ID: 1161582678

View in Genome Browser
Species Human (GRCh38)
Location 19:5089357-5089379
Sequence GCTACAGATATCCCTAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161582678_1161582689 30 Left 1161582678 19:5089357-5089379 CCATGTCTAGGGATATCTGTAGC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1161582689 19:5089410-5089432 CAGGGGATGGGTTGAACCAGTGG 0: 1
1: 0
2: 0
3: 16
4: 182
1161582678_1161582683 11 Left 1161582678 19:5089357-5089379 CCATGTCTAGGGATATCTGTAGC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1161582683 19:5089391-5089413 TAGTGGAAAGTTCTATGACCAGG 0: 1
1: 0
2: 0
3: 8
4: 101
1161582678_1161582685 13 Left 1161582678 19:5089357-5089379 CCATGTCTAGGGATATCTGTAGC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1161582685 19:5089393-5089415 GTGGAAAGTTCTATGACCAGGGG 0: 1
1: 0
2: 1
3: 11
4: 147
1161582678_1161582684 12 Left 1161582678 19:5089357-5089379 CCATGTCTAGGGATATCTGTAGC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1161582684 19:5089392-5089414 AGTGGAAAGTTCTATGACCAGGG 0: 1
1: 0
2: 1
3: 13
4: 152
1161582678_1161582686 17 Left 1161582678 19:5089357-5089379 CCATGTCTAGGGATATCTGTAGC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1161582686 19:5089397-5089419 AAAGTTCTATGACCAGGGGATGG 0: 1
1: 0
2: 0
3: 13
4: 145
1161582678_1161582687 18 Left 1161582678 19:5089357-5089379 CCATGTCTAGGGATATCTGTAGC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1161582687 19:5089398-5089420 AAGTTCTATGACCAGGGGATGGG 0: 1
1: 0
2: 0
3: 3
4: 121
1161582678_1161582679 -6 Left 1161582678 19:5089357-5089379 CCATGTCTAGGGATATCTGTAGC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1161582679 19:5089374-5089396 TGTAGCCCCGTTTGTTGTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161582678 Original CRISPR GCTACAGATATCCCTAGACA TGG (reversed) Intronic
906805838 1:48777819-48777841 GCTCCAGAAATCCCTAGCCTTGG - Intronic
913314701 1:117540019-117540041 GCCACAGAAACCCCTGGACAGGG + Intergenic
921108260 1:212005841-212005863 GTCACAGATATCCCAAGATAAGG - Intronic
922959303 1:229632424-229632446 TCTTCAGATTTCCCTAGTCAAGG + Exonic
1065752577 10:28900743-28900765 GATACAGATATCCCCACTCAAGG - Intergenic
1069858667 10:71456464-71456486 GCTCCAGATGTGCCCAGACAGGG - Intronic
1071425048 10:85540951-85540973 GATACTGATATCCCTAGGCAAGG + Intergenic
1079658913 11:23016867-23016889 GCCACAGGTATCCCTAGACCTGG - Intergenic
1082906643 11:58314736-58314758 GCTACAGATATTTGTATACATGG + Intergenic
1083503849 11:63137041-63137063 GCTACAGACATCCCACCACAGGG - Intronic
1084183211 11:67456671-67456693 GCAACAGACATCCCGAGCCAGGG - Intronic
1086787213 11:90983653-90983675 ACTATAGATATACATAGACATGG + Intergenic
1098144735 12:67487107-67487129 TCTACATATATCCCTAGGAAAGG + Intergenic
1098260550 12:68665768-68665790 GCTGCAGATATACATAGACCTGG - Exonic
1098612744 12:72481262-72481284 GTTCAAGATATCCCTAGACAAGG + Intronic
