ID: 1161587422

View in Genome Browser
Species Human (GRCh38)
Location 19:5113213-5113235
Sequence CTCCCGCGCCGCCATCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 120}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161587402_1161587422 29 Left 1161587402 19:5113161-5113183 CCCCCTCACTTCTAGTCACGACC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587405_1161587422 26 Left 1161587405 19:5113164-5113186 CCTCACTTCTAGTCACGACCTGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587403_1161587422 28 Left 1161587403 19:5113162-5113184 CCCCTCACTTCTAGTCACGACCT 0: 1
1: 0
2: 1
3: 3
4: 73
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587404_1161587422 27 Left 1161587404 19:5113163-5113185 CCCTCACTTCTAGTCACGACCTG 0: 1
1: 0
2: 0
3: 12
4: 96
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587409_1161587422 -1 Left 1161587409 19:5113191-5113213 CCCAGGAGCCCCCTCCCGCCCTC 0: 1
1: 0
2: 3
3: 64
4: 654
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587408_1161587422 2 Left 1161587408 19:5113188-5113210 CCTCCCAGGAGCCCCCTCCCGCC 0: 1
1: 0
2: 5
3: 76
4: 695
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587412_1161587422 -10 Left 1161587412 19:5113200-5113222 CCCCTCCCGCCCTCTCCCGCGCC 0: 1
1: 0
2: 12
3: 132
4: 1688
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587407_1161587422 8 Left 1161587407 19:5113182-5113204 CCTGCTCCTCCCAGGAGCCCCCT 0: 1
1: 0
2: 10
3: 80
4: 747
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587410_1161587422 -2 Left 1161587410 19:5113192-5113214 CCAGGAGCCCCCTCCCGCCCTCT 0: 1
1: 0
2: 6
3: 68
4: 654
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587411_1161587422 -9 Left 1161587411 19:5113199-5113221 CCCCCTCCCGCCCTCTCCCGCGC 0: 1
1: 1
2: 11
3: 116
4: 1353
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161587422 Original CRISPR CTCCCGCGCCGCCATCCTGG GGG Intronic