ID: 1161581239

View in Genome Browser
Species Human (GRCh38)
Location 19:5082210-5082232
Sequence CAGCGGCTCCAGGGGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 1, 2: 4, 3: 51, 4: 423}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161581239_1161581253 29 Left 1161581239 19:5082210-5082232 CCCTGGAGCCCCTGGAGCCGCTG 0: 1
1: 1
2: 4
3: 51
4: 423
Right 1161581253 19:5082262-5082284 GGCTCATAAGCCAGGCTCCCTGG 0: 1
1: 0
2: 0
3: 31
4: 242
1161581239_1161581247 8 Left 1161581239 19:5082210-5082232 CCCTGGAGCCCCTGGAGCCGCTG 0: 1
1: 1
2: 4
3: 51
4: 423
Right 1161581247 19:5082241-5082263 TTGACTTTGTGAAACCCCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 98
1161581239_1161581248 21 Left 1161581239 19:5082210-5082232 CCCTGGAGCCCCTGGAGCCGCTG 0: 1
1: 1
2: 4
3: 51
4: 423
Right 1161581248 19:5082254-5082276 ACCCCCTTGGCTCATAAGCCAGG 0: 1
1: 0
2: 2
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161581239 Original CRISPR CAGCGGCTCCAGGGGCTCCA GGG (reversed) Intronic
900145774 1:1158138-1158160 CCGCAGCTCCAGAGGCTCCTGGG + Intergenic
900154768 1:1199496-1199518 CAGGGGCCCCAGGGGCATCAGGG - Intergenic
900403622 1:2482984-2483006 CAGCCCACCCAGGGGCTCCAAGG - Intronic
900439162 1:2644788-2644810 CAAGGGCTTCAGGGGCCCCAGGG - Intronic
900610918 1:3544323-3544345 CAGGGGCTCCTGGGGCTGCAGGG + Intronic
900677990 1:3900456-3900478 TAGCGGCTACAGGGGTGCCAAGG - Intergenic
900803906 1:4755060-4755082 CCACGGCTCCATGGGCTGCAGGG - Intronic
901740670 1:11339780-11339802 AAGCGGCTCCAGCGGCTCTCAGG + Intergenic
901836316 1:11926203-11926225 CAGCGGCTCAAGGGGCTGCCGGG - Exonic
902044190 1:13513132-13513154 CAGCGACTCCAGGGTCTCGAAGG + Exonic
902577362 1:17386734-17386756 CAGCATCCCCAGGGCCTCCAAGG + Intronic
903342090 1:22660924-22660946 CTGGGGCTCCAGGGGCCCCTGGG - Exonic
903907431 1:26696588-26696610 CAGCGGCTGCGGCGGCCCCACGG - Exonic
904023690 1:27489041-27489063 CAGAGCCCCAAGGGGCTCCAAGG + Intronic
905168673 1:36098081-36098103 CAGGGGCACCAGGGGGTCCCGGG + Exonic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905433803 1:37943405-37943427 CAGCGTGTGCAGGGGCTCCGGGG + Intronic
906108181 1:43307067-43307089 CTGGAGATCCAGGGGCTCCAGGG - Intronic
906220266 1:44072792-44072814 CAGAGGCTCTGGGGGCTCCTGGG - Intergenic
906326460 1:44849186-44849208 CAGGGGTTCTAAGGGCTCCATGG + Intergenic
906932693 1:50185153-50185175 CAGAGGCTGCAGGAGCACCATGG - Intronic
907188570 1:52630816-52630838 CAGAGGCTCCTTGGGCTCCATGG - Intergenic
907470943 1:54673107-54673129 CAGTGTCTGCAGGGCCTCCAGGG - Exonic
907559679 1:55377060-55377082 CAGCAGGTGCAGAGGCTCCAAGG + Intergenic
910758893 1:90716968-90716990 ATGCGGCTCCGGGGGCTCCATGG + Exonic
910935648 1:92483515-92483537 CAGCGGCTCCAGGGACTCTTGGG - Exonic
911104208 1:94117404-94117426 CAGCTGTCCCAGGTGCTCCAGGG + Intronic
915526430 1:156479220-156479242 CAGTGGCCTCAGGGGGTCCAAGG - Intronic
916519609 1:165552007-165552029 CAGCAGCTCCAAGGCTTCCAAGG + Intronic
916563023 1:165949511-165949533 GAGGGGCCCCAGGGGCTGCAGGG + Intergenic
917669303 1:177257284-177257306 CAGCTGGTGCAGGGTCTCCAGGG - Exonic
918048475 1:180955043-180955065 GAGCTGCTCGAGGGCCTCCAAGG - Intergenic
918463000 1:184795331-184795353 CATGGGCCCCAGGGGCTCCTCGG + Exonic
919880211 1:201896028-201896050 CAGCTGCTCCAGGGGTGCCCTGG - Intergenic
921589522 1:216987344-216987366 TAGTGGCACCAGGGACTCCAAGG + Intronic
922772787 1:228196956-228196978 CAGTGGCTCCAGGTGCCCCTGGG + Intergenic
923490428 1:234478996-234479018 CAGCGTCTCCACGCGCTCCGCGG + Exonic
924626819 1:245702488-245702510 CAGTGCCTCCAGGTACTCCAGGG - Exonic
1062857870 10:788359-788381 CAGCAGCTGCAGGGGGTCTAGGG + Intergenic
1066010754 10:31191702-31191724 CAGGGCCCCAAGGGGCTCCAGGG - Intergenic
1066703768 10:38156712-38156734 CGGAGGCTCCAAGGCCTCCACGG + Intergenic
1067064096 10:43093967-43093989 CAGCAGGGCCACGGGCTCCAGGG + Intronic
1069884497 10:71615322-71615344 CGGCTGCTCCATGGACTCCAGGG + Intronic
1070723092 10:78770215-78770237 CAGTCCCTCCAGAGGCTCCAGGG + Intergenic
1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG + Exonic
1072370899 10:94765647-94765669 GAGCTGCTGCAGGGGATCCAGGG + Intronic
1073116257 10:101093536-101093558 GAGAAGCCCCAGGGGCTCCATGG - Intronic
1074508883 10:114095305-114095327 CAGTGGCCCCTGGGGCTTCATGG - Intergenic
