ID: 1161588503

View in Genome Browser
Species Human (GRCh38)
Location 19:5118180-5118202
Sequence CTTGGTGACCACTTGGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 159}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161588488_1161588503 11 Left 1161588488 19:5118146-5118168 CCCACCCCACCCCTGTCAGATGA 0: 1
1: 0
2: 2
3: 29
4: 306
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159
1161588492_1161588503 5 Left 1161588492 19:5118152-5118174 CCACCCCTGTCAGATGAGCCTGC 0: 1
1: 0
2: 2
3: 28
4: 335
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159
1161588491_1161588503 6 Left 1161588491 19:5118151-5118173 CCCACCCCTGTCAGATGAGCCTG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159
1161588495_1161588503 0 Left 1161588495 19:5118157-5118179 CCTGTCAGATGAGCCTGCCCCAC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159
1161588489_1161588503 10 Left 1161588489 19:5118147-5118169 CCACCCCACCCCTGTCAGATGAG 0: 1
1: 0
2: 2
3: 31
4: 287
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159
1161588494_1161588503 1 Left 1161588494 19:5118156-5118178 CCCTGTCAGATGAGCCTGCCCCA 0: 1
1: 0
2: 3
3: 11
4: 209
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159
1161588490_1161588503 7 Left 1161588490 19:5118150-5118172 CCCCACCCCTGTCAGATGAGCCT 0: 1
1: 0
2: 0
3: 17
4: 234
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159
1161588486_1161588503 23 Left 1161588486 19:5118134-5118156 CCCGGCAGCGGGCCCACCCCACC 0: 1
1: 0
2: 5
3: 74
4: 1009
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159
1161588485_1161588503 24 Left 1161588485 19:5118133-5118155 CCCCGGCAGCGGGCCCACCCCAC 0: 1
1: 0
2: 0
3: 27
4: 250
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159
1161588493_1161588503 2 Left 1161588493 19:5118155-5118177 CCCCTGTCAGATGAGCCTGCCCC 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159
1161588487_1161588503 22 Left 1161588487 19:5118135-5118157 CCGGCAGCGGGCCCACCCCACCC 0: 1
1: 0
2: 2
3: 69
4: 486
Right 1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG 0: 1
1: 1
2: 0
3: 9
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161588503 Original CRISPR CTTGGTGACCACTTGGTCCT TGG Intronic
901337767 1:8465916-8465938 CCTGCTCACCACTTCGTCCTCGG + Exonic
903489743 1:23719259-23719281 CTTGGCCACCCCTTGGGCCTAGG - Intergenic
903695046 1:25200327-25200349 CTTGGATACCACGTGGTACTTGG - Intergenic
903805796 1:26004911-26004933 CTTGGTCACCCCTTGCTCCAGGG + Intergenic
904754008 1:32758189-32758211 CTAGCTGAGCACTCGGTCCTGGG + Intronic
906325966 1:44846086-44846108 ATTTGTAACCACTTGGGCCTTGG + Intergenic
906568602 1:46817925-46817947 GTTGGTGACCAGGTAGTCCTGGG - Intronic
912776882 1:112511030-112511052 CTTGGGGACCAATTGGTGTTTGG + Intronic
913126122 1:115791991-115792013 TGTGGTGACCACTGGGTGCTAGG + Intergenic
913661613 1:121010230-121010252 ATTGGTGACCAATTGGATCTTGG - Intergenic
914012983 1:143793410-143793432 ATTGGTGACCAATTGGATCTTGG - Intergenic
914164842 1:145167775-145167797 ATTGGTGACCAATTGGATCTTGG + Intergenic
914351850 1:146846795-146846817 CATGGTCACCACTATGTCCTTGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914651608 1:149702019-149702041 ATTGGTGACCAATTGGATCTTGG - Intergenic
914983747 1:152439189-152439211 CTTGGCCACCACTGGGTCCCTGG + Intergenic
915038896 1:152951067-152951089 CTTTCCAACCACTTGGTCCTGGG - Intergenic
917167836 1:172133252-172133274 CTTGGTGAGCTCTTGGTTATTGG + Intronic
917988348 1:180346176-180346198 GTTTGTGACTACTTGGTCCTTGG - Intronic
918390449 1:184054274-184054296 CTTGATGACCACTTGATGATTGG + Intronic
920986979 1:210900075-210900097 CTTGTTTACCACTTGTTCTTAGG - Intronic
921397149 1:214680597-214680619 CTTGGTTATCACTTCCTCCTGGG + Intergenic
921774236 1:219078737-219078759 CTTTGTCACCACTTGGATCTTGG - Intergenic
922766567 1:228159253-228159275 CTTGGTCACCACTGGGGCCAAGG + Exonic
924456050 1:244219659-244219681 CTTGGTGAGCTCTTCCTCCTGGG - Intergenic
1063438408 10:6052956-6052978 CTTAAGGACCACCTGGTCCTTGG - Intronic
