ID: 1161584566

View in Genome Browser
Species Human (GRCh38)
Location 19:5098178-5098200
Sequence TAGAAGCCCCATTAACAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161584559_1161584566 26 Left 1161584559 19:5098129-5098151 CCTCAGTGTGTAGCCTCCGTGGC No data
Right 1161584566 19:5098178-5098200 TAGAAGCCCCATTAACAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 78
1161584564_1161584566 -2 Left 1161584564 19:5098157-5098179 CCATGTGTAGTACATGGTCAGTA 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1161584566 19:5098178-5098200 TAGAAGCCCCATTAACAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 78
1161584561_1161584566 10 Left 1161584561 19:5098145-5098167 CCGTGGCAGCCTCCATGTGTAGT 0: 1
1: 2
2: 34
3: 688
4: 1239
Right 1161584566 19:5098178-5098200 TAGAAGCCCCATTAACAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 78
1161584563_1161584566 1 Left 1161584563 19:5098154-5098176 CCTCCATGTGTAGTACATGGTCA 0: 1
1: 0
2: 2
3: 5
4: 87
Right 1161584566 19:5098178-5098200 TAGAAGCCCCATTAACAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 78
1161584560_1161584566 13 Left 1161584560 19:5098142-5098164 CCTCCGTGGCAGCCTCCATGTGT 0: 1
1: 0
2: 0
3: 23
4: 161
Right 1161584566 19:5098178-5098200 TAGAAGCCCCATTAACAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161584566 Original CRISPR TAGAAGCCCCATTAACAGCA GGG Intronic
900711124 1:4115058-4115080 TGGAAGCAACATTAAGAGCAAGG - Intergenic
902286356 1:15410639-15410661 GAGAAGCCCCACTAACAGCGCGG - Intronic
908487085 1:64605575-64605597 TAGAAGCTCCATTAACCTCCTGG + Intronic
911147327 1:94565351-94565373 AAGAAGCCCCATGAGCAGGATGG - Intergenic
912215846 1:107610861-107610883 TAAAAATCCCATTAATAGCATGG - Intronic
918959674 1:191257371-191257393 TAAAAGCTCCATTAACACAAAGG - Intergenic
1070267691 10:74920280-74920302 TTGAAGCCCCATTTACAATAGGG + Intronic
1070267832 10:74921473-74921495 TAGATGCCCAAAAAACAGCAAGG - Intronic
1070330568 10:75413915-75413937 TAGAAGCCACCTGAACAGCCAGG - Intergenic
1075794884 10:125112785-125112807 TAAAAGCCCCATTAAAAGAGGGG - Intronic
1079306054 11:19323680-19323702 TACAAGCACCATTTAGAGCAAGG - Intergenic
1083755848 11:64791293-64791315 TAGAGGCCCCATTCTCAGCCAGG - Intronic
1085233360 11:74991927-74991949 TGGAAGCTCCAGAAACAGCAAGG - Intronic
1087747451 11:101965452-101965474 TAGAAGCCACATTAGCAGAAGGG + Intronic
1090459841 11:126881257-126881279 AAGAAGCCCCATTAACAGAGAGG - Intronic
1092873657 12:12829999-12830021 TATAAGGCCCTTTAACACCAAGG - Intergenic
1093567223 12:20621970-20621992 TAGAAGCCCAATTAAGAACCTGG + Intronic
1095136130 12:38606221-38606243 TATAAACCACATTAACAGAAAGG + Intergenic
1096181041 12:49550486-49550508 GAGAAGCCCCAGTGACTGCAAGG + Intronic
1096283904 12:50281651-50281673 TAAATGCCACATTAACAACAGGG + Intronic
1106188524 13:27429057-27429079 TAGAAGCCCCCCTAACTGCAGGG - Intronic
1108049418 13:46416333-46416355 TAGATGCTCCATCAAAAGCATGG - Intronic
1109541937 13:63789612-63789634 TAGATGCTCCATCAAAAGCATGG - Intergenic
1115972226 14:38958409-38958431 TTGAAGCCCCATTAAGAATAAGG + Intergenic
1118492997 14:66280007-66280029 AGGAAGACCCATTAAGAGCATGG + Intergenic
1120266367 14:82256210-82256232 CAAAAGGCCCATGAACAGCAGGG - Intergenic
1120663779 14:87281269-87281291 TTGAAGCCCCATTATCATCAAGG + Intergenic
1127013267 15:54653782-54653804 AACAAACCCCATTAATAGCATGG + Intergenic
1129824655 15:78626698-78626720 TAGAACCCCCATTTACAATAAGG - Intronic
1132010061 15:98267701-98267723 TGGAGGCCCCATAACCAGCAGGG - Intergenic
1133325275 16:4938184-4938206 TAGAAGCCCCATTAAGAATAAGG - Intronic
1141425510 16:83942156-83942178 TACAAGCCCCACCCACAGCAAGG + Intronic
1144247282 17:13379540-13379562 CAGCAGCCCCATCAATAGCAGGG - Intergenic
1144505133 17:15822947-15822969 GAGAAGCTCCATTAACAGAAAGG - Intergenic
1145169306 17:20640830-20640852 GAGAAGCTCCATTAACAGAAAGG - Intergenic
1151034304 17:70780161-70780183 TGGAAGCTCCATTACTAGCAAGG - Intergenic
1152936643 17:83141732-83141754 TAAAAACCCTATTAAAAGCAAGG + Intergenic
