ID: 1161587515

View in Genome Browser
Species Human (GRCh38)
Location 19:5113646-5113668
Sequence GGAGCATCCTGGGCCCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 2, 2: 3, 3: 71, 4: 415}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161587502_1161587515 24 Left 1161587502 19:5113599-5113621 CCAGACAAGGGGCTTGTGGACAC 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1161587515 19:5113646-5113668 GGAGCATCCTGGGCCCTGCAGGG 0: 1
1: 2
2: 3
3: 71
4: 415
1161587501_1161587515 25 Left 1161587501 19:5113598-5113620 CCCAGACAAGGGGCTTGTGGACA No data
Right 1161587515 19:5113646-5113668 GGAGCATCCTGGGCCCTGCAGGG 0: 1
1: 2
2: 3
3: 71
4: 415
1161587511_1161587515 -8 Left 1161587511 19:5113631-5113653 CCTTCTCTGGTTGGGGGAGCATC 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1161587515 19:5113646-5113668 GGAGCATCCTGGGCCCTGCAGGG 0: 1
1: 2
2: 3
3: 71
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161587515 Original CRISPR GGAGCATCCTGGGCCCTGCA GGG Intronic
900177934 1:1298934-1298956 GCAGCCTGCTGGTCCCTGCAGGG - Intronic
900396528 1:2455346-2455368 GGAGGACCCTCGGCCCTGCCAGG + Intronic
900416388 1:2536935-2536957 GGAGCCTCCTGGGCTGGGCACGG - Intergenic
900497809 1:2984198-2984220 GGAGCATCCAGGACCCACCACGG - Intergenic
900569326 1:3350648-3350670 GGTGCTCCCAGGGCCCTGCATGG - Intronic
900596224 1:3481362-3481384 TGGCCAGCCTGGGCCCTGCAAGG - Intergenic
900700911 1:4048165-4048187 GGCCCTTCCTGAGCCCTGCAAGG + Intergenic
900816091 1:4847290-4847312 TCATCATCCTGGCCCCTGCAGGG - Intergenic
901000709 1:6147550-6147572 GGAGCAGCCTTGGCCCTCCAAGG + Intronic
901333029 1:8424890-8424912 GGAACATTCTGGGAACTGCAAGG + Intronic
901464696 1:9413653-9413675 GGGGCCTGCTGGGCCCTGCCCGG - Intergenic
901664199 1:10817211-10817233 GGAGGCTCCTGGGGCCTGCAGGG + Intergenic
902584135 1:17427731-17427753 GTGGCATCCTGGGCACTGCAGGG - Intronic
902914626 1:19629301-19629323 CTAGCATCCTGTGCCCTGCTGGG - Exonic
903295940 1:22343077-22343099 GGAGCATGCGGGTGCCTGCAAGG - Intergenic
903455618 1:23484569-23484591 GGAACAGCCTGGGCCGTGCAAGG - Intergenic
904118023 1:28176564-28176586 GGGGAATCCTGGCCCCTGCTGGG - Intronic
904211161 1:28887583-28887605 GGAGCATGCGGGGCCGGGCAAGG - Intronic
904303408 1:29570969-29570991 TGTGCCACCTGGGCCCTGCAGGG + Intergenic
904338312 1:29812200-29812222 GGGGCAGCATGGCCCCTGCATGG + Intergenic
905447220 1:38035075-38035097 GGAGCATCCTACGCCCCACACGG - Intergenic
905765236 1:40595227-40595249 GGGGCCTCCTGGGCCCTGCCAGG + Intergenic
906033866 1:42739080-42739102 GGTCCATCCTGGGCCCTGGGGGG + Intronic
906541453 1:46589636-46589658 GAATCATCCTGGTTCCTGCAGGG + Intronic
907301058 1:53486531-53486553 TGAGCACCCTGGGCACAGCAAGG - Intergenic
910291258 1:85602560-85602582 GGAGCAGCCTCCGACCTGCATGG - Intergenic
914343568 1:146779680-146779702 GCACCATCCTGGGCCCTGCAGGG - Intergenic
914940094 1:152014839-152014861 GGAGGATCCTGGGGCATGGATGG + Intergenic
915117880 1:153611834-153611856 GGAGCATAGTGGGGCCTGCTTGG + Intronic
915118136 1:153612928-153612950 TGAGCACCCTGGGCCCGGCCTGG - Intronic
915937362 1:160097377-160097399 GCAGGTCCCTGGGCCCTGCAGGG - Intronic
917929202 1:179812353-179812375 GTGGCATTCTGGGCCCTGGAAGG - Intronic
918817040 1:189200085-189200107 GGATCATCCTGAGGACTGCAAGG + Intergenic
921193168 1:212727291-212727313 AGGGGATCCTGGGCCCTGCCTGG - Intronic
922787547 1:228290466-228290488 GGAGCATCCTTGGGGCTTCAGGG - Intronic
922882304 1:228990107-228990129 AGAGCATCTGGGGCCCTGCAAGG + Intergenic
922978769 1:229806936-229806958 GGGGCATCCTTGGCCAAGCAGGG + Intergenic
923055731 1:230425312-230425334 GGAGCACCCCAGCCCCTGCATGG - Intronic
923082539 1:230672362-230672384 GGAGCATCCAGGGCTATGGAGGG - Intronic
1063369950 10:5514659-5514681 GGAGCCTGCAGGGCCCTGCGCGG - Intergenic
1063947199 10:11189610-11189632 GGAGTATACTGGGTCCTGCCTGG + Intronic
1065045472 10:21744471-21744493 GCAGCTGCCAGGGCCCTGCAGGG - Intergenic
1065557528 10:26931511-26931533 GGAGCACTCTGGGCCCCGCACGG - Intergenic
1067031058 10:42879102-42879124 GGAGCCTGCTGGGCCCTCCCAGG - Intergenic
1067533757 10:47093092-47093114 AGAGCATCCAGGGACCTGCTGGG - Intergenic
1068620392 10:59176150-59176172 CGAGTATCCTGGGACCTTCAGGG + Intergenic
1070672137 10:78385361-78385383 GGAGCAGCCTGGCCACTGCAGGG + Intergenic
1070778830 10:79125989-79126011 AGAGCTTCCTTGGCCCTTCAGGG - Intronic
1070821816 10:79360474-79360496 AAAGGATCCTGGGCCCTGGATGG - Intergenic