1075174388 10:120145609-120145631 CAACGGCCCCAGAGGCTTCAGGG + Intergenic
1075551453 10:123395644-123395666 CTGAGGCTCCAGGGACTGCAGGG - Intergenic
1076181741 10:128414700-128414722 CGGAGGCTCCAGGGGCACCCTGG + Intergenic
1076342333 10:129758334-129758356 CAGGGGCTCCAGCCCCTCCAGGG - Intronic
1076496675 10:130901918-130901940 CAGCTCCTCCAGAGGCTCCCCGG - Intergenic
1076691153 10:132224473-132224495 CAGCTGCACCAGGGACTCCACGG + Exonic
1077047263 11:552091-552113 CAGCTGCTCGGGGGGCTCCCTGG - Exonic
1077423321 11:2463009-2463031 CAGCGGCGGCAGGGGGCCCAGGG + Intronic
1077542010 11:3151149-3151171 CAGGGGCTCCAGGTGTTCCTTGG - Intronic
1078191544 11:9095597-9095619 CATCAGCTCCTGGTGCTCCATGG - Intronic
1078264933 11:9747998-9748020 AAGCTGCTCCAGCTGCTCCATGG - Exonic
1078774403 11:14381221-14381243 CAGCGGCGCCAGCGGCACCTGGG - Intergenic
1081812757 11:45922709-45922731 CACCTGCTCCAGCGGCTCCCGGG - Intronic
1083832575 11:65242155-65242177 CAGTGTCCCCAGGGGCTCCTGGG - Intergenic
1084182507 11:67454007-67454029 GAGAGGCACCAGGGGCTCCTAGG - Intronic
1084204393 11:67583630-67583652 CGGCGACTCCGGGGACTCCAGGG + Exonic
1084515660 11:69636958-69636980 CACGGGCTCCAGGGACCCCAGGG + Intergenic
1084544425 11:69807612-69807634 AGGCCGCCCCAGGGGCTCCAGGG - Intergenic
1084782379 11:71418743-71418765 CTGCAGCTCCCGGGGCTCCTGGG - Intergenic
1086312546 11:85550504-85550526 CAGCGGCACCAGTGGCACCAGGG - Intronic
1087291254 11:96322952-96322974 CAGATTCTCCAGGGGTTCCAAGG - Intronic
1088763116 11:112950637-112950659 CATAGCTTCCAGGGGCTCCAAGG - Intergenic
1089293884 11:117456632-117456654 TAGCGGCATCAGGGCCTCCAAGG - Intronic
1089688245 11:120170251-120170273 CAGAGGGTCCAGGGGCTCCCGGG - Exonic
1089754291 11:120674956-120674978 CAGCAGCTCCAGGAGGTGCAAGG - Intronic
1090205309 11:124880506-124880528 CAGGGGCTCCAGCAGCTCTAGGG + Exonic
1090205313 11:124880515-124880537 CAGCAGCTCTAGGGGCTCCCGGG + Exonic
1090385262 11:126354848-126354870 CGGGAGCGCCAGGGGCTCCAAGG - Intergenic
1090894059 11:130953615-130953637 CATGGGCTCCATGGGCTCCATGG + Intergenic
1091256591 11:134192796-134192818 CAGCTGGTCCAGGAACTCCAGGG + Exonic
1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG + Intronic
1091906516 12:4193944-4193966 CAGCTTCTCCAGGTCCTCCACGG + Intergenic
1094502594 12:31034457-31034479 CAGCAGGCCCATGGGCTCCAGGG - Intergenic
1095050357 12:37548562-37548584 CGGCAGCTTCAGGGGCTGCATGG + Intergenic
1095943428 12:47740512-47740534 CAGAGGCTCCAGGGGACCCAGGG + Intronic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1095954265 12:47797475-47797497 TTCCGTCTCCAGGGGCTCCAGGG + Exonic
1095981556 12:47977355-47977377 CAGCGGGGCCAGGGGAGCCAGGG + Exonic
1095981889 12:47978731-47978753 CAGGGGGACCAGGGGGTCCAGGG + Exonic
1095983700 12:47986407-47986429 CAGCGGGTCCAGGGGCTCCCTGG + Exonic
1096519213 12:52174688-52174710 CAGCAGCAACAGGGGCTCCGGGG - Intronic
1096993268 12:55822054-55822076 TAGAGGCTGCAGCGGCTCCAGGG + Exonic
1097693643 12:62756926-62756948 CAGCATCTCCAAGGGCTCAAAGG + Intronic
1102351399 12:112194916-112194938 CAGCAGTTGCAGGTGCTCCAGGG + Exonic
1102884001 12:116508294-116508316 CAGCGGCTCCAGCGTTTTCAAGG + Intergenic
1102964926 12:117118695-117118717 CTGCGACACCAGAGGCTCCAGGG - Intergenic
1103122056 12:118388770-118388792 CAGAGGCTCCAGGGACACCTGGG - Intronic
1103741215 12:123092844-123092866 GAGGGGCTCCAGGGGCTCGGGGG - Intronic
1103896737 12:124278141-124278163 CGGCTGCTCCGGGGTCTCCAAGG - Intronic
1104123010 12:125817407-125817429 CAGGGTCTCAAGGGTCTCCAGGG + Intergenic
1104471664 12:129034522-129034544 AAGCGGCCCCAGTGGGTCCATGG + Intergenic
1104568215 12:129903709-129903731 CGGCGGCTCCAGCTGCTCCCGGG + Intergenic
1104674033 12:130700603-130700625 CAGTGGCTCCAGGTGTTCCTTGG - Intronic
1104897379 12:132171052-132171074 CAACAGCTCCACGGGCCCCAGGG - Intergenic
1105454222 13:20525704-20525726 CGGCGTCTCCCCGGGCTCCAGGG + Intronic
1105627796 13:22129979-22130001 CTTCTGCTCCAGGGGCACCAGGG - Intergenic
1108394458 13:49979140-49979162 CAGCTGCTTCAGGCCCTCCAGGG - Intergenic
1108500510 13:51065964-51065986 CAGCTGCTCCTGGGGCCACAGGG + Intergenic
1112012091 13:95301191-95301213 CCGCGGCGCCAGCGGCTGCAGGG + Intronic
1113092916 13:106633608-106633630 CGGTGGCTCCAGGAGCTCCTTGG + Intergenic
1113248694 13:108427617-108427639 CAACTGCTGCAGGGGATCCAAGG + Intergenic
1113589582 13:111488992-111489014 CAGCTGCCCCAGGGGCACCTGGG + Intergenic
1114653380 14:24300684-24300706 CAGCTCCTCCAGGGTCTCCGTGG - Exonic
1117353511 14:54902660-54902682 CAGCGGCTGCGGCGGGTCCATGG - Exonic
1119030434 14:71188111-71188133 CAGCTTCTCCAGAGGCTGCAGGG + Intergenic
1119262228 14:73244680-73244702 CAGGGGCTCCACTGGCTCCAGGG - Exonic
1119704041 14:76773084-76773106 CAGCGCCTCCAGCCCCTCCAGGG - Intronic
1121232572 14:92368690-92368712 CAGCTGCTGCAGGGGCTCTGAGG + Intronic
1121434808 14:93912102-93912124 CAGTTGCACCAGGGACTCCAAGG + Intergenic
1121531148 14:94654370-94654392 CGACGTCTCCAGGGTCTCCAGGG - Intergenic
1122115852 14:99526880-99526902 CAGGGGCCCCAGCAGCTCCAGGG + Intronic
1122115858 14:99526889-99526911 CAGCAGCTCCAGGGGCAGCTGGG + Intronic
1122302808 14:100740726-100740748 CACCTGCTCCAGGTGCTGCACGG - Intergenic
1122325271 14:100877930-100877952 CAGCAGCTCCAGGAGCTCAAGGG - Intergenic
1122421414 14:101579800-101579822 CAGAGGGGACAGGGGCTCCAGGG - Intergenic
1122491125 14:102116832-102116854 CAGGGGCTCCAGGTCCTCAATGG - Intronic
1122540124 14:102493427-102493449 CAGGGGATGCAGGGGCTCCAGGG - Intronic
1122691990 14:103535875-103535897 CGGCAGCTCCAAGGGCCCCATGG - Exonic
1202857288 14_GL000225v1_random:59151-59173 CACCGGCTCCTGGAGCTCCTGGG - Intergenic
1124215616 15:27805523-27805545 GAGCGGCTCCATGCGCTCCCAGG - Intronic
1125119098 15:36131831-36131853 CAGAGGCCCAAGGGTCTCCATGG + Intergenic
1126108378 15:45161749-45161771 CTGCGGTTCCAGCGGCCCCAGGG + Exonic
1126446555 15:48752400-48752422 CAGCAGGTCCAGGGTCTCCTTGG + Exonic
1127146718 15:56032573-56032595 CTGCTGCTGCAGGGGCACCAGGG - Intergenic
1128143571 15:65319079-65319101 CAGAGGCTCCCTGGGCTCCAGGG + Intergenic
1128214265 15:65923437-65923459 CAGCAGCACCAGTGGCTCCTGGG - Intronic
1129035372 15:72645793-72645815 CTTGGGCTCCAGGTGCTCCAAGG - Intergenic
1129214512 15:74091423-74091445 CTTGGGCTCCAGGTGCTCCAAGG + Intergenic
1129330742 15:74826057-74826079 TAGCTGCTCCAGGGGCAGCAGGG + Intergenic
1129390896 15:75220502-75220524 CTCGGGCTCCAGGTGCTCCAAGG - Intergenic
1129448345 15:75634546-75634568 GAGAGGCTGCAGGGGCTTCAGGG - Intergenic
1129473412 15:75767370-75767392 CTTGGGCTCCAGGTGCTCCAAGG + Intergenic
1129702116 15:77774073-77774095 CAGGGGCTCCAGGGATGCCATGG + Intronic
1129731642 15:77935769-77935791 CTTGGGCTCCAGGTGCTCCAAGG + Intergenic
1129781179 15:78272471-78272493 CAGTGACTGCAGGAGCTCCACGG + Intronic
1130014344 15:80175377-80175399 CAGCCTCTCCAGGGGCTGCCTGG + Intronic
1131091428 15:89627441-89627463 CAGCAGCTCAAGGGACCCCAGGG - Exonic
1132115231 15:99131185-99131207 CAGCTGCTGCCGGGGCTCCTTGG - Exonic
1132605673 16:792797-792819 CAGCGGCTCCAGGAGGTCGGTGG + Exonic
1132678331 16:1129856-1129878 CAGCGGCCGCAGGGGCCCCGGGG - Intergenic
1132865282 16:2090128-2090150 TCGCTCCTCCAGGGGCTCCAAGG - Exonic
1133060992 16:3174557-3174579 CGGCGGCTTCAGGCGCTCCGTGG - Intergenic
1133079282 16:3305677-3305699 CCGCCGCTCCAGCGGCTCCAGGG - Intronic
1133117687 16:3587519-3587541 CGGGGGCTCAAAGGGCTCCATGG - Intronic
1133569846 16:7030497-7030519 CAGTGGCTCCAGGCGTTCCTTGG + Intronic
1133854786 16:9539427-9539449 CACCCCCTCCAGAGGCTCCAAGG - Intergenic
1134531951 16:14990126-14990148 CAGGGGCTCAAGGGGCTGCCGGG - Intronic
1135237762 16:20774720-20774742 CAGTGGCTCCAGTGGGTCCCAGG + Intronic
1135328433 16:21542639-21542661 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1135342972 16:21664389-21664411 CAGCGGCTTTAAGGGCTCCTGGG + Intergenic
1135838442 16:25850676-25850698 CAGAGACTCCGGGGTCTCCAAGG + Intronic
1136338780 16:29628612-29628634 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1136564326 16:31061098-31061120 CAAAGCCACCAGGGGCTCCAGGG + Exonic
1136920429 16:34266502-34266524 CAAGGGCTCCAGGGAATCCAGGG - Intergenic
1137044332 16:35642004-35642026 CAGTGGCTCCAGGAGAGCCAGGG + Intergenic
1137066164 16:35846295-35846317 CAGAGGCTACAGGGGCTGAAGGG + Intergenic
1137677722 16:50311929-50311951 CAGAGGCTCCAAGGACGCCAGGG + Intronic
1138206842 16:55131519-55131541 CAGAGGCTCAAGGGGCTGGAAGG - Intergenic
1139602437 16:67994587-67994609 AAGCGGTTCCAGGGGTGCCAAGG - Intronic
1140475001 16:75235399-75235421 CAGCGGCTCCTGTGGCTCAGAGG + Exonic
1141125397 16:81397424-81397446 CAGCAGCTCCAGAAGCTGCAAGG + Intergenic
1141423855 16:83933208-83933230 CAAAGGCTTCTGGGGCTCCAGGG + Intronic
1141695283 16:85616200-85616222 TACCTGCTCCAGGGGCTCAAGGG - Intronic
1142041463 16:87897177-87897199 CACCAGGTCCAGGGGATCCAGGG - Intronic
1142136311 16:88453462-88453484 CGGCAGCTCCAGCGGCTCCGGGG + Exonic
1142144555 16:88487504-88487526 CAGCAGGTCCAAAGGCTCCAAGG + Intronic
1142262921 16:89051000-89051022 CAGCGCCTCCCGGGGCTTAAGGG + Intergenic
1142306531 16:89289101-89289123 CAGGAGCTCCAGGGGCGCCCAGG + Intronic
1142549796 17:731989-732011 CAGCGGCTGCAGCCGCTCCGGGG - Intergenic
1142711707 17:1727139-1727161 CAGCTCCTCCAGGGCCTGCATGG - Exonic
1142956953 17:3528954-3528976 CAGCGTGTGCAGCGGCTCCAGGG + Exonic
1142984988 17:3690234-3690256 CAGAGGCTCCAGGGGACCCAAGG - Intronic
1143291153 17:5830170-5830192 AAGCTGCTCCAGGTGGTCCAGGG - Intronic
1143628003 17:8122012-8122034 CCGCGGCTCCAGGGGTTCCCCGG - Exonic
1143904532 17:10198450-10198472 CAGCGGCTCCGCGGGGTCCCAGG + Exonic
1144246614 17:13372532-13372554 CAGGATATCCAGGGGCTCCAGGG - Intergenic
1144673078 17:17143861-17143883 CAGCAGAACCAAGGGCTCCATGG + Intronic
1145101611 17:20081869-20081891 CATGGGCCCCAGGGGCTCCTGGG - Intronic
1145291975 17:21554033-21554055 CTGCTGCTCCAGGGGCTGCAGGG - Intronic
1146357020 17:32142777-32142799 CAGGGGCGACAGGGGCTGCAGGG - Intronic
1146948247 17:36888697-36888719 CAGCTGCCCCAGGGGCTTAAGGG + Intergenic
1147562101 17:41515613-41515635 CAGCAGATCCAGGGGCTCATTGG - Exonic
1148794840 17:50191988-50192010 CAGAGGGGCCAGGGGCGCCAAGG + Exonic
1148795854 17:50196313-50196335 CAGCAGGGCCAGGGGCTCCAGGG + Exonic
1148907902 17:50922900-50922922 CAGAGTCTCCAGGGGCCCCCTGG - Intergenic
1150209290 17:63433467-63433489 CAGCAGCTCCAGCAGCCCCAGGG + Exonic
1150249647 17:63698864-63698886 CAGCCGCTCCATGGGGTACACGG + Exonic
1150270538 17:63861695-63861717 CAGGGGCCCCAGGGCCACCATGG + Intergenic
1150274210 17:63885538-63885560 CAGGGGCCCCAGGGCCACCATGG + Intergenic
1150276359 17:63900365-63900387 CAGGGGCCCCAGGGCCACCATGG + Intergenic
1151252174 17:72844848-72844870 CTGCAGCTCCAGGGGCTTTAGGG - Intronic
1151565167 17:74893575-74893597 CATCGGCTCCGTGGGTTCCATGG + Exonic
1152095637 17:78270064-78270086 CAGGGGCTCAGGGGGCTCCGTGG + Intergenic
1152579910 17:81161276-81161298 CAGCGGCCCCAGGTGCTCCTGGG + Intronic
1154176925 18:12092026-12092048 CAGCTGCTCCAGGTTCTGCAGGG + Intergenic
1154270260 18:12912276-12912298 CACCGGCTCGTGGAGCTCCAAGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156498958 18:37544910-37544932 GAGCTGATCCTGGGGCTCCAGGG + Intronic
1157285324 18:46373634-46373656 CACTGGCTCCTCGGGCTCCAGGG + Intronic
1160250910 18:77202798-77202820 CAGCAGCTCCACCAGCTCCAGGG - Intergenic
1160610081 18:80077904-80077926 GACGGGCTCCAGGGCCTCCAGGG + Intronic
1160665242 19:325083-325105 CAGGGCCTGCAAGGGCTCCAGGG + Intronic
1160702171 19:512909-512931 CAGCGGCTGCAGGTGCTCCCTGG - Intronic
1161337035 19:3720253-3720275 CAGCCCCTCAAGGGTCTCCAAGG - Intronic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1161716079 19:5877002-5877024 CGGGGGCTCCAGGGGCATCAGGG + Intronic
1162128548 19:8511989-8512011 CTGGGCCTCCAGGGGCACCAGGG + Intronic
1163169937 19:15524275-15524297 TAGTGGTGCCAGGGGCTCCAGGG + Intronic
1163274258 19:16273175-16273197 CTGCGGCTGCCGGGGCTCCAAGG + Intergenic
1163400314 19:17088172-17088194 CTGGGGCTCCAGGTGTTCCATGG + Intronic
1163403868 19:17110684-17110706 CAGGGGCTCCATGGAGTCCAGGG - Intronic
1163575932 19:18110689-18110711 CAGGGGCTGCAGGGGCTGCTGGG - Intronic
1163575935 19:18110698-18110720 GAGGGGCTACAGGGGCTGCAGGG - Intronic
1163590910 19:18193666-18193688 GCGCGGCTCCAGAGGCTCCTGGG - Intronic
1165236871 19:34428634-34428656 CCGGGGCTCCAGGGGCTCTGAGG + Intronic
1165509070 19:36255693-36255715 CAGAGGCTTCAGGGGCTGCCTGG + Intergenic
1165509553 19:36258058-36258080 CAGCAGCTTCAGGGGCTGCCTGG + Intergenic
1165734027 19:38164567-38164589 CTCTGGCTCCAGGGGGTCCAGGG - Exonic
1165789574 19:38483459-38483481 CAGCGGCTCCTGGCACTGCACGG - Exonic
1166164513 19:40977914-40977936 GAGGGGATCCTGGGGCTCCAGGG - Intergenic
1166185807 19:41138044-41138066 GAGGGGATCCTGGGGCTCCAGGG + Intergenic
1166574224 19:43822150-43822172 CAGCCACTCCATGGGCTACAGGG - Intronic
1166762600 19:45234420-45234442 CAGCGGCTCCCGGGGCGCCCGGG - Intronic
1166765596 19:45251150-45251172 CGGGGGCTCCGGGGGCTCCGGGG - Intronic
1167281816 19:48573598-48573620 CAGCAGCTCCAGGGGCCCAGAGG + Intronic