1106677076 13:31971972-31971994 GCTACAGATATCAACTGACATGG - Intergenic
1109128452 13:58548583-58548605 GCAATAGATATCCCTCGTCAAGG - Intergenic
1113414738 13:110119535-110119557 CCTACAGATATGCCTGCACATGG + Intergenic
1119524438 14:75310980-75311002 GTTACAGAAATCCATAGAGAAGG + Intergenic
1121574577 14:94973301-94973323 GCTAGAAGTATCCCTAGACATGG - Intergenic
1125166758 15:36714967-36714989 GATTCAGATATAACTAGACAGGG + Intronic
1126301890 15:47206585-47206607 GCTACTGTTTTCCTTAGACATGG - Intronic
1127716556 15:61654401-61654423 GCCACCGAGATCCCTAGAGAAGG - Intergenic
1131284303 15:91044351-91044373 GCTAAAAATATCCCTGGACCAGG - Intergenic
1131687890 15:94790626-94790648 TCTAGAGATATCATTAGACAAGG + Intergenic
1133442020 16:5829006-5829028 GCTGCAGATATCCGAAGACCTGG + Intergenic
1138460373 16:57144206-57144228 GCAACAGGTATCCCCAGCCAAGG + Intronic
1144593992 17:16550540-16550562 GCTACCTATATCCCAAGAGAAGG - Intergenic
1145314968 17:21724800-21724822 CCTACAGTTCTCCCTGGACATGG + Intergenic
1145713405 17:26996738-26996760 CCTACAGTTCTCCCTGGACATGG + Intergenic
1152516036 17:80825477-80825499 GCTGCAGCTAGGCCTAGACAAGG - Intronic
1154067155 18:11118157-11118179 GGTACAGATGTCCCTACAAATGG + Intronic
1155371222 18:25103127-25103149 GATAGAGATATCTCTAGATATGG + Intronic
1157887992 18:51387176-51387198 GCTACCAATAGCCCAAGACAAGG - Intergenic
1159394724 18:67841042-67841064 GCTATTATTATCCCTAGACATGG - Intergenic
1160098658 18:75900534-75900556 ACTAAAGATATCCAAAGACAGGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1161582678 19:5089357-5089379 GCTACAGATATCCCTAGACATGG - Intronic
1163207446 19:15814034-15814056 GCCACAGACATCCCTAGAGCAGG + Intergenic
926549535 2:14284926-14284948 ACTTCAGATATCCCCAGACAAGG - Intergenic
933447659 2:82402769-82402791 GCTGCAGATACCCATAGCCAGGG - Intergenic
934670643 2:96210119-96210141 GCTACAGATACCCTGTGACAGGG - Intergenic
934941521 2:98506527-98506549 CCTACAGAGACCTCTAGACAAGG + Intronic
936238011 2:110761786-110761808 GGTACAGATCTCACTAGAGAAGG - Intronic
937515547 2:122651062-122651084 CCTACAGGTAGCCCTACACAGGG + Intergenic
939768282 2:146281241-146281263 GCTACAGATATATCTATCCATGG - Intergenic
939828199 2:147040759-147040781 GCTACATTTCTCCCTAAACATGG - Intergenic
941775515 2:169389046-169389068 GTTATAGATACCCTTAGACATGG + Intergenic
943542565 2:189235787-189235809 CATACTGCTATCCCTAGACAAGG + Intergenic
1171428600 20:25064381-25064403 TGTACAGATAGCACTAGACAGGG + Intergenic
1182780334 22:32862458-32862480 GCCACAGTTTGCCCTAGACAGGG - Exonic
1183066090 22:35363979-35364001 GCTAAAAACATCCCTAGACCTGG - Intergenic
954961513 3:54569485-54569507 GCTACCTTTATCCCTAGCCAAGG + Intronic
955378109 3:58414972-58414994 GTTACAGAAATGGCTAGACAAGG + Intronic
960737979 3:120801380-120801402 GCTTCTGATCTCCCTGGACAGGG + Intergenic
961822639 3:129582962-129582984 GCTGCAGCTGTCCCTGGACAGGG - Intronic
969087273 4:4665839-4665861 GACACAGACATCCCCAGACATGG + Intergenic