1072634719 10:97170545-97170567 TCAGCTTCCTGGGTCCTGCAGGG - Intronic
1073087542 10:100903163-100903185 GGAGCAACCAGGCCCCTTCAGGG + Intergenic
1074106652 10:110394048-110394070 AGAGCACCCTCGCCCCTGCAGGG - Intergenic
1074183624 10:111083348-111083370 GGACCATCCTAGGCATTGCAAGG + Intergenic
1074357328 10:112798078-112798100 GGAGCACAGTGAGCCCTGCAGGG + Intronic
1075011214 10:118871706-118871728 GGGGCATGCTGTGCCATGCAGGG - Intergenic
1076229973 10:128812030-128812052 GGAGGATGAAGGGCCCTGCAAGG + Intergenic
1076349879 10:129808439-129808461 GCAGCACCCGGGGCTCTGCAGGG + Intergenic
1076365952 10:129921274-129921296 GGGCCATCCTGGGCACCGCAGGG + Intronic
1076504554 10:130963205-130963227 GGACCCTGCTGGGCCCTGCTGGG - Intergenic
1077130445 11:969514-969536 GGGCCATTCTGGGCCCGGCACGG - Intronic
1077136718 11:1003235-1003257 GGGGCGCCCAGGGCCCTGCAGGG + Intronic
1077341257 11:2027387-2027409 TCAGCAGCCTGGGCCCTCCACGG - Intergenic
1077501933 11:2913235-2913257 GGAGTGTCCTGGGCACTGCGAGG - Intronic
1078363888 11:10691326-10691348 GGAGCAGACTGAGCCCTGCAAGG - Intronic
1078716118 11:13840393-13840415 GGACCATGTTGGGCCCTTCAGGG - Intergenic
1079073515 11:17368400-17368422 GGATCATCCTGGGCCCCATATGG - Intronic
1079650306 11:22920192-22920214 TGGGCCTCCTGGGTCCTGCAGGG - Intergenic
1081525176 11:43923182-43923204 GGAGCATTCAGCGCACTGCAGGG - Intergenic
1081910744 11:46698309-46698331 GGAGCAGCCGGGGCCGGGCACGG + Intronic
1083445654 11:62706518-62706540 GGCACATCTTGGGGCCTGCAGGG - Intronic
1083545727 11:63547601-63547623 GGAGCATCCAGGCCCTTCCAAGG + Intergenic
1084311488 11:68318805-68318827 CAAGAATCCAGGGCCCTGCAGGG + Intronic
1084494582 11:69496647-69496669 GGACTGTCCTGGGCCCTGTAGGG - Intergenic
1084629195 11:70334826-70334848 GGAGCCCCCTGAGCACTGCAAGG + Intronic
1084792066 11:71481267-71481289 GCAGCCTCCTGGGGCCTGCTTGG + Intronic
1087268334 11:96084806-96084828 GGAGCTTACTGGGTCCTGCTTGG - Intronic
1091353339 11:134915003-134915025 GGACCATACTGGGCACAGCAAGG + Intergenic
1202824242 11_KI270721v1_random:82576-82598 TCAGCAGCCTGGGCCCTCCACGG - Intergenic
1091398568 12:169387-169409 CTGGCATCCTGGCCCCTGCAGGG + Intronic
1091832548 12:3560122-3560144 GCAGCAGCCAGGGCCCTGCGTGG - Intronic
1091998394 12:5013714-5013736 GGTGCAGCCTGTCCCCTGCATGG + Intergenic
1092138625 12:6167316-6167338 AAAGAATCCTGGGCCCTGGAGGG - Intergenic
1092879113 12:12874273-12874295 GGAGCCTCTTCAGCCCTGCAGGG + Intergenic
1094682673 12:32679664-32679686 GGAGAATCCGGGGCCCGGCCAGG + Intronic
1098956270 12:76693092-76693114 CGGGCTTCCTGGGTCCTGCAGGG - Intergenic
1100608606 12:96171860-96171882 GGAGCATCATGTGCACGGCATGG - Intergenic
1101158215 12:101947439-101947461 TGGGGATCCTGGACCCTGCATGG - Intronic
1101499491 12:105289137-105289159 TGTGCCTCCTGGTCCCTGCAAGG + Intronic
1103445060 12:120989061-120989083 GGAGAGTCCTGGGCCCTCCCAGG - Intronic
1103947036 12:124532465-124532487 GGAGCCACTTGGGTCCTGCAAGG + Intronic
1104397499 12:128447040-128447062 GAAGCATACTGGGCAGTGCATGG + Intronic
1104763404 12:131311658-131311680 CCAGTGTCCTGGGCCCTGCAGGG - Intergenic
1104981055 12:132573309-132573331 GGTGCGTGCTGGGCCCTTCAGGG - Intronic
1105001983 12:132695956-132695978 GAAGCCTCCTGAGCCCTGCCAGG - Exonic
1105019512 12:132806559-132806581 GGAGCCTCCTGTGGCCTGCGAGG - Intronic
1110093890 13:71490646-71490668 GCAGCATCCCTGCCCCTGCATGG - Intronic
1111482260 13:88845901-88845923 AGAGCATCCTGGGCCAGGCGCGG + Intergenic
1112992589 13:105532189-105532211 TGAGGATGCTGGGCACTGCATGG - Intergenic
1113800466 13:113083671-113083693 GGCGCCTCCAGGGCCCTGAAAGG + Intronic
1113877321 13:113602415-113602437 GGACCCTCCTGGCCCCAGCACGG - Intronic
1113926816 13:113946383-113946405 GGGGCATCCTGGGAACTGAAGGG + Intergenic
1114175725 14:20317924-20317946 GAAGCATCCTGGGACCTGCCAGG + Exonic
1115443773 14:33466089-33466111 GGAGCATGCTGGGGAGTGCAAGG + Intronic
1116472932 14:45306327-45306349 GAAGCCTTCTGGGCTCTGCATGG + Intergenic
1119177590 14:72580585-72580607 GGAGCAGCCTTGGCTCTGAAAGG - Intergenic
1119666978 14:76491744-76491766 GGAGCTTCTAGGGCTCTGCATGG + Intronic
1121255121 14:92525384-92525406 GGAGCATTCTGTGCCCTTTATGG - Intronic
1121755910 14:96401780-96401802 TGAGCATTCTGGGCTCTGCCAGG + Intronic
1122084562 14:99290640-99290662 GTAGCAGCTTGGGGCCTGCAGGG - Intergenic
1122354087 14:101112984-101113006 GGAGCATGCAGGGGCCTGCTGGG + Intergenic
1122465390 14:101930100-101930122 GGAGAACCCCGGGCCCTGCAAGG + Intergenic