1167521924 19:49960363-49960385 CACCGGCTGCCCGGGCTCCAGGG + Exonic
1167523460 19:49970359-49970381 CACCGGCTGCCCGGGCTCCAGGG - Intergenic
1167613458 19:50518219-50518241 CTGCGTCTCCAGGGTCTCCACGG + Exonic
1167613620 19:50519011-50519033 CAGCTCCTCCAGGCGCACCAGGG + Exonic
1167649375 19:50721102-50721124 CAGCACCTCCAGGGCCTGCAGGG + Intergenic
1167756609 19:51416892-51416914 CACCGGCTGCCCGGGCTCCAGGG + Exonic
1168277427 19:55285357-55285379 CAGAGGCTGGAGGGGCTCCAGGG + Intronic
1168353176 19:55687855-55687877 CACCGGGTCCAGGGGCCCCCAGG - Intronic
925133793 2:1512607-1512629 CAGCTGCTTGAGGGGCTGCAGGG - Intronic
925467842 2:4125618-4125640 CAGCAGCTCTAGGGGAACCAAGG - Intergenic
925556568 2:5137232-5137254 TAGTGGCTTCAGGGACTCCATGG - Intergenic
925928323 2:8685825-8685847 CTGCGGCTCCAGGGGTCCCGGGG - Intergenic
927718404 2:25367514-25367536 CAGCTGCTCCAGGGCGGCCATGG - Intergenic
928003590 2:27542978-27543000 CAGCTACTCCAGAGGCTCCCAGG + Intronic
928020467 2:27700764-27700786 CAGTGGCTCCTGGGGCTGAAGGG - Intergenic
928203799 2:29269736-29269758 CAGTGTCTCAAGCGGCTCCAAGG + Intronic
928428342 2:31197819-31197841 CAGTGGCTCCAGGTGTTCCTTGG - Intronic
929778360 2:44942305-44942327 CGGCGGCTCCAGGGCCCCCCCGG + Exonic
930034278 2:47075860-47075882 CAGAGGCAGCAGGGGCTTCAGGG - Exonic
930866319 2:56125626-56125648 CAGAAGCCCCAGGGGTTCCAGGG + Intergenic
931924361 2:67055031-67055053 TAGCAGCTCCAGTGTCTCCATGG - Intergenic
934466222 2:94265488-94265510 CTGGGGCTCCTGGGGCTCCTGGG - Intergenic
934711120 2:96514838-96514860 CAAGGGCTCCAGGGACTCCAGGG + Intergenic
934790621 2:97056788-97056810 AAGCTGCTACAGGGGCTCCAGGG - Intergenic
934815838 2:97325741-97325763 AAGCTGCTCCAGGGTCTCCAGGG + Intergenic
934821857 2:97382742-97382764 AAGCTGCTCCAGGGTCTCCAGGG - Intergenic
937326309 2:120991507-120991529 CAGCGGCTCCAGCAGCCCCGAGG - Exonic
937375800 2:121334931-121334953 CTGTGTCTCCAGGAGCTCCAGGG + Intergenic
937438054 2:121895618-121895640 CATCAGCTCCAGGGGCTCTCAGG + Intergenic
937986351 2:127639886-127639908 CAGGGGGTCTAGGGGATCCAGGG - Intronic
938368819 2:130756214-130756236 CCGCGGCTCCAGGGGCCCCGCGG - Intronic
938448507 2:131395281-131395303 CAGCGGCGCCAGGGGCACTCGGG + Intergenic
938483829 2:131682845-131682867 CAGAGGCCCCTGGGGCTCCGAGG - Intergenic
939068911 2:137516643-137516665 CAGTGGCTCCAGTGGGTCCACGG + Intronic
940020134 2:149147625-149147647 CAGCTACTCCAGAGGCTGCAGGG - Intronic
940855147 2:158723676-158723698 CAGTGGCCCCAGGCACTCCAGGG + Intergenic
942216147 2:173720730-173720752 CAGAGACTCTAGGGGATCCATGG + Intergenic
946397148 2:219448860-219448882 CCGCGGCTCCTGGGCCTCCCAGG - Exonic
947039068 2:225894557-225894579 GAGCAGCTCCGGGGGCTCCAGGG + Intergenic
947525095 2:230872777-230872799 CAGGGGCTCCAGGAGCCCCATGG - Intronic
947741404 2:232486633-232486655 CAGCGAATACGGGGGCTCCATGG + Exonic
948207933 2:236172782-236172804 CCGCCGCCCCAGGGGCTCCGGGG - Intergenic
948289784 2:236816500-236816522 CAGCAGCGCCAGGGTCTCCTAGG - Intergenic
948463909 2:238143180-238143202 CACCGGCTCCAGGGCCTAAAAGG - Intronic
948485414 2:238277871-238277893 CTGGGGCTCCACGGGCTCCTTGG + Exonic
948544539 2:238717415-238717437 CCCGGGCTCCAGAGGCTCCATGG - Intergenic
1168849045 20:964081-964103 CAGGGGCTCCAGCCGCCCCAGGG + Exonic
1169122863 20:3107749-3107771 CTGCCACTCCAGGGGCTCCCAGG + Exonic
1171091634 20:22290850-22290872 CAGGGTCTCCAGGTGCTCCAGGG - Intergenic
1171482605 20:25465403-25465425 CCGCGGCTCCAGGGACTCAGTGG + Intronic
1172309742 20:33908399-33908421 CAGTGGCTCCAGGAGCCCAAGGG - Intergenic
1172435725 20:34927717-34927739 CATTGGCTCCAGGGGCTGTATGG + Exonic
1173848984 20:46206016-46206038 CAGGGGCTTGAGGAGCTCCAGGG - Intronic
1174112261 20:48204984-48205006 CAGCAGCTCCAGGGGGCTCACGG - Intergenic
1174126394 20:48310073-48310095 CAGCAGCTACTGGGGCTCCTGGG + Intergenic
1174193645 20:48757742-48757764 GAGCTGGTCCAGGGGCTACACGG - Intronic
1174264634 20:49322569-49322591 GACTGGATCCAGGGGCTCCAAGG + Intergenic
1175276369 20:57773898-57773920 CCCCAGCTCCAGGAGCTCCAGGG - Intergenic
1175391073 20:58627876-58627898 CGCCGGCTCCAGGGGCTGCTGGG - Intergenic
1175736651 20:61391874-61391896 CAGCAGCTCCGGGGCCTGCAGGG + Intronic
1175873201 20:62217995-62218017 CAGCGGCTCCCTGGGCTGCATGG + Intronic
1176039443 20:63056556-63056578 CAGCGGCTCCTGGCGGTCGAGGG - Intergenic
