ID: 1161587422

View in Genome Browser
Species Human (GRCh38)
Location 19:5113213-5113235
Sequence CTCCCGCGCCGCCATCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 120}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161587402_1161587422 29 Left 1161587402 19:5113161-5113183 CCCCCTCACTTCTAGTCACGACC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587407_1161587422 8 Left 1161587407 19:5113182-5113204 CCTGCTCCTCCCAGGAGCCCCCT 0: 1
1: 0
2: 10
3: 80
4: 747
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587404_1161587422 27 Left 1161587404 19:5113163-5113185 CCCTCACTTCTAGTCACGACCTG 0: 1
1: 0
2: 0
3: 12
4: 96
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587412_1161587422 -10 Left 1161587412 19:5113200-5113222 CCCCTCCCGCCCTCTCCCGCGCC 0: 1
1: 0
2: 12
3: 132
4: 1688
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587405_1161587422 26 Left 1161587405 19:5113164-5113186 CCTCACTTCTAGTCACGACCTGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587409_1161587422 -1 Left 1161587409 19:5113191-5113213 CCCAGGAGCCCCCTCCCGCCCTC 0: 1
1: 0
2: 3
3: 64
4: 654
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587408_1161587422 2 Left 1161587408 19:5113188-5113210 CCTCCCAGGAGCCCCCTCCCGCC 0: 1
1: 0
2: 5
3: 76
4: 695
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587410_1161587422 -2 Left 1161587410 19:5113192-5113214 CCAGGAGCCCCCTCCCGCCCTCT 0: 1
1: 0
2: 6
3: 68
4: 654
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587403_1161587422 28 Left 1161587403 19:5113162-5113184 CCCCTCACTTCTAGTCACGACCT 0: 1
1: 0
2: 1
3: 3
4: 73
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1161587411_1161587422 -9 Left 1161587411 19:5113199-5113221 CCCCCTCCCGCCCTCTCCCGCGC 0: 1
1: 1
2: 11
3: 116
4: 1353
Right 1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161587422 Original CRISPR CTCCCGCGCCGCCATCCTGG GGG Intronic
900242448 1:1623524-1623546 CGCCCTCGCCGCCGTCCTGCTGG - Exonic
904086665 1:27914277-27914299 CTTCCTCGCCGCCTTCCTGCGGG + Intronic
916961476 1:169893787-169893809 CTCCCCCGCCGCCTTCCTGCAGG - Exonic
918239894 1:182611872-182611894 CTCCCCCGCCGCCACTCTGCCGG - Intergenic
919925501 1:202189849-202189871 CTCTGGCACCTCCATCCTGGTGG - Intergenic
921177756 1:212608705-212608727 CGACCGCGCCGCCAGCCTGAGGG + Exonic
922770034 1:228176692-228176714 AGCCTGTGCCGCCATCCTGGGGG + Exonic
924437388 1:244054383-244054405 CTGCCTCTCCGCCAGCCTGGGGG - Exonic
1065487614 10:26249912-26249934 CTCCTTCTCCGCCCTCCTGGTGG - Intronic
1073325567 10:102642662-102642684 CTCCGCCGCCGCCTTCCTCGCGG + Intergenic
1079217527 11:18526967-18526989 CTTCCGGGCCGCCGTCCTGCGGG + Exonic
1080795337 11:35557907-35557929 CTCCCTCTTCCCCATCCTGGGGG + Intergenic
1081712433 11:45226011-45226033 CTCCGGCCCCGCCATCATGGAGG + Intronic