1122557783 14:102591062-102591084 GCAGCATCCAGGGCACTCCAAGG + Intergenic
1122856559 14:104563026-104563048 GGAGCAGCCTGGGCTCATCAGGG - Intronic
1123020492 14:105395715-105395737 AGAGCCTCCCAGGCCCTGCACGG - Exonic
1123450464 15:20356695-20356717 CGAGTTTCCTGGGCCCCGCAGGG + Intergenic
1127602393 15:60551365-60551387 GGCTCATCCTGGTCCCTGCTCGG + Intronic
1127981114 15:64035863-64035885 GGAGCATCCTGCACTCTGCTGGG - Intronic
1128458118 15:67844327-67844349 GGGGCAGCCTGGGCTATGCAGGG - Intergenic
1129350261 15:74951945-74951967 GGAGCTTCCTGGACCCAGCCTGG - Intergenic
1129823046 15:78617594-78617616 GACACTTCCTGGGCCCTGCAGGG - Intronic
1131117877 15:89805609-89805631 GGAGCCTCCGGAGCCCTGCCAGG + Intronic
1131178744 15:90225885-90225907 GCACCATCCTGGGCCCTCCTTGG + Intronic
1131277869 15:90997252-90997274 TGATCATTCTGGGCCCCGCACGG - Intergenic
1132085089 15:98901870-98901892 GGGGCATCCTGGGGCCTGTTGGG + Intronic
1132515070 16:362430-362452 TGGACATCCTGGGCACTGCAGGG + Intergenic
1132566345 16:625320-625342 TAAGCATCCTTGGCCCTGCCCGG + Intronic
1132576029 16:664596-664618 GGAGGGCCCTGGGCCCTACAAGG - Intronic
1132648044 16:1008034-1008056 GGGGCTTCCTGGGTCCTCCAAGG - Intergenic
1132679609 16:1134349-1134371 GGGGCATCCTAGGCCCAGGACGG + Intergenic
1132703012 16:1229966-1229988 GGAGCATCGTGGGCCTGGCCGGG + Intronic
1132705311 16:1240902-1240924 GGAGCATCGTGGGCCTGGCCGGG - Intronic
1132708439 16:1256265-1256287 GGAGCATCGTGGGCCTGGCCGGG - Exonic
1132825635 16:1903964-1903986 GGACCACCGTGGGCCCTGCCTGG + Intergenic
1133017640 16:2951629-2951651 GCTGCCTCCTGGGCCCTGCCCGG + Intergenic
1133240157 16:4409348-4409370 TGTGCTTGCTGGGCCCTGCAGGG + Intronic
1133254084 16:4505734-4505756 GGTGCCTGCTTGGCCCTGCAGGG + Intronic
1133569676 16:7028385-7028407 TGATCATCTTGGGCTCTGCATGG + Intronic
1134192126 16:12129812-12129834 TGAGCATACTGGGCCGGGCACGG + Intronic
1135406067 16:22198786-22198808 GGATGATACTGGGCCCTGCTAGG + Intergenic
1136153619 16:28367985-28368007 GGGCCAGCCTGGGCCCCGCAGGG - Intergenic
1136209468 16:28747282-28747304 GGGCCAGCCTGGGCCCCGCAGGG + Intergenic
1136654822 16:31703481-31703503 GGAGGGCCCTGGGCCCTGCCCGG + Intergenic
1137300322 16:47143286-47143308 GGAGGCCCCTGGGCCCAGCAGGG - Intronic
1137499465 16:48999155-48999177 GGAGCCACCTGGGCCTTGCATGG + Intergenic
1138181595 16:54944207-54944229 GGAGCATCTGGGGCCCCACAGGG + Intergenic
1139671172 16:68493182-68493204 GGTGCTACCTGGGCCCTGTATGG + Intergenic
1139990423 16:70935654-70935676 GCACCATCCTGGGCCCTGCAGGG + Intronic
1140456947 16:75111243-75111265 GCAGGTTCCTGGGACCTGCAGGG + Intergenic
1140888304 16:79263551-79263573 AGAGAATCCTGGGCCCCACAAGG - Intergenic
1141938937 16:87261486-87261508 GGAGAATCCTGGGAGCAGCATGG - Intronic
1142427996 16:90010991-90011013 GCTGCTTCCTGGACCCTGCATGG + Intronic
1203141250 16_KI270728v1_random:1768277-1768299 GGGCCATCCTGGGCACTGTACGG + Intergenic
1142866102 17:2792513-2792535 GGCCCATCATGAGCCCTGCAGGG - Intronic
1143175098 17:4950759-4950781 GGGGTAACCTGAGCCCTGCAAGG - Intronic
1145994772 17:29099019-29099041 GGAGGATCCTGGGCCGAGCTTGG - Intronic
1146064561 17:29623962-29623984 GGAGCCTCGTGGGCCCTTCATGG - Intergenic
1146833256 17:36088806-36088828 GGGGAATCCTGGGCCCACCATGG + Intronic
1146847776 17:36195420-36195442 GGGGAATCCTGGGCCCACCATGG + Intronic
1147636783 17:41968772-41968794 GCAGCACCCTGTGCCCAGCAAGG - Intronic
1148131023 17:45262648-45262670 GCTGCCTCCTGAGCCCTGCATGG - Intergenic
1150313982 17:64153289-64153311 GGGGCATCCTGTGCATTGCAGGG + Intronic
1150409285 17:64929962-64929984 GCAGTATTCTGGGCCCTACATGG - Intergenic
1150675692 17:67244879-67244901 GCAGCGTCCTGGGCCCTGGCAGG - Intronic
1151661572 17:75521830-75521852 GGGGCCCCCTGGGCCCTTCATGG - Exonic
1151896345 17:76983248-76983270 GGGGCATCCTCAGCCCTGCTGGG + Intergenic
1151996313 17:77611509-77611531 GAAGCCTCCTGGGTCCTGCTGGG + Intergenic
1152183596 17:78840559-78840581 GGAGCATCCCGGGTCCTCCTCGG + Exonic
1152245277 17:79182197-79182219 GGCTCATCCTGGGGCCTGCAGGG - Intronic
1152337978 17:79708642-79708664 CGAGTCTCCTGGGCCCCGCAGGG - Intergenic
1152431403 17:80250071-80250093 GGAGCCTTCTGAGCACTGCAGGG + Intronic
1152720331 17:81920571-81920593 GGAGCCTCCTGAGCCCAGCCAGG + Exonic
1153851930 18:9102875-9102897 GGAGAGCCCTGGGCTCTGCACGG + Intronic
1155303876 18:24459802-24459824 GGAGTCTCCTGGGCTCTGCCTGG + Intergenic
1156389259 18:36635420-36635442 GGAGCATTCTGGGCACAGCATGG + Intronic