1176116368 20:63433246-63433268 CTGCTGCCCGAGGGGCTCCAAGG + Intronic
1176173587 20:63707536-63707558 CGGCGCCTGCAGGGGCTCCTGGG - Intronic
1176232253 20:64038504-64038526 CCGCGCGTCCCGGGGCTCCACGG + Intronic
1176408771 21:6436486-6436508 CAGCGGCTCCAGAGCCTGCCGGG + Intergenic
1177905224 21:26966003-26966025 CAGTGGCTCCGGTGGCGCCAGGG + Exonic
1179277937 21:39908702-39908724 CCGCGGCTCCAGGTGCTCTCTGG + Intronic
1179684264 21:43044806-43044828 CAGCGGCTCCAGAGCCTGCCGGG + Intergenic
1179731094 21:43367829-43367851 CAGCGGCCCCTGGAGCTGCAAGG + Intergenic
1179981124 21:44896553-44896575 GACCGGCCCCAGGAGCTCCATGG - Intronic
1179985042 21:44915726-44915748 CAGAGGCTCCAGGAAATCCAGGG + Intronic
1179996121 21:44975259-44975281 CACCAGCTCCAGGAGCTACAAGG - Intronic
1180000139 21:44991788-44991810 CCTCGGCAGCAGGGGCTCCAGGG + Intergenic
1180166365 21:46032746-46032768 CATCCCCTCCTGGGGCTCCAGGG - Intergenic
1182350621 22:29697339-29697361 CAGAAGCACCTGGGGCTCCAGGG + Exonic
1182472127 22:30555121-30555143 CAGCGGCTGCCAGGGCTGCATGG + Exonic
1183078259 22:35440405-35440427 CAGAGCCTCAAGGGGCTTCAGGG - Intergenic
1183098450 22:35568684-35568706 CACAGGCTGCAGGAGCTCCATGG - Intergenic
1183187433 22:36300081-36300103 CCGCTGCTCCAGGGGCGCCGTGG - Intronic
1183253606 22:36746707-36746729 CAGCCTCTCCAGGGCCTCCTCGG - Intergenic
1183403886 22:37620421-37620443 CTGGGGCTCCAGCGGCTTCAGGG + Intronic
1183411729 22:37658901-37658923 CAGCCGCTCCAGCAGCTCCGGGG - Exonic
1183588268 22:38765753-38765775 CAGTGGCTGCAAGGGCTACATGG - Intronic
1184173907 22:42775220-42775242 CACCCACTCCAGGGCCTCCAGGG + Intergenic
1184426182 22:44410524-44410546 AAGCGGCTCCAGGCGTCCCAGGG + Intergenic
1184580520 22:45413547-45413569 CAGCAGCTCCAGGTGGGCCATGG + Exonic
1184599051 22:45531906-45531928 CTGGGGCTCCAGGGGCACAAAGG - Intronic
1184613488 22:45621997-45622019 CAGGGCCTCCACTGGCTCCATGG - Intergenic
1184729024 22:46363112-46363134 CAGTGGCCCCTTGGGCTCCAAGG + Exonic
1184819982 22:46903098-46903120 CAGAGACTCCAGGTGCACCAGGG - Intronic
1184886179 22:47345625-47345647 CAGGGGCTCCAGGGGTTCCTTGG + Intergenic
1184894279 22:47397967-47397989 CACAGGCTCCAGTGCCTCCACGG - Intergenic
1185374079 22:50474370-50474392 CTGTGGCTCTAGTGGCTCCAGGG - Intronic
950412190 3:12846239-12846261 CAGCTGCTCCAGTGGCTAAAAGG + Intronic
950441796 3:13014872-13014894 CAGTGGGTCAAGGGGCTCCTGGG + Intronic
950635107 3:14308678-14308700 CAGCTGCTCCAGGGGCTCCTGGG - Intergenic
952796437 3:37243299-37243321 CCGCGGCTCCCGGGGCTGGATGG + Exonic
954133671 3:48572403-48572425 CAAGGCCTCCAGGGGCTCCCTGG + Exonic
954217963 3:49134858-49134880 CTGCTGCTCCAGGGCCTGCAGGG + Intergenic
954673638 3:52303832-52303854 CTGAGGCTCCAGGGCCTTCAAGG + Intergenic
955380333 3:58433478-58433500 CAGAGGCAGCAGGAGCTCCACGG + Intronic
958743886 3:98109979-98110001 CAGCGGCTGCCAGGGCCCCAAGG + Intergenic
960048324 3:113218175-113218197 CGGGGGCTCCAAGGCCTCCACGG - Intronic
961336055 3:126180387-126180409 CGGGGGCTCCGGGGGCTCCAGGG - Intronic
961336059 3:126180396-126180418 CTGCAGCTCCGGGGGCTCCGGGG - Intronic
961523372 3:127481214-127481236 AAGGGGCTCCATGGGCTCCAGGG - Intergenic
961558844 3:127714984-127715006 CAGCAGCGCCAGGGGCTCCAGGG + Intronic
961830343 3:129619916-129619938 CCGGGGCTCCAGGGACCCCAAGG + Intergenic
961869243 3:129975994-129976016 CAGCGGCTGCAAGGGGACCAGGG + Exonic
964569277 3:158094728-158094750 CCCCTGCTCCAGGGTCTCCAGGG + Intergenic
968793968 4:2689777-2689799 CAGCTGCGCCAGGGCTTCCACGG - Intronic
968902425 4:3437969-3437991 CAGCGGCTCCGTGGCCACCAAGG - Intronic
969256987 4:6008890-6008912 CAGCTGCTCCAGAGCCTCCCAGG + Intergenic
969394307 4:6910371-6910393 AAGCGGGGTCAGGGGCTCCAAGG - Intronic
969944307 4:10767292-10767314 CAGTGGCTCCAGTCGCCCCAGGG - Intergenic
970106842 4:12595133-12595155 CAGCAGCTCCTGGAACTCCACGG + Intergenic
975329620 4:73099317-73099339 CAGCCACTGCAGGGGCCCCATGG + Intronic
978400277 4:108323678-108323700 CAGTGGCTCCACTGGGTCCACGG + Intergenic
981541492 4:145851078-145851100 CAGTGGCTGCAGGGACTCCTTGG - Intronic
985651172 5:1108456-1108478 CAGCTGCTGCAGGGGCTCCCGGG + Intronic
985723676 5:1504346-1504368 CACCTGGTCCCGGGGCTCCAGGG + Intronic
985729706 5:1540326-1540348 CTGTGGTTCCATGGGCTCCAGGG + Intergenic
985888444 5:2697956-2697978 CAGCAGCTCGAGGGGCCACAGGG + Intergenic