1083621050 11:64049601-64049623 CTCCCGCACAGACATCCTGATGG + Intronic
1084146229 11:67266692-67266714 CTCCAGGTCCGCCATCTTGGCGG - Exonic
1084979580 11:72822037-72822059 CTCCAGGGCTGCCAGCCTGGAGG - Exonic
1089500427 11:118928774-118928796 CGCCCGCACCCCCATCTTGGTGG + Intronic
1091347485 11:134864866-134864888 CTCCCGCTCAGCCAGCCTGGGGG - Intergenic
1103726612 12:123000346-123000368 CTCCCGCGGGGCCATCTTGTCGG + Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113698749 13:112366951-112366973 CTCCCTTGTCACCATCCTGGTGG - Intergenic
1120788001 14:88554660-88554682 CTCCCGCTCCCGCATCCTCGGGG + Exonic
1121650483 14:95554390-95554412 CTCCCAGGCAGCCATCCTAGTGG - Intergenic
1122226986 14:100285836-100285858 CTCCCACCCCGCCCTCCAGGGGG - Intergenic
1122230829 14:100305765-100305787 GTCCCGCGCAGCCATCCAGCGGG - Intronic
1122904418 14:104795361-104795383 CTCCCGCTCCTCCATTCTGGCGG + Intronic
1123478794 15:20612396-20612418 CTCCCTCGCCCACATCCAGGGGG - Intergenic
1124095254 15:26643239-26643261 GCCCCGTGCCCCCATCCTGGCGG + Intronic
1131397655 15:92099223-92099245 CTCCTGCTCTGCCATCCTGAGGG + Intronic
1133170096 16:3977525-3977547 CTCCCTCGCCACCGTCGTGGGGG - Exonic
1133802147 16:9092421-9092443 CTCCCGCGGCGCCATCTTGCGGG - Intronic
1134785666 16:16940529-16940551 CTCCCTGGCCGCCATCTTGTAGG - Intergenic
1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG + Exonic
1144058226 17:11559778-11559800 CTTCCCCGCCTCCAGCCTGGGGG + Exonic
1144756517 17:17682982-17683004 CTCCCGCGCCGCCTTCCCCGCGG + Intronic
1145811285 17:27765697-27765719 CAGCCGTGCCACCATCCTGGTGG - Exonic
1145935196 17:28711183-28711205 CTCCCGCCCCGGCGTCCGGGTGG + Intronic
1146176230 17:30667942-30667964 CTCCCGCGCCCCCAACCCGAGGG - Intergenic
1146349686 17:32084053-32084075 CTCCCGCGCCCCCAACCCGAGGG - Intergenic
1149774732 17:59348393-59348415 CTCCCGCCCCTCCATCCTGGTGG + Intronic
1151210005 17:72537410-72537432 CCCCAGCCCCGCCTTCCTGGGGG + Intergenic
1151771883 17:76168637-76168659 CTCCCCCTCCAACATCCTGGTGG + Intronic
1152269487 17:79315738-79315760 CGCCCGTGCCGCCACCCTGGGGG + Intronic
1152349216 17:79774480-79774502 CTTCCCCGCCCCGATCCTGGAGG - Intergenic
1152924295 17:83080273-83080295 GTCCCGCGACCCCATCCCGGGGG + Intronic
1153568444 18:6444330-6444352 CTACTACGCAGCCATCCTGGTGG - Intergenic
1157764844 18:50288085-50288107 CACGGGCGCCGCCATCTTGGTGG + Intronic
1160548729 18:79679795-79679817 AGCCCGCGCCGACTTCCTGGAGG - Exonic
1160685546 19:434850-434872 CTCCGGCCCTGCCAGCCTGGGGG + Exonic
1161027312 19:2042573-2042595 CTCCCGCGGGGCCACCCTGCCGG + Intronic
1161430419 19:4229290-4229312 CTCCCCCGCCCCCACCCTCGGGG + Intergenic
1161510018 19:4665067-4665089 CCCCTGCCCCGCCCTCCTGGTGG + Intronic
1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG + Intronic
1161752966 19:6110664-6110686 CTCGCGCCCCGCCCTCTTGGGGG - Intronic
