072119816 10:92396504-92396526 GGCCACAGGAACCAGCACCCAGG + Intergenic
1075483729 10:122802879-122802901 GGCCTCCGGAACCAAGATCAGGG - Intergenic
1078390330 11:10931285-10931307 GCCCCCCAGCACCACCACCACGG - Intergenic
1081532202 11:43969719-43969741 GGCCCTGGGGACCAGCACCAGGG - Intergenic
1083694947 11:64436549-64436571 GGCCCCAGGAACCCCCTCCAGGG - Intergenic
1083794984 11:65011096-65011118 GGCCCCTGGGAACAACAGCATGG + Intergenic
1093027753 12:14260144-14260166 GGCCCCGGGAGCCGTCACCATGG + Intergenic
1096590040 12:52651986-52652008 AGCCCCCGCCACCACCACCATGG + Exonic
1101551773 12:105769843-105769865 GGCTCCCTGAACCACCACCTGGG + Intergenic
1101883057 12:108638999-108639021 GGCCTCCTCAAACAACACCAAGG - Intergenic
1103564821 12:121810310-121810332 GCCCCCCGACACCAACAGCATGG + Exonic
1104187737 12:126448854-126448876 GGCCCCCAGGACCTACAGCAGGG + Intergenic
1104595836 12:130119461-130119483 GGGCCCCAGATCCAACACAAAGG - Intergenic
1104784869 12:131443121-131443143 GGCCCGCGGAAGCCACACCCAGG + Intergenic
1105016025 12:132787398-132787420 GGCCCCAGGAACCCTCCCCAAGG + Intronic
1105834119 13:24193387-24193409 GGCCCCCAGTACAAACAACATGG - Intronic
1107164155 13:37265663-37265685 GGGCCCCGCCCCCAACACCAGGG - Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1123019203 14:105389751-105389773 GGCCCCCAGGACCAACGCCTGGG - Intronic
1123918993 15:25057416-25057438 GGCCCCTGTAACCAACACTGGGG - Intergenic
1128807313 15:70540470-70540492 GGCCCCAGGATCCCACAGCAGGG - Intergenic
1129803983 15:78438652-78438674 GGCCCCCGTCAGCAACACCAGGG + Intronic
1130015883 15:80186066-80186088 GCTCACCGGAACCAACACCTAGG - Intronic
1132502392 16:290302-290324 GGCTTCCAGAGCCAACACCAGGG + Intronic
1132847467 16:2007089-2007111 GGCCCTGGGAGCCAACCCCAGGG - Intronic
1136938625 16:34499867-34499889 GGCAGCCAGAACAAACACCAAGG + Intergenic
1136961193 16:34848690-34848712 GGCAGCCAGAACAAACACCAAGG - Intergenic
1137055866 16:35746478-35746500 GCCCACCTGCACCAACACCACGG + Intergenic
1138529946 16:57629554-57629576 GGACCCCGGACCCAGCCCCAGGG - Intronic
1141660837 16:85440710-85440732 GGCCCCAGGAACCATCACGGGGG + Intergenic
1143628392 17:8123616-8123638 GGCCTCTGGAACCAACGCCCCGG + Intronic
1143824059 17:9589987-9590009 GGCCCACAGATCCAAGACCAAGG - Intronic
1148796887 17:50201344-50201366 GGCCCCCGGGACCAAGCGCAAGG + Intronic
1151433396 17:74079966-74079988 GGCCCCTGGATCCTACACCAGGG + Intergenic
1151821075 17:76497246-76497268 AGCCCCAGGAACCTACGCCAGGG + Intronic
1151969780 17:77451616-77451638 GGCTCCCGGCACCGCCACCATGG - Intronic
1160550193 18:79689903-79689925 GCCGCCGGGAACCAGCACCACGG - Intronic
1161579955 19:5075266-5075288 GGCCCCCGGAACCAACACCAGGG - Intronic
1162996429 19:14338830-14338852 GGCACCTGGAACCAGCCCCAGGG + Intergenic
1165357372 19:35312319-35312341 GGCCCCCGGAACCTACCTCCTGG - Intronic
1166372475 19:42309919-42309941 GGGCCCAGGAACCAGCCCCACGG + Exonic
1167048588 19:47065903-47065925 GAGACCCGGAACCAAGACCATGG - Exonic