986197302 5:5549752-5549774 CAGGGCCTGCAGGGGCTGCAGGG + Intergenic
986216492 5:5724368-5724390 CAGCGGCCCCAGAGGCTGTAAGG - Intergenic
989097670 5:37796122-37796144 CAGCGGGTCCAGTGGGTCCCTGG + Intergenic
995492360 5:112706695-112706717 CAGTGGCTCCTGGGCCCCCATGG + Intergenic
996926321 5:128830666-128830688 CAGTGCCTCGAGGGGCTCCTTGG - Intronic
997229821 5:132234220-132234242 CAGCTGCTGCAGTGGTTCCAGGG - Intronic
997460355 5:134047553-134047575 CAGAGGCTGCAGGGCCTCCTGGG + Intergenic
997825057 5:137098841-137098863 CACCGGGTCCACAGGCTCCACGG + Intronic
998040562 5:138948588-138948610 CTGCGCCTCCAGAGGCCCCAGGG - Intronic
998642919 5:144032387-144032409 TTGCAGCTCCTGGGGCTCCATGG + Intergenic
999068107 5:148713967-148713989 CAGCAGCTCCAGAGACTCCAAGG + Intergenic
1001216810 5:169864115-169864137 CAGCGGCTACATCAGCTCCAAGG + Intronic
1002204508 5:177553788-177553810 CCGCGGCTGCAGGCGCTGCAGGG + Intronic
1002299085 5:178247533-178247555 CAGGGCCTCCAGGGAATCCAGGG - Exonic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1002929548 6:1624044-1624066 CAGCGGCAGCAGGGGCCGCAGGG + Exonic
1003114267 6:3273026-3273048 CTGCGGAACCCGGGGCTCCAGGG - Exonic
1003984233 6:11419484-11419506 CAGTGGCCCCAGTGGCCCCAAGG + Intergenic
1004170465 6:13291873-13291895 CTGCTGCTCCAGGGGCCCCCTGG - Intronic
1005781772 6:29200868-29200890 TCCCGGCTCCAGGGGCTCCACGG - Intergenic
1005812751 6:29529465-29529487 GAGAGGCTCCTGGGGCCCCAAGG - Intergenic
1006020774 6:31116450-31116472 AGGCGGCTCCACGGGCTCCAAGG - Exonic
1006459356 6:34149458-34149480 CAGTGGCCCCAGGCTCTCCAGGG + Intronic
1006806860 6:36794329-36794351 CAGTGGCTCCTGGGACTTCAGGG - Intronic
1006891600 6:37433540-37433562 CAGCGGCAGCTCGGGCTCCAGGG - Intronic
1007705261 6:43786988-43787010 CAGAGGCTCAAGGAACTCCAGGG - Intergenic
1009928643 6:70149876-70149898 CAGGAACTCCAGGGACTCCAGGG + Exonic
1009931355 6:70180328-70180350 CAGGGCCTCCAGGAGTTCCAGGG + Exonic
1010163612 6:72889329-72889351 CAGTGGCTTCCGAGGCTCCAAGG - Intronic
1012474257 6:99603574-99603596 CACCAGCACCAGGGTCTCCAAGG + Intergenic
1016948986 6:149562177-149562199 CAGGAGCTAGAGGGGCTCCAGGG - Intergenic
1018058584 6:160072323-160072345 CAGCAGCTCTAGGCTCTCCAGGG + Intronic
1018430133 6:163715696-163715718 CAGCAGCTCCAGTGGCTTCCAGG + Intergenic
1019049107 6:169169788-169169810 CAGCAGCTCCAGAGGTTACAGGG + Intergenic
1019261401 7:83984-84006 GAGCCCCTCCCGGGGCTCCAGGG + Intergenic
1019526164 7:1481466-1481488 CTGCGGCTCCAGGTCCTGCAGGG + Exonic
1020040189 7:4995933-4995955 CAGAGGCACAAGGGCCTCCAAGG - Intronic
1020072184 7:5234358-5234380 CAGGGGACCCAGGAGCTCCATGG + Intergenic
1020106997 7:5426809-5426831 CAGCGACTGCAGGGACACCAGGG - Intergenic
1020432602 7:8128902-8128924 CAGAGGCTCAAGGGGGTCTAAGG - Intronic
1023983079 7:45080845-45080867 CAGGGGCTCCAGGGCCTCGCAGG - Intronic
1025296263 7:57777144-57777166 CAGCAGCTTCAGGGGCTGCCTGG + Intergenic
1026010148 7:66629532-66629554 CATCAGCTCTCGGGGCTCCAGGG - Intronic
1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG + Exonic
1029548308 7:101222855-101222877 CAGAGGCACCAGGAGCTCCTGGG - Intronic
1029594103 7:101527774-101527796 CTGTGGCCCCAGGTGCTCCAGGG + Intronic
1032191380 7:129767750-129767772 CAGGGGCTAAAGGGGCACCAGGG + Intergenic
1032192520 7:129772929-129772951 CAGACACTCCAGAGGCTCCAGGG + Intergenic
1032345129 7:131109913-131109935 CCGCGGCCCCAGGGGATCCTTGG - Intergenic
1034268294 7:149791556-149791578 CAGGGCCCCCATGGGCTCCAGGG - Intergenic
1034272887 7:149811928-149811950 CACTGGCTCCAAGGGGTCCAGGG - Intergenic
1034274459 7:149817968-149817990 CACGGGCCCCACGGGCTCCAGGG - Intergenic
1034346776 7:150390260-150390282 CCTCAGCTCCAGGGCCTCCAGGG + Intronic
1035179685 7:157080268-157080290 CAGCGGCTCCCGGGCATCAAGGG - Intergenic
1035381322 7:158443245-158443267 CAGCGGCTCCCGCGGCTCCAGGG + Intronic
1036608479 8:10329289-10329311 CTGCTCCCCCAGGGGCTCCAGGG + Intronic
1036788776 8:11704251-11704273 CTGCAGCTCCGGGGGCTCCCAGG + Exonic
1037628597 8:20631301-20631323 CAGCACAGCCAGGGGCTCCAAGG + Intergenic
1037710234 8:21349522-21349544 CAGTGGCTCATGGGGCCCCAGGG + Intergenic
1037814974 8:22107328-22107350 CAGCTCCTCCAGCGGCTTCAGGG - Exonic
1037909874 8:22737995-22738017 GATGGGCTCCCGGGGCTCCAAGG - Intronic
1038147896 8:24914803-24914825 CTGCCGCTCCAGGGACTCCTTGG - Exonic