1156462720 18:37330630-37330652 GGGCCATGCTGGGCCCTGCGTGG - Intronic
1157805480 18:50654764-50654786 GGAGCATCTGGGTCCCTGCGTGG - Intronic
1160433583 18:78829366-78829388 GGTGCATCCTGAGCCTGGCATGG - Intergenic
1160681388 19:413116-413138 GGGGCGTCCTGGCCCCTCCACGG + Intergenic
1160681402 19:413154-413176 GGGGCGTCCTGGTCCCTCCACGG + Intergenic
1160681425 19:413228-413250 GGGGCATCCTGGCCCCTCCACGG + Intergenic
1160681450 19:413302-413324 GGGGCATCCTGGCCCCTCCACGG + Intergenic
1160681475 19:413376-413398 GGGGCATCCTGGCCCCTCCACGG + Intergenic
1160681488 19:413414-413436 GGGGCATCCTGGCCCCTCCATGG + Intergenic
1160686274 19:438434-438456 GGGGCGTCCTGGCCCCTGCAGGG + Intronic
1160772569 19:839631-839653 GGGCCATCCTGGGCACTGCAGGG + Intergenic
1160772723 19:840344-840366 GGCCCGTCCTGGGCACTGCAGGG + Intergenic
1160779689 19:872301-872323 GGGCTGTCCTGGGCCCTGCAGGG - Intronic
1160800215 19:964198-964220 GGGGCCACCTGGGCACTGCAGGG - Intronic
1160809551 19:1007525-1007547 GGGCCGTCCTGGGCACTGCAGGG - Intronic
1160897888 19:1411272-1411294 GGGGCACCGTGGGCACTGCAGGG + Intronic
1160940327 19:1617796-1617818 GGGCCGTCCTGGGCACTGCAGGG + Intronic
1161036559 19:2088186-2088208 GGGGTATCCTGGGCACTGCAGGG - Intronic
1161036766 19:2089418-2089440 GGGCCATCCTGGGCACTGCAGGG + Intronic
1161037015 19:2090511-2090533 GGAGTGTCCTGGGCACTGCAGGG - Intronic
1161050393 19:2160813-2160835 GGGCTATCCTGGGCACTGCAGGG + Intronic
1161055440 19:2188557-2188579 GGGCCGTCCTGGGCACTGCAGGG + Intronic
1161060339 19:2211511-2211533 GGGCCATCCTGGGCACTGCAAGG - Intronic
1161071975 19:2266996-2267018 GCAGCGTCCTGGGCACTGCAGGG - Intronic
1161078961 19:2300913-2300935 GGGCCGTCCTGGGCACTGCAGGG + Intronic
1161120334 19:2522168-2522190 GGGCCGTCCTGGGCACTGCAGGG - Intronic
1161125875 19:2556809-2556831 GGAGCATCCTGGGCTCTGCAGGG + Intronic
1161126600 19:2561333-2561355 GGGCCAACCTGGGCACTGCAGGG - Intronic
1161126832 19:2562584-2562606 GGGCCATCCTGGGCACTGCAGGG + Intronic
1161127809 19:2569689-2569711 GAGCCATCCTGGGCACTGCAGGG + Intronic
1161129259 19:2578692-2578714 GGGCCGTCCTGGGCACTGCAGGG + Intronic
1161134589 19:2612250-2612272 GGGCCATCCTGGGCACTGCAGGG + Intronic
1161134876 19:2613764-2613786 TGGCCATCCTGGGCACTGCAGGG - Intronic
1161137309 19:2627290-2627312 GGGTCATCCTGGGCACTGCAGGG - Intronic
1161142187 19:2654383-2654405 GGGCCATCCTGGGCACTGCAGGG + Intronic
1161142285 19:2654825-2654847 GGGCCATCCTGGGCACTGCAGGG + Intronic
1161145502 19:2675785-2675807 GGGCCATCCTGGGCACTGCAGGG - Intronic
1161145897 19:2677856-2677878 GGGCCATCCTGGGCACTGTAGGG - Intronic
1161148394 19:2693626-2693648 CGGCCATCCTGGGCACTGCAGGG + Intronic
1161148517 19:2694455-2694477 GGGCCGTCCTGGGCACTGCAGGG - Intronic
1161149401 19:2699751-2699773 GGGGCCTTCTGGGCACTGCAGGG - Intronic
1161155167 19:2728773-2728795 GGGCCGTCCTGGGCACTGCAGGG + Intronic
1161156509 19:2734606-2734628 GGGCCGTCCTGGGCACTGCAGGG + Intronic
1161158926 19:2750831-2750853 GGGCCATCTTGGGCACTGCAGGG + Intergenic
1161160360 19:2758150-2758172 GGGCCGTCCTGGGCACTGCAGGG - Intronic
1161211336 19:3067646-3067668 GGGGCGTCCTGGGCACTGCAGGG + Intergenic
1161234886 19:3192909-3192931 GGGCCGTCCTGGGCACTGCAGGG - Intronic
1161236742 19:3201961-3201983 GGGCCGTCCTGGGCACTGCAGGG + Intronic
1161247142 19:3259383-3259405 GGGCCGTCCTGGGCACTGCAGGG - Intronic
1161247248 19:3259828-3259850 GGGCCATCCTGGGCACTGCAGGG - Intronic
1161265808 19:3363836-3363858 GGGCCGTCCTGGGCCCTGCAGGG - Intronic
1161280645 19:3443795-3443817 GGGCCATCCTGAGCACTGCAGGG - Intronic
1161281154 19:3446438-3446460 GGGCCCTCCTGGGCACTGCAGGG - Intronic
1161286258 19:3469905-3469927 GGGCCGTCCTGGGCACTGCAGGG - Intergenic
1161322475 19:3647568-3647590 GGGCCGTCCTGGGCCCTGCAGGG - Intronic
1161328639 19:3675777-3675799 GGGCCGTCCTGGGCACTGCAGGG + Intronic
1161329765 19:3680961-3680983 GGGCCATCCTGGGCACTGCAGGG - Intronic
1161365332 19:3876042-3876064 GAGCCATCCTGGGCACTGCAGGG + Intergenic
1161391682 19:4024392-4024414 GGCCCATCCTGGGCATTGCAGGG + Intronic
1161394030 19:4035287-4035309 AGGCCAGCCTGGGCCCTGCATGG + Intronic
1161403048 19:4077410-4077432 GGTCCGTCCTGGGCACTGCAGGG - Intergenic
1161405932 19:4091055-4091077 GGGCCATCCTGGGTACTGCAGGG + Intronic
1161477964 19:4496722-4496744 GGGTCATCCTGGGCACTACAGGG - Intronic
1161480295 19:4506989-4507011 GGGCCACCCTGGGCACTGCAGGG + Intronic
1161480455 19:4507825-4507847 GGATCATCCTGGTCCCTGCAGGG - Intronic