1156821058 18:41373484-41373506 TAGAAGACACATCAAAAGCAGGG + Intergenic
1157271239 18:46277956-46277978 TTGAAGACCCAGTAACAGAATGG + Intergenic
1159135174 18:64329094-64329116 TAGAAGCCCCAATTAGAGGATGG - Intergenic
1160106378 18:75982205-75982227 TAGCTGCACCATTTACAGCAAGG + Intergenic
1161584566 19:5098178-5098200 TAGAAGCCCCATTAACAGCAGGG + Intronic
1164944412 19:32281351-32281373 CAGAAGCCACAATGACAGCAGGG - Intergenic
1165868806 19:38955854-38955876 TAGCAGCCCCATTTTCAGAAAGG - Intronic
1167374226 19:49102551-49102573 TAGCAGCCCCATAGAAAGCACGG - Intronic
1168338777 19:55611990-55612012 GAGAAGCCCCACTAAGGGCAAGG + Intronic
1168338790 19:55612028-55612050 GAGAAGCCCCACTAAGGGCAAGG + Intronic
925368588 2:3327689-3327711 CAGAGGCCTCATTTACAGCAGGG - Intronic
925480233 2:4262456-4262478 TAGAAGCACCACAAAAAGCAAGG - Intergenic
926964828 2:18398427-18398449 TAGAAGCCACATTTACAGAATGG - Intergenic
928497696 2:31850903-31850925 AAGAAGCCCCATGCCCAGCATGG + Intergenic
930453154 2:51570076-51570098 TAAATGCCCCATGAACAGCTTGG + Intergenic
932301858 2:70673113-70673135 TAGAAGTCTCATTATCAGCCAGG - Intronic
934715832 2:96542752-96542774 AAGAAGCCCCAGTCACACCAAGG + Intronic
936064098 2:109317499-109317521 CAGCAGCCCCGTTCACAGCAGGG + Intronic
936243840 2:110809658-110809680 TCAAACCCCCATCAACAGCAGGG - Intronic
946084179 2:217154453-217154475 AAGAAGTTTCATTAACAGCAAGG + Intergenic
1169612438 20:7397111-7397133 TAGAACCCCCACTAACCTCAAGG - Intergenic
1170395961 20:15925914-15925936 TCCATGCCCCATTAACAGAAGGG - Intronic
1170511946 20:17086433-17086455 AAGCAGCACCATTAACACCAGGG - Intergenic
1175671936 20:60910764-60910786 GAGAAGCCCCATGAAGAGGAAGG - Intergenic
1179979736 21:44889701-44889723 TTGAGGTCCCATTCACAGCAGGG - Intronic
1183571351 22:38656043-38656065 TAGAAGCCGCCATAACGGCACGG + Intronic
950454611 3:13085257-13085279 GAGCAGCCCCAGTAGCAGCAAGG + Intergenic
956697086 3:71927744-71927766 TACAAACCACATTAACAGCTCGG - Intergenic
956789848 3:72672143-72672165 TAGAAGAGCCATTCCCAGCAGGG + Intergenic
958761949 3:98319838-98319860 TTGAAGACCCAGTAACAGCATGG - Intergenic
964017084 3:151960987-151961009 TAGAAGCATCATTAAGAGCACGG - Intergenic
966793309 3:183692539-183692561 GAGAAGCCCCATTACCTTCAGGG - Intergenic
966944987 3:184771437-184771459 GAGAAGCCACACTGACAGCAGGG + Intergenic
985270547 4:188190535-188190557 GAGATGCCACATTAACAGAAAGG - Intergenic
987046723 5:14115829-14115851 TAGGAGCCCCATGAGGAGCATGG - Intergenic
987083333 5:14446040-14446062 AAGAACACCAATTAACAGCACGG - Intronic
987792271 5:22582958-22582980 TAGATGACCCTTTAGCAGCAGGG - Intronic
991646488 5:68805713-68805735 AAGAAGCCCAATAAACACCAAGG + Intergenic
992334605 5:75752986-75753008 TAGAAGCCTCAGTAACTGCCTGG - Intergenic
996771157 5:127087294-127087316 TAGATGCCTCATTAACTGCATGG + Intergenic
997322683 5:132991663-132991685 TACAAACACCATTAACATCAAGG + Intergenic
999277051 5:150338500-150338522 AAGAAGCCCCATTTAAAGCAGGG - Intronic
1001138417 5:169122095-169122117 TAGAAGCAGCATTATCTGCAGGG - Intronic
1002307790 5:178293926-178293948 TAGAAGCCCCTTACACAGCCTGG - Intronic
1005392544 6:25348425-25348447 TAGAAGCGCGTTTAACAGCAAGG - Intronic
1022991939 7:35717246-35717268 TAAAAGACCCATTAACAGTAAGG + Intergenic
1027629232 7:80581536-80581558 TAAAAGCAACATCAACAGCAAGG + Intronic
1029213711 7:98929887-98929909 TAGAAACTCCATAAAAAGCAGGG - Intronic
1030332459 7:108285572-108285594 AACAAGCCCCATTAACAGTTTGG - Intronic
1030790036 7:113713843-113713865 TAGAAGCACCAACAATAGCAGGG - Intergenic
1036577370 8:10040629-10040651 CAGTGGCCCCATTATCAGCAGGG + Intergenic
1037540240 8:19863979-19864001 TAGAAGCCACATTAAAAACACGG - Intergenic
1040355677 8:46616294-46616316 TAGTAGCCCCATTAAAAAAAAGG + Intergenic
1059635514 9:116166484-116166506 AGAAAGCCCCATTAACAGAAAGG - Intronic
1186544805 X:10437844-10437866 TAAAAGCACCATTAACAGGTAGG - Intergenic
1186723557 X:12331513-12331535 TAGAAGCCCCGTGAAGTGCAAGG + Intronic
1195918182 X:109956364-109956386 TATAAACCACAATAACAGCAAGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic