ID: 1161586333

View in Genome Browser
Species Human (GRCh38)
Location 19:5107783-5107805
Sequence GCTCAGCAGGGCCACAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161586333_1161586339 17 Left 1161586333 19:5107783-5107805 CCCACACTGTGGCCCTGCTGAGC 0: 1
1: 0
2: 1
3: 23
4: 254
Right 1161586339 19:5107823-5107845 CGACTACCCTGTGTCCTCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161586333 Original CRISPR GCTCAGCAGGGCCACAGTGT GGG (reversed) Intronic
900327348 1:2115164-2115186 GCTCAGTCGGGCCCCTGTGTGGG + Intronic
900889359 1:5438374-5438396 GCCCAGTAGGGCCTCTGTGTGGG + Intergenic
900951301 1:5859530-5859552 CCTCAGCTTGGCCACAGTGGAGG + Intergenic
901078617 1:6571175-6571197 GCTCAGCAGGGCGGCTGTGGTGG - Exonic
901259687 1:7862257-7862279 GCCCAGCAGGCCCACTGTGAGGG - Intergenic
901879660 1:12186276-12186298 GCTCAGCAGGCCCAAACTCTGGG + Intronic
901916265 1:12502910-12502932 ACTCTGCAGGGCCACTGTGATGG - Intronic
902334824 1:15748741-15748763 GCTCAGGAAGGCCAAAGGGTTGG + Intergenic
902395095 1:16128248-16128270 GCCCAGCAGGGCCACAGGCTTGG - Intronic
902659413 1:17890856-17890878 GCTGAGCAGAGCCACAGAGATGG - Intergenic
902802744 1:18840400-18840422 GGCCAGCAGGGCCACAGCGATGG + Exonic
904419432 1:30382111-30382133 CCACACCAGGGCCTCAGTGTTGG + Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
906102643 1:43273021-43273043 GCGCAGCAGGGCCACATGGTGGG - Exonic
906323424 1:44830126-44830148 GCTCAGTAGGGCTGGAGTGTAGG + Intronic
909039983 1:70637857-70637879 GTTCAGTAGGGCTACAGTGAAGG + Intergenic
910070532 1:83207895-83207917 GCTTAGAAAGGACACAGTGTTGG - Intergenic
911053914 1:93694948-93694970 GCCCAGGTGGGCCAGAGTGTAGG - Intronic
911095602 1:94052486-94052508 GCTCAGCAGGGCCAGGTTCTGGG - Intronic
913402820 1:118455034-118455056 TCCCAGCAGGGACCCAGTGTGGG + Intergenic
914344586 1:146787761-146787783 GCCCAGCAGGGCTACCCTGTAGG + Intergenic
915588620 1:156858590-156858612 GCTCCCCAGGGCCACAGACTAGG + Exonic
916176225 1:162041404-162041426 GCTCAGCCAGGCCACAGTAAAGG + Intergenic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
917569001 1:176244366-176244388 GCTCCTGAGGGCCACAATGTTGG - Intergenic
919766016 1:201127762-201127784 GCTCTCCAGGGACACAGTGCAGG + Intergenic
921169051 1:212529497-212529519 ACTCTGCAGGGCCACATTATTGG + Intergenic
921338066 1:214107951-214107973 GCTCCGCAGGCCCACAATGCAGG + Intergenic
923622629 1:235590720-235590742 GGTGTGCAGGGCCACAGTGCTGG - Intronic
924616030 1:245612855-245612877 GGTCTGTAGGGGCACAGTGTTGG - Intronic
924798720 1:247311637-247311659 GCTCCCCAGGCCCACTGTGTTGG + Intronic
1064642434 10:17428280-17428302 ACTAAGGAGGGCCAGAGTGTGGG - Intronic
1067901713 10:50248524-50248546 GCTGAGAAGGGCCACTGTGATGG + Exonic
1069716802 10:70526355-70526377 ACTCACCACGTCCACAGTGTGGG + Intronic
1070566233 10:77605653-77605675 CCTCAACTGGGCCAGAGTGTGGG - Intronic
1072687555 10:97547467-97547489 GCTCAACAGGGACAGAGAGTGGG - Intronic
1072897019 10:99376114-99376136 ACTGAGAAGGGCCAAAGTGTGGG - Intronic
1073750936 10:106526503-106526525 GTTCCCCAGTGCCACAGTGTTGG + Intergenic
1076268642 10:129131335-129131357 GCTCAGCATGGTCACCTTGTTGG + Intergenic
1076526976 10:131118049-131118071 GCTCAGCATGGTCAGAGTGAGGG - Intronic
1076628901 10:131841140-131841162 GCTCAGCTGCCCCACAGTGAAGG - Intergenic
1076810711 10:132885007-132885029 GCTCAGCAGGGACCTGGTGTGGG - Intronic
1076902997 10:133348968-133348990 GCTCAGCAGGGCTGCAGTCAAGG - Intronic
1084257177 11:67951124-67951146 GCTCTGCAGGTCCCCAGCGTGGG + Intergenic
1084447185 11:69210416-69210438 GATAGGCAGGGCCACACTGTGGG + Intergenic
1084598556 11:70131666-70131688 GCTCAGCAGGGCCTCATGCTTGG - Intronic
1084676721 11:70639755-70639777 GCCCTGCAGGCCCACAGGGTGGG + Intronic
1088020106 11:105108913-105108935 ACTCATCAGGACCACAGTTTTGG + Intergenic
1088705586 11:112461351-112461373 GCATACCAGGGCCAAAGTGTAGG - Intergenic
1089003746 11:115073717-115073739 GTTCAGCATGGCTACAGTATAGG + Intergenic
1089625153 11:119746375-119746397 ACTCAGCACAGCCACTGTGTGGG - Intergenic
1091633548 12:2180363-2180385 GCCCAGCAGGGCCTGAGTGCTGG + Intronic
1091991214 12:4957474-4957496 GCTCAGCTGGGCCACCTTGCCGG + Intergenic
1094495074 12:30984133-30984155 GCTCAGCAGGAGCTGAGTGTGGG + Intronic
1094781396 12:33795866-33795888 TCACAGAGGGGCCACAGTGTTGG - Intergenic
1095206942 12:39449121-39449143 GTTCAGAAGGGCCACACTCTTGG - Intergenic
1096459780 12:51815641-51815663 GGTAGGCAGGGCCCCAGTGTTGG - Intergenic
1097179337 12:57162441-57162463 GCGCAGAAGGGTCACAGTGGGGG - Exonic
1100438134 12:94590663-94590685 GCTCAGCATGGCCCCACAGTGGG + Intronic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1102666372 12:114577478-114577500 GCAGAGCAGGGCCACCCTGTAGG + Intergenic
1102986467 12:117282418-117282440 GATCAGCAGGGACACAGTTCTGG - Intronic
1103560267 12:121789896-121789918 GCTCATCAGGGCCAAGGTGTGGG - Intronic
1103618928 12:122174050-122174072 GCTCAGCAGGGCTGCAGGGATGG - Intronic
1106192532 13:27466306-27466328 CTTCAGCAGGACCACAGTGGAGG + Intergenic
1107125029 13:36837598-36837620 TCCCAGCAAGGGCACAGTGTAGG - Intergenic
1109512995 13:63404127-63404149 CCCCAGCAGGGACTCAGTGTGGG + Intergenic
1112210536 13:97373001-97373023 GTTCAGCAAGGCCCCAGTGTGGG + Intronic
1112338457 13:98533830-98533852 GCTCCGCAAGGTCACAGTGCAGG + Intronic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1115601242 14:34957692-34957714 GCTGACCAGGGTCACAGAGTTGG + Intergenic
1119400392 14:74358639-74358661 GCTCAGCAAGGGCCCACTGTGGG - Exonic
1121754957 14:96394478-96394500 GCTGAGTAGGGCCACATTCTGGG - Intronic
1121890230 14:97583387-97583409 GCTCCCCAGGGCCAGTGTGTGGG - Intergenic
1122642727 14:103169984-103170006 CCTCAGGATGGCCACAGTGTTGG + Intergenic
1122900843 14:104781733-104781755 ACCCAGCAGGGCCTGAGTGTGGG + Intronic
1124510594 15:30321001-30321023 TCTCAGAAGGGACACAGGGTGGG - Intergenic
1124732294 15:32209526-32209548 TCTCAGAAGGGACACAGGGTGGG + Intergenic
1129120943 15:73396209-73396231 GGTCACCAGGGCCAGAGTCTGGG - Intergenic
1129150543 15:73684998-73685020 GCCCAGCAGGGCGAAGGTGTGGG + Intronic
1129455873 15:75675988-75676010 ACTGAGCAGGGCCACGCTGTAGG + Exonic
1130976309 15:88778177-88778199 GCTCAGCATAGGCACAGTATGGG - Intergenic
1131013424 15:89038325-89038347 GCTCTGCAGGGTGACAGTGGCGG + Intergenic
1132672271 16:1106723-1106745 GCACGGCGGGGCCACAGTGGGGG - Intergenic
1132674069 16:1114499-1114521 GCCCAGCAGGGCGGCAGGGTGGG - Intergenic
1132804144 16:1767984-1768006 GCTCTGCAGGGCCACCTTGGAGG + Intronic
1132928561 16:2446373-2446395 GCTCTGCAGGGCACCAGTGGGGG - Intronic
1133130376 16:3672982-3673004 CCCCTGCAGAGCCACAGTGTGGG - Intronic
1137494405 16:48958673-48958695 GACCAGGAGGGCCACTGTGTGGG - Intergenic
1138084735 16:54123117-54123139 GCACTGCAAGGCCACAATGTGGG + Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139551538 16:67675752-67675774 GGTCAGCAGGTCCACAATGTAGG + Exonic
1139829003 16:69781456-69781478 GCTAATCAGGACCACAGAGTTGG - Intronic
1139989406 16:70927545-70927567 GCCCAGCAGGGCTACCCTGTAGG - Intronic
1141143476 16:81513242-81513264 GCTCACCAGACCCAGAGTGTGGG + Intronic
1141930073 16:87196338-87196360 GCTCAGCAGGTGCAGGGTGTGGG + Intronic
1142265392 16:89062027-89062049 GAGCAGCAGGGCCCCTGTGTGGG - Intergenic
1142569389 17:863099-863121 GCCCAGCAGAGCCTGAGTGTAGG + Intronic
1142960204 17:3547790-3547812 GCTCAGCCAGGCCACAGGGCCGG - Intronic
1143152225 17:4814765-4814787 GATTAGCAGGGCTGCAGTGTGGG + Intronic
1143202286 17:5121403-5121425 GCTCTGCAGGGCCTCTGTGTTGG - Exonic
1143526700 17:7477410-7477432 GCTCAACAGGTGCACAGTGACGG - Intronic
1143526917 17:7478474-7478496 CCTCAGCAGGGCCACAGAAATGG + Intronic
1143729132 17:8870483-8870505 GGTCTGCAGGACCACAGTATTGG + Intergenic
1144422777 17:15113174-15113196 GTTCCGCGGGGCCACAGTGAGGG + Intergenic
1144627132 17:16849734-16849756 GCTCTGCAGGGCCTCTGTGTTGG + Intergenic
1144800531 17:17923095-17923117 GCTCATTAAAGCCACAGTGTTGG + Intronic
1144879307 17:18422978-18423000 GCTCTGCAGGGCCTCTGTGTTGG - Intergenic
1145152931 17:20521409-20521431 GCTCTGCAGGGCCTCTGTGTTGG + Intergenic
1146972606 17:37084917-37084939 TTTCAGCAGGGGCTCAGTGTGGG - Intergenic
1147581271 17:41628419-41628441 ACTCTGCAGGGCCTCTGTGTTGG + Intergenic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1151172582 17:72259747-72259769 GCTCAGCAGGGCCAACGGGAAGG - Intergenic
1151572341 17:74933089-74933111 TCTTAGCAGGGCCTCAATGTGGG - Intronic
1151702542 17:75751013-75751035 GCTCAGCTGGGTCACCGTGGAGG - Exonic
1152177374 17:78796708-78796730 GCCCAGCAGAGCCACACTGAAGG + Exonic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156904424 18:42336779-42336801 CCTCAGCAGGGTCTCCGTGTGGG + Intergenic
1157290304 18:46405337-46405359 GCTCTGCAGGTCCACAGGGCTGG + Intronic
1157555529 18:48610638-48610660 GCTCAGCAGGCCTGCAGTGCTGG - Intronic
1158558125 18:58491823-58491845 CCTCTGCAGGGCCACAGGGCAGG + Intronic
1159410879 18:68073229-68073251 GCCCAGTAGGGACACTGTGTGGG - Intergenic
1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG + Intronic
1161586333 19:5107783-5107805 GCTCAGCAGGGCCACAGTGTGGG - Intronic
1162460028 19:10809511-10809533 CCTCAGCTGGGGCCCAGTGTGGG + Intronic
1163639923 19:18456403-18456425 GCTCAGCAGGACCATCGTCTGGG + Intronic
1164419648 19:28077766-28077788 GAGCAGCAGGGCCACACTCTTGG - Intergenic
1164606776 19:29605270-29605292 TCTCAGCAGTGACCCAGTGTTGG - Exonic
1164739331 19:30564893-30564915 GCTCGGCGGGGCCACAGAGCTGG + Intronic
1167095012 19:47370586-47370608 GCACAGCAGGGCTTCAGTGTGGG + Intronic
1167170153 19:47825581-47825603 GCTCAGCAGGAGGAAAGTGTGGG - Intronic
1168351977 19:55681081-55681103 AGCCAGCAGGGCCACAGGGTGGG - Intronic
925865269 2:8221442-8221464 GTCCAGGAGGGGCACAGTGTGGG - Intergenic
930022724 2:47011335-47011357 CCGCAGCAGGGACACAGCGTAGG - Exonic
931904838 2:66831278-66831300 ACTCAGCAGAGCCCAAGTGTAGG + Intergenic
932443115 2:71750634-71750656 GCACAGCAGGGCCACTTAGTAGG - Intergenic
932582581 2:73001347-73001369 GCTCAGCAGGGCCAAAGTCCTGG + Intronic
933769445 2:85733851-85733873 GCTAAGCAGGGACAGAGGGTTGG + Intergenic
935457053 2:103282365-103282387 GCACCGCAGGGCCACTGTGCTGG - Intergenic
937268807 2:120633925-120633947 CCTCCACAGGGCCCCAGTGTTGG + Intergenic
938384418 2:130854245-130854267 GATCAGCAGTGGCACAGTCTGGG + Intronic
938647715 2:133348560-133348582 GCTAATGGGGGCCACAGTGTGGG - Intronic
938841789 2:135171736-135171758 GCTCAGGAAGCTCACAGTGTGGG + Intronic
939494832 2:142915556-142915578 GCTCATAAGGTCCACAGTGGTGG + Intronic
947588644 2:231371896-231371918 CCCCAACAGGGCGACAGTGTAGG + Intronic
948273674 2:236692401-236692423 GCTTGCCAGGGCCACAGTGAGGG + Intergenic
948763893 2:240209692-240209714 GCTCAGCAGGGGCACTCTGCAGG + Intergenic
1170432996 20:16294432-16294454 GCTGAGCAGGTCCCCACTGTGGG + Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1172122654 20:32607944-32607966 GCCCAGGAGGGGCACAGTGAGGG + Intronic
1172670550 20:36632106-36632128 ACTCAGCAGAGACACAGTGCTGG - Intronic
1172940415 20:38650071-38650093 GCTGATCATGGCTACAGTGTTGG - Exonic
1173820822 20:46019250-46019272 GCTAAGGAAGGCCCCAGTGTGGG + Intergenic
1174536553 20:51255829-51255851 GCTCTACAGAGCCACTGTGTGGG - Intergenic
1175255481 20:57643783-57643805 GCAGAGCAGGGCCACCCTGTAGG - Intergenic
1176246098 20:64097855-64097877 CGTCAGCAGGACCAGAGTGTCGG - Exonic
1179341684 21:40516746-40516768 ACTCTGCAGTGCCCCAGTGTGGG + Intronic
1179819992 21:43931004-43931026 GCTCATCAGGGACTCAGCGTGGG + Intronic
1180793826 22:18592218-18592240 GCTCTGCAGAGCCACTGGGTGGG - Intergenic
1181227914 22:21403102-21403124 GCTCTGCAGAGCCACTGGGTGGG + Intergenic
1181250739 22:21531737-21531759 GCTCTGCAGAGCCACTGGGTGGG - Intergenic
1181957282 22:26597133-26597155 GCTCAGCAAAACCACAGGGTGGG + Intergenic
1183084017 22:35475421-35475443 GCTCAGCAGAGCCACTTTGGGGG + Intergenic
1183724360 22:39580340-39580362 GCTCAGCCGGGCCAGAGCGGAGG + Intronic
1184673622 22:46028387-46028409 CCTGAGCAGGGCTACACTGTGGG - Intergenic
1184737618 22:46408764-46408786 GCTCTGCTGGGCCCCAGGGTTGG + Intronic
1185049025 22:48544054-48544076 GCTCAGCAGGACAGCAGGGTGGG + Intronic
1185058850 22:48595113-48595135 GCACAGCAGGGCCACACTCAGGG - Intronic
950750381 3:15123596-15123618 GCTCTGCAGGTCCCCAGCGTGGG - Intergenic
953234013 3:41090208-41090230 GCTTACCAGGGATACAGTGTGGG - Intergenic
953983585 3:47425447-47425469 GCTCCACTGGGCCACAGGGTGGG - Intronic
954706368 3:52482890-52482912 GCTCCCCAGGGGCACAGTCTGGG - Intronic
956551231 3:70461806-70461828 GCCCAGCAGGGACTCTGTGTGGG - Intergenic
956726965 3:72164076-72164098 GCTCAGCAGGGCCCCTGAGAAGG - Intergenic
961282025 3:125771481-125771503 GCTCTGCAGGTCCCCAGCGTGGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963346226 3:144099151-144099173 GCTCATCAGTGCCAAAGTTTTGG - Intergenic
963422278 3:145075209-145075231 GCTCAGCATATCCACAATGTAGG + Intergenic
964641016 3:158910697-158910719 GCACAGCAGTGCCACACTGCTGG - Intergenic
968474324 4:795834-795856 TCTCAGCAGGGCCAGAGGGCAGG - Intronic
968608721 4:1547293-1547315 GCAGTGCAGGGCCTCAGTGTGGG + Intergenic
968702750 4:2064579-2064601 GCTCAGCCGGGCCACACCCTCGG - Exonic
968827803 4:2912396-2912418 GCGCAGCAGGTCCCCAGTGGTGG - Intronic
969150662 4:5166222-5166244 TCTCAGGAAGGCCACACTGTGGG + Intronic
969279806 4:6162134-6162156 GGTCAGCAGGGCCTCAGGGAAGG + Intronic
969655284 4:8493795-8493817 GCTCATCAGGGCCACAGCTCTGG + Intergenic
969738256 4:9005436-9005458 GCTCTGCAGGTCCCCAGAGTGGG - Intergenic
969797438 4:9536982-9537004 GCTCTGCAGGTCCCCAGTGTGGG - Intergenic
972243943 4:37224945-37224967 TCTCAGCAGGGCCGGAGTGCTGG + Intergenic
972571660 4:40316875-40316897 TCTCAGCAGAGGCACAGAGTGGG - Intergenic
976352955 4:84081536-84081558 GATCACAAGGGCCACAGGGTTGG + Intergenic
976697925 4:87937931-87937953 TCTCAGCATGGGCACAGAGTGGG - Intergenic
977015954 4:91693542-91693564 GCCCAGTGGGGCCACTGTGTGGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980955652 4:139426953-139426975 GGTCAGCAGGTCCACGATGTAGG + Intergenic
982352482 4:154430832-154430854 GCTCTGCAGGGCCACAGGGTAGG - Intronic
983749998 4:171256300-171256322 TCCCAGCAGGGCCACACTATTGG + Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
986013955 5:3741034-3741056 GCATGGCAGGGCCACAGTGTAGG + Intergenic
986489991 5:8279638-8279660 GCTCAGCAGGGACTGAGGGTTGG - Intergenic
986956941 5:13163432-13163454 ACTCAGGAGGAACACAGTGTGGG - Intergenic
988761107 5:34310614-34310636 GCCCAGTAGGGACTCAGTGTGGG + Intergenic
989195750 5:38714480-38714502 GCTCATCATGGCCAAAGAGTGGG + Intergenic
990309588 5:54525062-54525084 GCTCTGGAGGGCCAGTGTGTGGG + Intronic
992028024 5:72690582-72690604 GGTTAGCAGAGCCACAGTCTTGG - Intergenic
993920063 5:93790681-93790703 GCTCAGCAGTGCCACGCTGGGGG + Intronic
997293078 5:132751782-132751804 GCTCAGCTTGGCCACAGGATGGG + Exonic
999024643 5:148213963-148213985 GGCCATCAGAGCCACAGTGTGGG - Exonic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999530917 5:152462663-152462685 TCTCCACAGGGCCACAGAGTGGG - Intergenic
999919798 5:156305586-156305608 CCTCAGTAGGGCCTCTGTGTGGG - Intronic
1001434528 5:171688905-171688927 GCTCAGAAGGGCCTCACTCTTGG - Intergenic
1001649968 5:173309396-173309418 GCTCAGCAGGGACACCGTCAGGG - Intergenic
1002362238 5:178681650-178681672 GCTCAGCAGGTGTACAGTTTCGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1012939445 6:105402212-105402234 GATCAGCACGGCCACACTATGGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017619543 6:156281540-156281562 GTTCAGCAGGGCTAGAGTGATGG - Intergenic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1018854105 6:167663134-167663156 GCTCTGCGGGGCCACCGTGGGGG + Intergenic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1019104731 6:169659110-169659132 GCTCAGCAGTGCCCCAGCATGGG - Exonic
1020638220 7:10722997-10723019 GCTGAGAAGTTCCACAGTGTGGG + Intergenic
1021606545 7:22414594-22414616 GCTGGGCAGGAACACAGTGTGGG - Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1021962833 7:25889633-25889655 GCTCTGTGGGGCCACACTGTGGG - Intergenic
1022042715 7:26595608-26595630 GCTCATCAGAGTCACAGTGAGGG - Intergenic
1022582929 7:31574790-31574812 GGGCAGGTGGGCCACAGTGTAGG + Intronic
1023831410 7:44040681-44040703 GCTCAGCAGGGCCCCCAGGTGGG + Intergenic
1027288252 7:76672758-76672780 GCTTAGAAAGGACACAGTGTTGG - Intergenic
1029074375 7:97924559-97924581 GCTCTGCAGGTCCCCAGCGTGGG + Intergenic
1029741735 7:102494983-102495005 GCTCAGCAGGGCCCCCAGGTGGG + Exonic
1029759726 7:102594152-102594174 GCTCAGCAGGGCCCCCAGGTGGG + Exonic
1029777089 7:102690062-102690084 GCTCAGCAGGGCCCCCAGGTGGG + Intergenic
1030088888 7:105840126-105840148 GCCCACAAGGGCCACAGTGAGGG + Intronic
1031869564 7:127077162-127077184 GCTGAGCAGGGCAACTGTGCTGG + Intronic
1034342674 7:150368533-150368555 GCTCCGCAGGGACAAAGGGTCGG + Intronic
1034402210 7:150870057-150870079 TCTCAGCAGGGGCTCAGTGAAGG - Intergenic
1034878797 7:154748433-154748455 GCTCACCAGGAGCACAGTGTGGG - Intronic
1035306805 7:157938408-157938430 GCTCAGCAGGGACACAGGAGAGG + Intronic
1035317036 7:158002787-158002809 GCTCAGCAGGTCCACGGAGCAGG + Intronic
1036243330 8:7096731-7096753 GCTCTGCAGGTCCCCAGCGTGGG - Intergenic
1036430530 8:8685621-8685643 CCTCAGCAGCGTCACAGTGATGG + Intergenic
1036744020 8:11391284-11391306 GCAAAGCACGGCCAAAGTGTGGG + Intronic
1036829398 8:12010461-12010483 GCTCTGCAGGTCCCCAGCGTGGG + Intergenic
1036898498 8:12654699-12654721 GCTCTGCAGGTCCCCAGCGTGGG + Intergenic
1039951384 8:42175523-42175545 GCCCAGCAGGGCCTCAAAGTTGG - Exonic
1040340335 8:46437326-46437348 GCAAAACAGGGCCTCAGTGTGGG - Intergenic
1042156661 8:65851452-65851474 GCAGAGCAGGGCCACCCTGTAGG - Intergenic
1047105576 8:121727269-121727291 GCCCAGCAAAGCCACAGTGGTGG - Intergenic
1048278791 8:133089357-133089379 GCTCAGCAGGCCCTCAGTAAAGG - Intronic
1048514406 8:135092948-135092970 ACTCAGCATGGCCCCAGAGTGGG - Intergenic
1049762045 8:144336185-144336207 GCTCCGCAGGCCCACAGCGCCGG - Exonic
1050564335 9:6866466-6866488 GCTCAGCAGTGCTACACTGTAGG - Intronic
1051668177 9:19484731-19484753 TCTCAGCAGGGCCACTCTGGAGG - Intergenic
1053018091 9:34675528-34675550 GCTCTGCAGTCCCAGAGTGTGGG + Intergenic
1054313226 9:63552495-63552517 TCTCAGGAGGGCCCCAGTATTGG + Intergenic
1055685552 9:78769907-78769929 CCTCAGCAATGCCACAGAGTTGG + Intergenic
1056499781 9:87197443-87197465 AATCAGCAGGGTCACACTGTGGG + Intergenic
1056568999 9:87799511-87799533 GCTCAGCAGCTCCACAGTGCAGG - Intergenic
1058628606 9:106961975-106961997 GCACAGCATGGAAACAGTGTGGG + Intronic
1058656064 9:107221547-107221569 GCTCAGCAGGGCTGCAGTGCCGG + Intergenic
1059502714 9:114768723-114768745 GCTCAGCAGTGGCACATAGTGGG - Intergenic
1059502905 9:114770719-114770741 GCTCAGCAGTGGCACATAGTGGG - Intergenic
1060345847 9:122814995-122815017 CCTCAACAGGGGCACATTGTGGG + Intronic
1060993936 9:127865204-127865226 GCTCTGCAGAGCCACAGAGGTGG - Intergenic
1061185121 9:129048523-129048545 GCTCACCGAGGCCACACTGTGGG - Exonic
1061250094 9:129421491-129421513 GCTGAGCACGCCCACCGTGTTGG - Intergenic
1188634664 X:32414130-32414152 AATCAAGAGGGCCACAGTGTAGG - Intronic
1190702567 X:52999595-52999617 GCTCAGAAGGGCCATAATGGGGG - Intergenic
1191673390 X:63769948-63769970 GCCCAGTAGGGACTCAGTGTGGG - Intronic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1192718678 X:73669437-73669459 GCTCAGCAGTTCCACCATGTGGG - Intronic
1196108028 X:111917049-111917071 GATTAGCTTGGCCACAGTGTGGG + Intronic
1199133283 X:144220052-144220074 GCCCAGCAATGCCACACTGTGGG - Intergenic
1199975540 X:152893123-152893145 GCTTAGCAGGGCCCCAGAGTCGG + Intergenic
1200151097 X:153951857-153951879 GGGCAGCAGCGCCACAGTGCTGG + Exonic