1161481983 19:4515714-4515736 GGGCCATCCTGGGCACTGCAGGG - Intronic
1161548309 19:4895838-4895860 GGGCCGTCCTGGGCACTGCAGGG + Intronic
1161551426 19:4914979-4915001 GGACCGTCCTGGGCACTGCAGGG + Intronic
1161552870 19:4923782-4923804 GGGCCTTCCTGGGCCCTGCAGGG - Intronic
1161553606 19:4928209-4928231 GAGCCATCCTGGGCACTGCAGGG - Intronic
1161553720 19:4928706-4928728 GGACCGTCCTGGGCACTGCAGGG + Intronic
1161556359 19:4944889-4944911 GGGCCATCCTGGGCACTGCAGGG + Intronic
1161558490 19:4957705-4957727 GGGCCGTCCTGGGCACTGCAGGG + Intronic
1161564960 19:4996877-4996899 GGGCTGTCCTGGGCCCTGCAGGG + Intronic
1161583293 19:5092241-5092263 GGGCCGTCCTGGGCACTGCACGG + Intronic
1161587515 19:5113646-5113668 GGAGCATCCTGGGCCCTGCAGGG + Intronic
1161605933 19:5214928-5214950 GGGCCATTCTGGGCACTGCAGGG + Intronic
1161654606 19:5506489-5506511 CGACCATCCTGGGCACTGCAGGG + Intergenic
1161671953 19:5617696-5617718 GGAGTATCCTGTGCATTGCAGGG - Intronic
1161834374 19:6635690-6635712 GGAGCCATCTGGGCACTGCAAGG - Intergenic
1161942443 19:7414106-7414128 GGACCTACCTGGGCACTGCAGGG + Intronic
1162362276 19:10227356-10227378 GGGGCATCCTGGCCCCTGGCTGG + Intronic
1162417501 19:10546934-10546956 GGGGCACCCTGGGCCCAGCGTGG - Exonic
1162475979 19:10899541-10899563 GGAACCTCCTGAGCCCTGCCAGG - Intronic
1163222136 19:15929350-15929372 AGAGGGGCCTGGGCCCTGCAGGG + Intronic
1163381756 19:16973734-16973756 GGAGCATGCTTCGCCCTTCAGGG - Intronic
1164607952 19:29613481-29613503 CCAGCATCCTGGGCAGTGCATGG + Intronic
1164632145 19:29768865-29768887 GGAGCATCCTGAGCTCTCCCAGG + Intergenic
1165083998 19:33329984-33330006 GGATCATGCTGGGCCTTGTAGGG - Intergenic
1166160734 19:40950987-40951009 GGGGCATCCTGGGCCCTTTGGGG - Intergenic
1166169638 19:41018726-41018748 GGGGCATCCTGGGCCCTTTGGGG - Intergenic
1166267604 19:41694934-41694956 GGGTCCTCCTGGGTCCTGCAGGG + Intronic
1166589570 19:43984792-43984814 GGATCATCCAGAGCCCTGCCGGG - Intronic
1166591537 19:44003535-44003557 GGATCATCCAGCGTCCTGCAGGG - Intronic
1166593710 19:44025901-44025923 GGATCATCCAGCGTCCTGCAGGG - Intronic
1166601078 19:44094947-44094969 GGATCATCCAGCGTCCTGCAGGG - Intronic
1166624416 19:44337067-44337089 GGACCAGCCTGGGCAATGCAGGG - Intronic
1167476832 19:49706210-49706232 GGCACATCCCGGGCCCTCCAGGG + Exonic
1167743477 19:51338088-51338110 CGGGCATCCTGGGCCCGGGAAGG - Exonic
924978847 2:201972-201994 ACAGCAGCCTGGGACCTGCAGGG + Intergenic
925041550 2:735148-735170 AGAGCATCCTGGGCCCAGCTGGG - Intergenic
925099912 2:1235609-1235631 GGTGCCTCGTGGGGCCTGCAGGG - Intronic
926116096 2:10214446-10214468 GGGGGTCCCTGGGCCCTGCATGG + Intergenic
926195619 2:10762001-10762023 GGCCCTGCCTGGGCCCTGCAGGG + Intronic
926680187 2:15657265-15657287 GGAGCAATCTGGGCCCTGAGAGG - Intergenic
927554580 2:24022972-24022994 TGAGCCTCCTGGGGCCAGCAGGG + Intronic
927558267 2:24050533-24050555 GGAGCACCCTGGGACGTCCAGGG - Intronic
928420480 2:31134604-31134626 GGAGCCTCCTGTGCCCCACATGG + Intronic
932056619 2:68449485-68449507 GGAGCATCCTGGATCCTGGATGG - Intergenic
932421478 2:71604002-71604024 GCAGCCTGCTTGGCCCTGCAGGG - Intronic
934577699 2:95413525-95413547 GGTGGAGCCTGGGGCCTGCAGGG + Exonic
934639992 2:96022233-96022255 GGTGGAGCCTGGGGCCTGCAGGG + Exonic
934793654 2:97083163-97083185 GGTGGAGCCTGGGGCCTGCAGGG - Intergenic
934986740 2:98893049-98893071 GGAGCATCTTCGGCCCAGAAAGG + Intronic
938108825 2:128550988-128551010 AGAACATTCTGGGTCCTGCAGGG + Intergenic
945731440 2:213541326-213541348 GAAACATCTTGGGCCATGCACGG + Intronic
948055782 2:235008355-235008377 TGGCCCTCCTGGGCCCTGCAGGG - Intronic
948056115 2:235010316-235010338 GAAGCAGGCTGGGCCCAGCACGG - Intronic
948122630 2:235542792-235542814 GAAGCACCATGGGGCCTGCAGGG - Intronic
948752938 2:240143019-240143041 GATGCTTCCTGGGTCCTGCAGGG + Intronic
948798553 2:240419619-240419641 CCAGCTTCCTGGGTCCTGCATGG + Intergenic
948845728 2:240682016-240682038 GGAGCAGCCTGTCCCCTGCCAGG - Intronic
948848129 2:240692714-240692736 GGAGCAGCCTGTCCCCTGCCAGG + Intronic
1172789302 20:37491490-37491512 GGGGCATCCAAGGCTCTGCAGGG + Intergenic
1172795289 20:37532714-37532736 AGATCATCCTGGGCCAGGCATGG - Intergenic
1172871317 20:38137088-38137110 GGAGCGTCCAGGCCTCTGCAGGG - Intronic
1173338412 20:42132065-42132087 GAATCATGCTGGGCTCTGCAGGG + Intronic
1173499168 20:43539868-43539890 GCACCACCCTGGGCCCTGCAAGG - Intronic
1174055381 20:47794825-47794847 GGCCCAGCCTGGCCCCTGCATGG + Intergenic
1174658975 20:52194121-52194143 GGAGCTGCCTGGGCAATGCAGGG - Intronic
1174934746 20:54855176-54855198 AGAGCATACTGGGCCATGCACGG + Intergenic
1175253676 20:57625227-57625249 GCCACATGCTGGGCCCTGCAGGG + Intergenic
1175455828 20:59113177-59113199 GGAGCATCCTGCTACCCGCATGG - Intergenic
1175481971 20:59318222-59318244 GAAGCAGCCTGGGGCATGCACGG + Intronic
1175493969 20:59400100-59400122 GGTGCACCCTGGGGCCGGCAAGG - Intergenic
1175598294 20:60253050-60253072 GGAGCAGCCTTGGCCCAGGATGG - Intergenic
1175811473 20:61860722-61860744 GTGGCATCCAGGCCCCTGCAGGG + Intronic
1175956106 20:62610204-62610226 GGAGCACCCTGCACCCTCCAAGG + Intergenic
1176044876 20:63087393-63087415 GCTGCTTCCTGGGCCCAGCAGGG - Intergenic
1176159166 20:63639987-63640009 GGAGGATCCTGACCCCTGCAGGG - Exonic
1176161581 20:63651442-63651464 GCAGCCTCCAGGGCCCTCCAGGG - Intronic
1176256616 20:64156354-64156376 GCAGCATCCTGGGCTCAGCATGG + Intronic
1176267028 20:64215035-64215057 GCAGCCTGCTGGGACCTGCAGGG - Intronic
1176672615 21:9748654-9748676 TGGACATCCTGGGCCCTTCAGGG + Intergenic
1176822026 21:13666259-13666281 GCAGCATCCTGGGCCTTCCCTGG + Intergenic
1179250085 21:39664895-39664917 GGAGGATCCTGGGCTCTGCGTGG + Exonic
1179558047 21:42193232-42193254 GGAGCACCCTGGGCCATGCTGGG - Intergenic
1179905259 21:44419258-44419280 GGAGCATCCTGGAGCTGGCAAGG + Intronic
1180704328 22:17799616-17799638 GGGGCAGCCTTGGCACTGCAAGG + Intronic
1180961162 22:19763013-19763035 GGAGCCTCCTGGGCCGTTCCTGG - Intronic
1180979365 22:19871555-19871577 GGAGCATCCTATGCCCAGCCTGG - Intergenic
1181007628 22:20021473-20021495 GGAGCTGCGTGGTCCCTGCAGGG + Intronic
1181310885 22:21944114-21944136 GGAGCAGAGTGGGCCCAGCAGGG - Intronic
1181330516 22:22087157-22087179 GGAGCATCCAGGGCCCCACCTGG + Intergenic
1181370384 22:22410414-22410436 GGGGCATCCAGGGCCCTGCCTGG + Intergenic
1181778673 22:25177936-25177958 GGAGGATCCTGACCCCTGCAGGG - Intronic
1182429291 22:30290617-30290639 GGAGCATTCTCAGCCCTGCATGG - Intronic
1182520349 22:30881368-30881390 GGTGGTACCTGGGCCCTGCATGG - Intronic
1182921538 22:34084581-34084603 GGAGCATCTTGGGACCCTCAAGG - Intergenic
1183101864 22:35589050-35589072 GCAGCAGCCTGTGCCCTACATGG - Intergenic
1183386104 22:37515663-37515685 GGACTGTCCTGTGCCCTGCAGGG + Intronic
1183620185 22:38967576-38967598 GCTGCATCCAGGGCCCTGCAGGG - Intronic
1183722778 22:39572101-39572123 GCAGCCTCCAAGGCCCTGCAGGG - Intronic
1183732790 22:39628007-39628029 AGAGCAGCCTGGACCCTGCAGGG + Intronic
1184014516 22:41775882-41775904 GGTCCATCCTAGGCCGTGCATGG - Intronic
1184259435 22:43306117-43306139 GGAGCACCCTGGGCCCTGGGTGG - Intronic
1184350362 22:43939522-43939544 GGAGCAGCCTGGGCCGGGCGCGG + Intronic
1184351259 22:43945660-43945682 GGTGGATCCTGGGCCCTGGCTGG + Intronic
1184878415 22:47289806-47289828 GGCTCTTCCTGGTCCCTGCACGG - Intergenic
1184949380 22:47829499-47829521 TTAACATCCTGGGTCCTGCAGGG + Intergenic
1185118724 22:48952916-48952938 GGGGAAGCCTTGGCCCTGCAAGG - Intergenic
1185220747 22:49628019-49628041 TGTGCATCCTGGGCCCTGCCTGG - Intronic
950171987 3:10845024-10845046 TGAGCATGCTGTGCACTGCAAGG + Intronic
953534891 3:43769903-43769925 GGAGCAGCCTGGGCCCCTCCCGG - Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
956099025 3:65748125-65748147 GGAGCACCCTGGCCCATGCTTGG - Intronic
956585628 3:70861448-70861470 GGAGAATTCTGGCCCATGCATGG - Intergenic
961311938 3:126007851-126007873 GGAGCACCGTGGGCGCTGGAGGG - Intronic
961449666 3:126996866-126996888 GGAGGGTCCTGTGCCCTGCATGG + Intronic
961663845 3:128484366-128484388 AGAGCCTCCTGGGCCCAGCCAGG - Intronic
961735921 3:129002093-129002115 GGGGCAGCCGGGGCCCCGCACGG - Exonic
961796840 3:129415249-129415271 GGAGCAGCCTGGCCACTGCAAGG - Exonic
964568867 3:158090399-158090421 GGAGAATCCTGGGCCCTTTTAGG + Intergenic
968605689 4:1534285-1534307 GGAGCTGCCTGGGCCCAGCCAGG - Intergenic
968644794 4:1735088-1735110 GGCGCCTCCTGGGCACCGCAGGG - Intronic
968753556 4:2402851-2402873 GGGGCAGGCTTGGCCCTGCAGGG - Intronic
968864434 4:3198833-3198855 GGAGCATCCTGGGCCTAGGCAGG - Intronic
968952393 4:3701773-3701795 GGAGCCTCCCGGGCCCTCCGTGG - Intergenic
969243866 4:5919705-5919727 GGTGCCTACTGGGCCCTGGAGGG + Intronic
969870367 4:10100934-10100956 GGGGCAGCATGGGCCCTGGATGG - Intronic
981616447 4:146648629-146648651 GGGGCATCCTGGCTCCTGAATGG - Intergenic
982253278 4:153428630-153428652 GGTGGAGTCTGGGCCCTGCAGGG - Intergenic
985402108 4:189603177-189603199 TGGACATCCTGGGCCCTTCAGGG - Intergenic
985764141 5:1768066-1768088 GGAGCATGCAGGGCCCAGCCAGG + Intergenic
985768797 5:1796153-1796175 GGCCCATCCTGGGCACTGCCGGG - Intergenic
985810291 5:2078205-2078227 GAGGCAGCCTAGGCCCTGCACGG - Intergenic
985880950 5:2638831-2638853 GTAGCACCCAGAGCCCTGCATGG + Intergenic
985890185 5:2709100-2709122 GGTGCTTGTTGGGCCCTGCAGGG + Intergenic
986539206 5:8826650-8826672 AGAGCTTTCTGGGCCCTGGAGGG - Intergenic
986723527 5:10577473-10577495 GGCCCATCCTGGGTCTTGCAGGG + Intronic
988518929 5:31928972-31928994 GGAGTATGCTGGGCTCTGAAAGG + Intronic
995180106 5:109223079-109223101 TGTGCATGTTGGGCCCTGCACGG + Intergenic
995188666 5:109298020-109298042 GAAGCATCATGAACCCTGCACGG - Intergenic
997235828 5:132271506-132271528 GGGGCAACCTGGGCACTGCAGGG - Intronic
997750637 5:136342200-136342222 GAAGCTGCCTGGGTCCTGCATGG + Intronic
998500389 5:142627617-142627639 GGGGCATGCTGGGGCCTCCATGG - Intronic
999242637 5:150136645-150136667 GGAGCTTCCAGGTCCCTGCTGGG - Intronic
999261612 5:150241946-150241968 GGAACCTCCTGGCCCCTGCGCGG - Intronic
999747101 5:154600776-154600798 GGAGACTCCTTGGCCCTTCAGGG + Intergenic
1000019121 5:157303703-157303725 GGACCAACCAGGCCCCTGCAGGG - Intronic
1002043865 5:176531511-176531533 GGAGCATGCTGGGAGCTGCTGGG + Exonic
1002295164 5:178226547-178226569 GGAGCTTCCTGTGCCCTCCCTGG + Intronic
1002434589 5:179222845-179222867 GGAGGCAGCTGGGCCCTGCAGGG - Intronic
1002522703 5:179800378-179800400 GGAGAATTCAGGGCACTGCAGGG + Intronic
1004367026 6:15021338-15021360 GGAGCATCTGGGTCCCTGGAGGG - Intergenic
1004601256 6:17152213-17152235 GGAGCATTGTGGGTTCTGCATGG + Intergenic
1004776096 6:18846767-18846789 GGAGCGTCCTGTGCCCTCTAGGG + Intergenic
1005064083 6:21801422-21801444 AGAGCATCCTTGGCACTGCATGG + Intergenic
1005671168 6:28107726-28107748 GGAGACTCCTGGGCCCTGTGAGG + Intergenic
1006809127 6:36808542-36808564 GGAGGGTCCTGGGCCCTCCCTGG - Intronic
1007484920 6:42174401-42174423 GGAGCATTCTGGGTTCTCCAGGG - Intronic
1008886219 6:56433345-56433367 CGAGCTTCCTGGGCCCGGCGCGG + Intergenic
1011670000 6:89674348-89674370 GCAGCCTCCTGGCCCCTGCCTGG - Exonic
1012401442 6:98845337-98845359 TGAGCATCCTGGGCGCTGGCAGG + Intergenic
1013502496 6:110766612-110766634 GCAGCATCATTGACCCTGCAGGG + Intronic
1013590164 6:111613074-111613096 GTATCTTCCAGGGCCCTGCAGGG - Intergenic
1013632173 6:111996253-111996275 GCTGCATCCTGGCCCCTGCTAGG + Intergenic
1016390841 6:143573397-143573419 GTAGCATCCAGGGACCTCCATGG - Intronic
1017106752 6:150895137-150895159 CCAGCGTCCTGGGCCCTGCAGGG + Intronic
1017918907 6:158854825-158854847 GCAGCAGCCTGGGCACTGCATGG - Intergenic
1018038131 6:159898923-159898945 GGTGCTCCCTGGGTCCTGCAGGG - Intergenic
1018536773 6:164828632-164828654 GGAGCAGCCTGGTCAATGCAGGG - Intergenic
1018874042 6:167804404-167804426 TGAGGATGCTGGGCCTTGCAGGG + Intergenic
1018936341 6:168276188-168276210 GGAGGAACCTGGGGCCTGTAGGG - Intergenic
1019289837 7:245087-245109 GGAGCATCCTGGCCCTGCCACGG - Intronic
1019478566 7:1255648-1255670 GGAGCCTGCTGTGCCCTGGAGGG - Intergenic
1019594341 7:1851455-1851477 GGGGCTTCCTGGGCACTGCTGGG - Intronic
1020561178 7:9729629-9729651 GGAGCATGCTTCGCCCTTCAGGG + Intergenic
1021925450 7:25529636-25529658 GGTTCATGCTGGGCCCTGCGGGG - Intergenic
1022977048 7:35568253-35568275 TTAGCATCCTGGGCCCTGTTTGG - Intergenic
1023366508 7:39469564-39469586 GGAGCTCCCTGGCCCCTTCATGG - Intronic
1023478230 7:40604260-40604282 GGACCATCATAGGCCTTGCAGGG - Intronic
1023938722 7:44756954-44756976 GGAACCCCATGGGCCCTGCAGGG + Exonic
1024990788 7:55233356-55233378 GGAGCAACCTGGGTCTTGAAGGG + Intronic
1025237606 7:57245317-57245339 GGCCCAGCCTGGCCCCTGCATGG - Intergenic
1025850463 7:65239658-65239680 GGAGGGTTCGGGGCCCTGCAGGG - Intergenic
1026576280 7:71574289-71574311 GGGGCAGACTGGGCTCTGCAGGG - Intronic
1027629671 7:80587319-80587341 TTAGAATCCTGGGCCCTGAAAGG - Intronic
1028204902 7:88005326-88005348 GGAGCATTCTGGGCATTGCAGGG + Intronic
1029728527 7:102424527-102424549 GGGGCTTCCTGGGCCATGCTTGG + Intronic
1030198522 7:106877361-106877383 GGACTATCCTGTACCCTGCAGGG - Intronic
1034336974 7:150330112-150330134 AGATCATCCTGGGCACTGCCAGG + Exonic
1034627247 7:152503254-152503276 GGAGCATCCTTGATGCTGCAGGG - Intergenic
1034946927 7:155268344-155268366 GGAGCCTCCTGGGCCCTGCAAGG + Intergenic
1034990978 7:155548110-155548132 GGCGGGTCCTGGGGCCTGCAAGG + Intergenic