1038484395 8:27923356-27923378 CAGTGTCTCCTGGAGCTCCAGGG + Intronic
1039399077 8:37253321-37253343 GAGAGGGTCCAGGGGCTCCATGG + Intergenic
1041264169 8:56047651-56047673 AAGAGGCTCCAGAGGCTACAAGG - Intergenic
1042920176 8:73912451-73912473 GCGCTGCTGCAGGGGCTCCAGGG - Intergenic
1045476872 8:102560753-102560775 CAGGGGCTGCAGGGGCTGCAAGG - Exonic
1045476874 8:102560762-102560784 CAGGGGCTGCAGGGGCTGCAGGG - Exonic
1045476877 8:102560771-102560793 CAGGGGTTGCAGGGGCTGCAGGG - Exonic
1045476880 8:102560780-102560802 CAGGGGCTGCAGGGGTTGCAGGG - Exonic
1046659923 8:116938286-116938308 CAGGGGCTCCAGGGACTCCCAGG + Exonic
1047051097 8:121114320-121114342 CATCGGCTACAGGGCCTCTACGG - Intergenic
1047438723 8:124857549-124857571 CAGCAGCTCCAGTTGCTCAAGGG + Intergenic
1047494085 8:125397305-125397327 TAGTGGCTCCAGGTGCTCCTTGG + Intergenic
1048345622 8:133572366-133572388 CAGTGGCTCCCGGGCCTCCCGGG - Intergenic
1048377184 8:133833260-133833282 CATCGGCCTCAGAGGCTCCACGG - Intergenic
1049040876 8:140110958-140110980 GAGCTGCTGCAGGGGCTGCAGGG - Intronic
1049093629 8:140535089-140535111 CAGCTGCTGCAGGGGCCGCATGG - Intronic
1049297210 8:141848520-141848542 CACCTGCTGCAGGAGCTCCAGGG - Intergenic
1049341544 8:142115119-142115141 CAGAGCCTCCTGGGGCTCCTGGG + Intergenic
1049507952 8:143013827-143013849 CAGCGGCAGCAGGGGCTGGATGG + Intergenic
1049525190 8:143121841-143121863 GAGAGGATCCAGGGGTTCCAGGG - Intergenic
1049571134 8:143370793-143370815 CAGGGGCTGCAGGGGCTCCCGGG + Intronic
1049680950 8:143917911-143917933 CTGCGCCTCCAGGAGCTCAAAGG + Exonic
1049682382 8:143925306-143925328 CAGCTCCTCCAGGGCCTGCAGGG + Exonic
1049832766 8:144712907-144712929 CAACAGCCCCAGGGGCACCAGGG + Intergenic
1050412715 9:5383170-5383192 CAGTGGCTCCAGGCGTTCCTTGG - Intronic
1053696271 9:40642260-40642282 CTGGGGCTCCTGGGGCTCCTGGG - Intergenic
1054307518 9:63441479-63441501 CTGGGGCTCCTGGGGCTCCTGGG - Intergenic
1054307522 9:63441488-63441510 CTGGGGCTCCTGGGGCTCCTGGG - Intergenic
1054406250 9:64765490-64765512 CTGGGGCTCCTGGGGCTCCTGGG - Intergenic
1054439877 9:65250963-65250985 CTGGGGCTCCTGGGGCTCCTGGG - Intergenic
1054490529 9:65770976-65770998 CTGGGGCTCCTGGGGCTCCTGGG + Intergenic
1056604610 9:88076508-88076530 CAGGAGCTGCAGGGGCTCGAGGG - Intergenic
1056922126 9:90800733-90800755 CAGCGGATTCAGAGACTCCAGGG - Intergenic
1059436895 9:114282498-114282520 CAGGGGGTCCAGGGTCTCCAGGG - Exonic
1059657372 9:116368774-116368796 CAGTAGCTCCCTGGGCTCCATGG - Intronic
1060153678 9:121304290-121304312 CAAGGGCACAAGGGGCTCCAGGG - Intronic
1060743237 9:126113279-126113301 CAGGGGCTCCTGGGGCTCATGGG + Intergenic
1060827568 9:126695583-126695605 CCGCCCCTCCAGGGGATCCAGGG - Intronic
1060933830 9:127504747-127504769 CAACAGCTGCAGGGGCTCGAGGG + Intergenic
1061038049 9:128124394-128124416 CAGCAGCTCCACGTGCTCCCAGG + Intronic
1061042160 9:128146454-128146476 GACCGACTCCAAGGGCTCCAGGG - Intergenic
1061537177 9:131257506-131257528 CAGCCACTCCAGGACCTCCAGGG + Intergenic
1061885223 9:133587894-133587916 TATCTGCTCCAGGGGCTCCCAGG - Intergenic
1062133925 9:134914774-134914796 CTGCCTTTCCAGGGGCTCCAGGG + Exonic
1062221501 9:135418470-135418492 CAGTGGATCCAGGGTCCCCAAGG + Intergenic
1202778719 9_KI270717v1_random:15921-15943 CTGGGGCTCCTGGGGCTCCTGGG - Intergenic
1186341544 X:8651120-8651142 CAGCGGCTCCAGAGTTCCCAGGG - Intronic
1187297028 X:18012032-18012054 CAGCAGCTACAGCGGCTCCCTGG + Intergenic
1188156447 X:26748526-26748548 CAGCAGCTTCAGGGCCCCCATGG + Intergenic
1188476838 X:30600931-30600953 AAGCGGTTCCAGGGGTGCCAAGG - Intergenic
1189122438 X:38408984-38409006 AAGCGGCTCCAGGCTTTCCAAGG + Exonic
1192267107 X:69546591-69546613 CAGTGGCTGCAGCTGCTCCAGGG - Intergenic
1192737338 X:73861884-73861906 CAGCAGCTCCAGGGGCTGTTTGG + Intergenic
1195252687 X:103063924-103063946 CAGTGGCGGCTGGGGCTCCAGGG - Intronic
1195884317 X:109624189-109624211 CAGCTGCTCCAGGGGCTGCCAGG - Exonic
1200075803 X:153549974-153549996 CTGGGGCTCCAGGGGCAGCATGG + Intronic
1200286837 X:154830836-154830858 CAGCAGCTTCTGGGGTTCCATGG + Exonic
1200915167 Y:8565032-8565054 CAGCAGCTCCTGAGGCTGCATGG - Intergenic
1200964715 Y:9025601-9025623 CAGCAGCTCCTGAGGCTGCATGG + Intergenic
1201472711 Y:14351693-14351715 GAGCTGCTGCAGGGGTTCCAGGG + Intergenic
1202148058 Y:21820737-21820759 CAGCAGCTCCTGAGGCTGCATGG - Intergenic