1161973335 19:7595990-7596012 CCCCGGCGCCGCCATGGTGGAGG + Exonic
1162982591 19:14248964-14248986 CTCCCGCGCCCCCAACCCGAGGG + Intergenic
1163248405 19:16111491-16111513 CTCGCGCGCCGGCAGCCTGGCGG - Intergenic
1163725278 19:18919834-18919856 CTGCATCCCCGCCATCCTGGAGG + Exonic
1165750535 19:38256600-38256622 CTCCCGGGCCGGGATCCTGTGGG + Intronic
1166869861 19:45864532-45864554 TTCCCGCTCCGCCATCCCCGAGG - Intronic
1166887589 19:45971563-45971585 CTCCCCCACCTCCATCCAGGTGG - Intronic
1167217082 19:48171795-48171817 CTCCGGCCGCTCCATCCTGGGGG - Exonic
925058395 2:872527-872549 CTCCCCGGACCCCATCCTGGGGG + Intergenic
927698493 2:25252651-25252673 CTCCCGAGCCGCCTGCCCGGAGG + Intronic
929433836 2:41911510-41911532 CTGCCGCGTGGCCATCCTGGAGG + Intergenic
941951341 2:171160300-171160322 ATCACACGCCGCCATCCGGGAGG - Exonic
944579042 2:201116501-201116523 CTCCGGCGCCGCCAGCGCGGGGG - Intronic
946416980 2:219544624-219544646 CTCTCCCACCCCCATCCTGGTGG + Intronic
946725346 2:222656388-222656410 CTCTCGCCCCGCCCACCTGGTGG - Intergenic
1176169092 20:63689096-63689118 CACCGGCGCCACCTTCCTGGCGG + Exonic
1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG + Intronic
1176242984 20:64083645-64083667 CGCGCGCGCCGCCATCCGGCTGG - Exonic
1176553617 21:8243020-8243042 CTGCAGCACCGCCATCCTCGAGG + Intergenic
1176572539 21:8426044-8426066 CTGCAGCACCGCCATCCTCGAGG + Intergenic
1176580448 21:8470605-8470627 CTGCAGCACCGCCATCCTCGAGG + Intergenic
1179068590 21:38050753-38050775 CTCCAGCTTCACCATCCTGGGGG - Intronic
1179511268 21:41875292-41875314 CTCCCAAGCCGGCATCCTGGCGG + Intronic
1180866323 22:19122033-19122055 CACCCGCGGCGCCCTCCTGCAGG - Intronic
1181312542 22:21952921-21952943 GTCCGGCCCCGCCAGCCTGGAGG - Intergenic
1182122618 22:27797511-27797533 CGCTCACGTCGCCATCCTGGGGG - Exonic
1183692681 22:39399795-39399817 CCTCTGCGCCGCCATCTTGGAGG - Exonic
1184073189 22:42159543-42159565 CACCCACACCTCCATCCTGGCGG + Intergenic
1184280294 22:43433613-43433635 CTCCCGCCGCGGCATCGTGGTGG + Intronic
1185092635 22:48784631-48784653 CTCCGGTGCCGCCTTCATGGGGG - Intronic
1203258615 22_KI270733v1_random:160048-160070 CTGCAGCACCGCCATCCTCGAGG + Intergenic
950024311 3:9810084-9810106 ACACCGCGCCGCCCTCCTGGCGG - Exonic
950043318 3:9933792-9933814 CACCCGCGCCGCAGTCCAGGGGG - Intergenic
950522659 3:13505854-13505876 CTCCCCCGCCCACTTCCTGGAGG - Exonic
955231431 3:57102369-57102391 CTTCCCAGGCGCCATCCTGGAGG + Intronic
962714603 3:138115541-138115563 CTCCAGTGCCGCCAACCTGCGGG + Exonic
966362970 3:179149062-179149084 CTCCGGCCCCGCCAGCCTGGCGG + Intronic
966406529 3:179604404-179604426 CTCCGGCTCTGCCATCCAGGCGG + Intronic
966594207 3:181711787-181711809 CTCCCGCGCCGCCGGCCGCGCGG - Intergenic
968258228 3:197298111-197298133 CTCGGGGGCCGCCATCTTGGCGG - Intronic
968560642 4:1279504-1279526 CTCCTGAGCCGCGACCCTGGCGG - Intergenic