1035761017 8:2068816-2068838 GCAGCATCCTGGCTCCTACACGG + Intronic
1036384839 8:8270039-8270061 AGGGCCTCCTGGGCCCTTCAAGG + Intergenic
1038124827 8:24661642-24661664 GCAGTATCCTGGGGCCTGAATGG + Intergenic
1039800057 8:40946396-40946418 GGCCCTTCCTTGGCCCTGCAGGG + Intergenic
1040436848 8:47399318-47399340 GGTCCATCCTGGCACCTGCATGG - Intronic
1040562201 8:48532956-48532978 GGAGCTCGCTGGGGCCTGCAAGG - Intergenic
1042650830 8:71039092-71039114 TCAGCATCCTGGGCCAGGCACGG - Intergenic
1047313057 8:123708458-123708480 GCAGCCTCCTGGGCCCAGCCAGG - Intronic
1047525075 8:125626118-125626140 GGAGCATCCTAGGCTTTCCAGGG + Intergenic
1048411364 8:134177434-134177456 GGGGCATCCTGGGGAATGCATGG - Intergenic
1048512777 8:135077776-135077798 GCAGCACCCTGGGCCCTGGATGG - Intergenic
1048906829 8:139096682-139096704 GGAGCATGCCTGGCTCTGCAGGG + Intergenic
1049160666 8:141095691-141095713 GTAGCAGCCTGGGCCCGGGAAGG - Intergenic
1049192439 8:141295834-141295856 GCACCATCCTGGGCGGTGCAGGG - Intronic
1049262140 8:141645563-141645585 GGGGCCACCTGGGCCCTCCAGGG - Intergenic
1049470791 8:142774226-142774248 GGAGCAGCCTGGGGCCGGCGCGG - Intronic
1049475136 8:142793821-142793843 GGCCCATGCTGGGCCCTGCCAGG + Intergenic
1049800146 8:144513883-144513905 TCAGCAGCCAGGGCCCTGCAGGG + Intronic
1051029707 9:12658925-12658947 GGGGCAGCCTGGGCCTTCCAGGG + Intergenic
1054463994 9:65481774-65481796 GAAGCATCCTGTGCACTGCCGGG - Intergenic
1056738012 9:89226173-89226195 GGGGCCCACTGGGCCCTGCATGG - Intergenic
1057276957 9:93681104-93681126 TGAGCACCCTGGGCCCTGGAAGG + Intergenic
1057575117 9:96236224-96236246 TGAGGATCCTGGGCCAGGCATGG + Intronic
1057790185 9:98119332-98119354 GGAGCATCCTCCGACCAGCAGGG + Intergenic
1058799123 9:108527700-108527722 TAAGCATCCTCGGCCATGCATGG - Intergenic
1058907331 9:109492348-109492370 GGAGCATCCAGGACTGTGCAGGG - Intronic
1059335015 9:113563633-113563655 GAAGGTTCCTAGGCCCTGCAAGG + Intronic
1059395625 9:114032427-114032449 TGGGCCTCCTGGGCCCTGCCAGG + Intronic
1060757306 9:126223106-126223128 GGAGCCCCCTGGGCCCGGGACGG + Intergenic
1061138552 9:128750829-128750851 GGAGAGGCCTGGGCTCTGCAAGG + Intronic
1061139151 9:128753748-128753770 CGAGCAGCCTGGCCCCTGCTTGG + Intronic
1061814787 9:133188217-133188239 GCAGAAGCCTGGACCCTGCAGGG + Intergenic
1062026163 9:134341728-134341750 GGAGCACCATGGGGCATGCATGG + Intronic
1062401499 9:136374705-136374727 GGGCCATCCTGGGCCCTGCCAGG + Intergenic
1062416684 9:136454739-136454761 GAAGCATCCAGGGCCCAGCATGG - Intronic
1062508129 9:136888615-136888637 GGTGCAACCTGGCCGCTGCAGGG - Intronic
1062619015 9:137411257-137411279 GGGGCATCCTGGGCTCAGCTGGG - Intronic
1062631211 9:137463975-137463997 GGGGCATCCTGTGTCCTCCATGG + Intronic
1062634921 9:137485760-137485782 GGAGCCTCCAGGGCCCACCAAGG + Intronic
1185479037 X:432694-432716 GGGCCATCCTGGGCGCTGTAGGG + Intergenic
1185573085 X:1149485-1149507 GGGCCATCCTGGGCACTGGAGGG + Intergenic
1185622275 X:1457493-1457515 GGGCCATCCTGGGCACTGTACGG - Intergenic
1185694490 X:2185068-2185090 GGGCCATCCTGGGCACTGTAAGG - Intergenic
1185770025 X:2758724-2758746 GGGGCGTCCTGTGCACTGCAGGG - Intronic
1185778440 X:2824780-2824802 GGGGCGTCCTGTGCACTGCAGGG - Intergenic
1185832489 X:3315498-3315520 GGGCCATCCTGTGCACTGCAGGG + Intronic
1185871623 X:3669521-3669543 GGGGCATCCTGTGCACTGTAGGG - Intronic
1186586567 X:10881230-10881252 GGAAAATCCTGGGCACTGAAAGG - Intergenic
1187298717 X:18027490-18027512 AGAGCATCCTGGCCTCTGCAGGG + Intergenic
1187390302 X:18882336-18882358 GAACCATCGTGGGCCTTGCAAGG - Intergenic
1189369216 X:40414513-40414535 GGAGCCTGCTCTGCCCTGCAGGG - Intergenic
1190264141 X:48817494-48817516 GGAGCATCCAGGTCCCCACAAGG - Intronic
1193865500 X:86725942-86725964 GAAACTTCCTGGGTCCTGCATGG + Intronic
1194448295 X:94012900-94012922 GGAGCAGCCTGGTCCCTGACAGG - Intergenic
1196170780 X:112586924-112586946 GGTGTCTCCTGGGTCCTGCAGGG - Intergenic
1199894210 X:152116370-152116392 GGAGCGTCTTAGGCCCTGCCAGG - Intergenic
1200018292 X:153181555-153181577 GGAGCGTCCCAGGCCCTGCCAGG + Intronic
1200807116 Y:7444463-7444485 GTAGAATCCTGTGCCTTGCAAGG + Intergenic
1201243562 Y:11981455-11981477 GGGCCATCCTGTGCACTGCAAGG - Intergenic
1201291498 Y:12424950-12424972 GGGGCGTCCTGTGCACTGCAGGG + Intergenic
1201300496 Y:12500908-12500930 GGGGCGTCCTGTGCACTGCAGGG + Intergenic
1201341791 Y:12942269-12942291 AGGGCCTCCAGGGCCCTGCAGGG + Intergenic
1202044710 Y:20726764-20726786 GGGCCATCCTGGGCACTGCAGGG + Intergenic