ID: 1161586333

View in Genome Browser
Species Human (GRCh38)
Location 19:5107783-5107805
Sequence GCTCAGCAGGGCCACAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161586333_1161586339 17 Left 1161586333 19:5107783-5107805 CCCACACTGTGGCCCTGCTGAGC No data
Right 1161586339 19:5107823-5107845 CGACTACCCTGTGTCCTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161586333 Original CRISPR GCTCAGCAGGGCCACAGTGT GGG (reversed) Intronic