1168189436 19:54727097-54727119 TGCTCCTGGAACCAGCACCAGGG + Intronic
1168206369 19:54853230-54853252 TGCTCCTGGAACCAGCACCAGGG + Intronic
927732563 2:25487513-25487535 GGCTCCTGGAACCAACCCCCAGG + Intronic
937937211 2:127255907-127255929 AGCCCCAGGAACCAGCAACAGGG - Intergenic
938092219 2:128441293-128441315 GGCCCCGAGGACCAGCACCAAGG - Intergenic
943834497 2:192501702-192501724 GGCCCTGGGAATAAACACCATGG - Intergenic
1176386564 21:6141023-6141045 GGGCCACAGAAGCAACACCACGG + Intergenic
1178767610 21:35469040-35469062 TGCACACGGGACCAACACCAGGG - Intronic
1179736909 21:43397229-43397251 GGGCCACAGAAGCAACACCACGG - Intergenic
1184428195 22:44425376-44425398 GACCCCCGCAACAAACACAAGGG - Intergenic
1184813928 22:46856081-46856103 AGCCCCCGGAACAAACCTCAGGG - Intronic
953391577 3:42536699-42536721 GGTCACCAGCACCAACACCACGG + Exonic
954638543 3:52084760-52084782 GGCCCCAGGTACCACCACCCAGG - Intronic
957496596 3:80999571-80999593 GGCTGCTGGCACCAACACCATGG + Intergenic
962381436 3:134901449-134901471 GGAACCAGGAAACAACACCATGG - Intronic
966918033 3:184595343-184595365 GGCCCCCGCAACCTGCACCCTGG - Intronic
971353440 4:25872925-25872947 GCCCCCCCGACCCATCACCATGG + Intronic
972987050 4:44777643-44777665 GGCCCACAGAACAACCACCACGG + Intergenic
985678900 5:1245924-1245946 GGCCACCGGGACCCACAGCACGG - Exonic
997106368 5:131023721-131023743 GGCCCCTGGAACCAGCCCCAGGG + Intergenic
998108266 5:139482058-139482080 TGTCCCCGGAACCCACCCCAGGG + Intronic
1007412231 6:41671585-41671607 GGCCCCCAGCACCATCTCCAAGG - Intergenic
1007601743 6:43086346-43086368 GGCCCCCATAACCACCCCCAGGG - Intronic
1010359631 6:74977812-74977834 GACCCCTGGAGCCAATACCAAGG - Intergenic
1019057038 6:169231465-169231487 GGCCGCTGGAACGAACACCACGG - Intronic
1019322695 7:422832-422854 GACCCCTGGAACCAACACCCGGG - Intergenic
1023128449 7:36978248-36978270 AGCCCCAGGAAGCCACACCAGGG + Intronic
1023550790 7:41367950-41367972 AGCCCTGGGAGCCAACACCATGG - Intergenic
1024477454 7:49828976-49828998 TTCCCACGGAACCCACACCAAGG + Intronic
1029506993 7:100968653-100968675 AACTCCCTGAACCAACACCAGGG - Intergenic
1034456357 7:151173135-151173157 GGCCCGCGGGACCAACAGCCAGG + Intronic
1040293707 8:46138468-46138490 GGCCCCCAGAAGCAAAAACAGGG - Intergenic
1040304483 8:46205010-46205032 GGCCCCCACAAGCAAAACCAGGG + Intergenic
1040338617 8:46428702-46428724 GGCCCCCAGAAGCAAAAACAGGG + Intergenic
1047830016 8:128618833-128618855 GGCCCCTGGCTCCAACACCAAGG - Intergenic
1059257531 9:112945040-112945062 GACCCCTGAAACCATCACCACGG - Intergenic
1059404651 9:114092340-114092362 GGCCCCCGAAGACATCACCAGGG - Exonic
1060151127 9:121289087-121289109 GGCCCCAGGCACCAACATAATGG - Intronic
1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG + Intronic
1187163932 X:16787219-16787241 GGCCCCCGGGACCTAGACCCCGG + Intronic
1199419053 X:147621829-147621851 TGCCCCTGAAACCATCACCACGG - Intergenic
1200266642 X:154649677-154649699 GGCCCCTGCAGCCAACATCACGG - Intergenic