968582784 4:1402680-1402702 CTCCCGCGCCGCCCTCCGCCCGG - Intergenic
968703764 4:2068967-2068989 CTCGCTCGCCCCCACCCTGGGGG - Exonic
969214503 4:5711305-5711327 GTCCCGCGTCGCCGCCCTGGCGG + Exonic
969330597 4:6471899-6471921 CCTCCGCGCCGCCCTCCGGGAGG - Intronic
982109558 4:152041392-152041414 CTCCAGCGTCTCCCTCCTGGTGG + Intergenic
982288762 4:153759836-153759858 CTTCCGCGCCGCCGTCCCCGCGG + Exonic
983941479 4:173538216-173538238 CTCCCGCGCCGCCGGCCGCGAGG - Intergenic
988796567 5:34657218-34657240 CTCCCGCGACCCCTGCCTGGTGG + Intronic
993647019 5:90474534-90474556 CTCCTGCGCCCCCGTGCTGGTGG - Exonic
998162530 5:139821714-139821736 CTCCAGAGTGGCCATCCTGGGGG + Intronic
998444338 5:142187022-142187044 CACCCGCACCGCCCTCCCGGTGG + Intergenic
999731864 5:154481250-154481272 CTCCCCCGACGTCATCCTGCTGG - Intergenic
1006860810 6:37170548-37170570 TCCCTGCGCCGACATCCTGGAGG + Exonic
1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG + Intronic
1007612528 6:43159833-43159855 GTCCCCCGAGGCCATCCTGGAGG + Exonic
1008786487 6:55174820-55174842 CTCCCGGGCAGCCCTCCTAGGGG + Intronic
1019302213 7:311594-311616 CACCCCCGCCCCCCTCCTGGAGG + Intergenic
1019703821 7:2488084-2488106 CTCCCCCGCCCCCAGCCAGGAGG + Intergenic
1020071213 7:5228170-5228192 CACACTCGCCGCCCTCCTGGGGG - Exonic
1024262417 7:47582206-47582228 CGCCCGCGCCCCGAGCCTGGCGG + Intronic
1024604616 7:51013496-51013518 TCCCCGTGCCGCCATCCCGGAGG + Intergenic
1035209038 7:157314220-157314242 CTCCTGCCCTGCCTTCCTGGGGG + Intergenic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1049322138 8:142002175-142002197 CTCCCGTGCTCCCATCCTGAAGG - Intergenic
1049576217 8:143391151-143391173 CTCCCCCCCCGCCCACCTGGAGG + Intergenic
1049585189 8:143429770-143429792 GTCCCGCGCCGCCATGGTGGTGG + Exonic
1049658100 8:143807743-143807765 CACGGGCGCCTCCATCCTGGAGG + Intronic
1049801085 8:144517832-144517854 CTCCCGCGCAGCCGTCGCGGGGG + Intronic
1055054417 9:72010775-72010797 CTGCCATGCCGCCATCCTGCGGG - Intergenic
1057076125 9:92139029-92139051 CTCTGGCACCTCCATCCTGGTGG - Intergenic
1059412158 9:114139367-114139389 CTTCCCAGCCCCCATCCTGGGGG + Intergenic
1060194712 9:121616183-121616205 CTCCCTCGCCTGCATCCTGCAGG - Intronic
1061840606 9:133356664-133356686 CTCCCGCGCTGCGAACCTTGCGG - Exonic
1061970394 9:134041766-134041788 CTGCAGCTCCGCCAGCCTGGTGG + Exonic
1062170736 9:135133373-135133395 CACCCGAGCCACCCTCCTGGTGG - Intergenic
1062565591 9:137162661-137162683 CTCCTACACCGCCAACCTGGCGG + Exonic
1062588694 9:137263397-137263419 CTCCCCCTCCGCCCTCCTGAAGG + Intronic
1203474810 Un_GL000220v1:142064-142086 CTGCAGCACCGCCATCCTCGAGG + Intergenic
1190745773 X:53321109-53321131 CGACCCCGCCTCCATCCTGGCGG + Exonic
1192033798 X:67543673-67543695 CTCCCTCGCCTCCACCCTGTTGG + Intergenic
1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG + Exonic