977719496 4:100223417-100223439 GCTACAGGTATCCTTGGAAAAGG - Intergenic
978435906 4:108684356-108684378 GTTATAGATGTCCCAAGACAGGG + Intergenic
981685856 4:147453768-147453790 CCAAAAGATATCCATAGACAGGG - Intergenic
982284553 4:153721548-153721570 GATACATATTTCCCTGGACATGG - Intronic
983469795 4:168142223-168142245 CCTACACATATTCCTACACATGG + Intronic
988478701 5:31611181-31611203 GCTTTAAATATCCCCAGACAAGG + Intergenic
989518195 5:42368565-42368587 GCTATAGAAATCTCTAGATATGG - Intergenic
991739803 5:69658561-69658583 GCTACAGAATACCATAGACAGGG + Intergenic
991757696 5:69894616-69894638 GCTACAGAATACCATAGACAGGG - Intergenic
991791378 5:70238302-70238324 GCTACAGAATACCATAGACAGGG + Intergenic
991819266 5:70534686-70534708 GCTACAGAATACCATAGACAGGG + Intergenic
991837099 5:70770498-70770520 GCTACAGAATACCATAGACAGGG - Intergenic
991883827 5:71238644-71238666 GCTACAGAATACCATAGACAGGG + Intergenic
996940179 5:128995270-128995292 CCTAGATATATCCCTAGATATGG - Intronic
997457496 5:134028069-134028091 GCTATAGAAATACCTGGACATGG - Intergenic
999118392 5:149185496-149185518 GCTGCAGATCTCCCTACAAAAGG - Intronic
999274249 5:150318504-150318526 AATACAGATATCAATAGACATGG + Intronic
1005550199 6:26904459-26904481 GCTACAGAATACCATAGACAGGG + Intergenic
1006728049 6:36214214-36214236 GCTACAGAGAAGCCCAGACAGGG + Exonic
1015321879 6:131885416-131885438 GCTACAGATATCCTGAGTCTAGG + Intronic
1016699378 6:147036715-147036737 ACTACAGATATCTGTAGACCCGG - Intergenic
1022982486 7:35617603-35617625 CCTGCAGACATCCCTAGAAAGGG - Intergenic
1034151612 7:148921193-148921215 TCTACAGATGTCCCTTGATAAGG - Intergenic
1036694080 8:10963396-10963418 TCCATGGATATCCCTAGACACGG + Intronic
1036717552 8:11140560-11140582 GGGACAGTTATCACTAGACAAGG + Intronic
1037523859 8:19706027-19706049 GCTACAAATAAACCCAGACATGG + Intronic
1041720859 8:60974112-60974134 GCTGAATATATCCCTACACAAGG - Intergenic
1044910657 8:97054961-97054983 TCTACAGATAGCCATAGGCATGG + Intronic
1046433317 8:114155839-114155861 GCTATAAATATCCCTACAGATGG + Intergenic
1050311500 9:4357754-4357776 CCTACAGAAATACCTGGACATGG + Intergenic
1052963580 9:34320715-34320737 GCTACAGATCTCCCTTGGGAAGG + Intronic
1053397686 9:37789132-37789154 GCTACAGATATTTTTACACAAGG + Intronic
1056315748 9:85388178-85388200 TCTAAAGATATTCCTAGCCATGG - Intergenic
1060502831 9:124175392-124175414 GGTACAGGGATTCCTAGACATGG - Intergenic
1061564963 9:131432610-131432632 CCTGCAGTTATTCCTAGACATGG + Exonic
1186083928 X:5965473-5965495 GCTTCAGTTATGCCTACACATGG + Intronic
1186995638 X:15118754-15118776 GCTAAATATATCCATATACATGG - Intergenic
1188254185 X:27939698-27939720 GCTATAGAAATCCCTATACCAGG + Intergenic
1192000169 X:67141248-67141270 CATACTGCTATCCCTAGACAAGG - Intergenic
1193488199 X:82114513-82114535 ACTACAAATAAGCCTAGACAGGG - Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1201488033 Y:14512407-14512429 GCTACAGATGGCCTTACACATGG + Intergenic