1065834732 10:29646422-29646444 CTTTGTGAACACATGGTCCCTGG - Intronic
1066061853 10:31731041-31731063 CTTGGTAACCAGTAGGTGCTAGG + Intergenic
1067567521 10:47349575-47349597 CTTGGTGACCAGATCTTCCTCGG - Exonic
1071565683 10:86670242-86670264 CCTGGAGACCACAGGGTCCTGGG + Intronic
1071672914 10:87626805-87626827 CTTGAGGATCACTTGGGCCTAGG - Intergenic
1073510541 10:104039973-104039995 CTTGGTGTCCTCTGGGGCCTGGG + Exonic
1077051759 11:569717-569739 CTTGCTGACCCCTTGACCCTTGG + Intergenic
1078056783 11:8015653-8015675 CATGGTAAGCCCTTGGTCCTAGG + Intergenic
1080032125 11:27672933-27672955 CTTGGTGACTTCTTGGTGTTTGG - Intronic
1081110830 11:39131130-39131152 CTGGGTGTCAACTTGATCCTGGG + Intergenic
1081638251 11:44735098-44735120 CATAGTGAACACTTGTTCCTGGG + Intronic
1081807245 11:45897231-45897253 CTTGCTCACCTCTAGGTCCTGGG - Intronic
1082738450 11:56883503-56883525 CTTGGAGACCATCTGGTCCCTGG + Intergenic
1084704015 11:70805335-70805357 CTTGGCTCCCACTTGGGCCTAGG + Intronic
1085118268 11:73949583-73949605 CTTGGTGACCAGTTGGATTTGGG + Intergenic
1085531059 11:77192199-77192221 GTTGGTGGCCACGTTGTCCTCGG - Exonic
1088140040 11:106604929-106604951 CTTCCTTACCACTTGATCCTGGG - Intergenic
1089012589 11:115143107-115143129 CCTGGTGACCACTCGGGCCAGGG - Intergenic
1090012325 11:123056324-123056346 CTGGGTGACCACTTGGACCCAGG + Intergenic
1090856219 11:130611137-130611159 CTTTGGGACCACATGCTCCTTGG + Intergenic
1095941929 12:47733053-47733075 CTTGGAGAGCACTTGGATCTTGG - Intergenic
1096786922 12:54022105-54022127 CCTGGTGACCACTTGGTTAAGGG + Intronic
1102724732 12:115051173-115051195 CTTGGTGACAGCTTGGTTCCAGG + Intergenic
1103419964 12:120772431-120772453 CTAGCTGACCACGTGCTCCTGGG + Intronic
1103897738 12:124285051-124285073 CTTGGTGAGGACTTGCTTCTTGG + Intronic
1103956426 12:124579514-124579536 CTTGGTGACCACTGTATCCCTGG - Intergenic
1104499386 12:129270037-129270059 CTAGGAGACCCCTTCGTCCTCGG - Intronic
1108614436 13:52117666-52117688 TTTGCTCACCACTTGATCCTTGG - Intronic
1114032475 14:18588789-18588811 CCTGGTGTCCACCTGGGCCTTGG - Intergenic
1114065994 14:19060263-19060285 CTTGCTCACCACTGAGTCCTTGG - Intergenic
1114077257 14:19167815-19167837 CCTGGTGTCCACCTGGGCCTTGG - Intergenic
1114084907 14:19231749-19231771 CCTGGTGTCCACCTGGGCCTTGG + Intergenic
1114096274 14:19339762-19339784 CTTGCTCACCACTGAGTCCTTGG + Intergenic
1116996289 14:51328560-51328582 CTTGCTGTCCACTTGGTGGTAGG + Intergenic
1121976575 14:98410034-98410056 CTTGGTGAATATTTGGTCATGGG - Intergenic
1122371422 14:101230771-101230793 CTAGGTGACCACTAGGTCCAAGG + Intergenic
1122651737 14:103230263-103230285 CCTGGGGTCCACTAGGTCCTGGG + Intergenic
1202896509 14_GL000194v1_random:13560-13582 CCTGGTGTCCACCTGGGCCTTGG + Intergenic
1124493393 15:30171969-30171991 CTTGGGGACCAGTGGGCCCTGGG + Intergenic
1124750141 15:32366356-32366378 CTTGGGGACCAGTGGGCCCTGGG - Intergenic
1125155360 15:36579447-36579469 CTTGTTGACCCTTTGATCCTAGG + Intergenic
1126581293 15:50244753-50244775 CCTGGTGATCCCTTGCTCCTGGG + Intronic
1130225648 15:82056460-82056482 CTTGGACACCCCTTGGGCCTAGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1139982184 16:70868741-70868763 CATGGTCACCACTATGTCCTTGG + Exonic
1140406345 16:74713969-74713991 CTTGGTGGCCAGGTGGCCCTTGG - Exonic
1140519066 16:75566517-75566539 CTGGGTAAGCACTTGGTCGTCGG + Exonic
1140681866 16:77393121-77393143 CATGGTGACCAGATGGTCCCTGG - Intronic
1142357052 16:89606189-89606211 CTTGGCCACCACCTGCTCCTGGG - Intergenic
1142740427 17:1928854-1928876 CTTGGGGACCCCGTGGTCCCTGG + Intergenic
1142996542 17:3763922-3763944 CCTGGTGTCCTCTTGGTTCTGGG + Exonic
1143518568 17:7432410-7432432 ATTGGAGACCACTTGGGCCTTGG - Intergenic
1145041047 17:19578961-19578983 CATGTAGACCAGTTGGTCCTCGG - Exonic
1145302956 17:21653642-21653664 CTAGGTGAACACTAGGTCTTAGG + Intergenic
1145347084 17:22048199-22048221 CTAGGTGAACACTAGGTCTTAGG - Intergenic
1147897426 17:43759803-43759825 CTTTGTGACCACTTGGTCCTGGG - Intergenic
1148214664 17:45827887-45827909 CTTGGTGGCCAGTAGCTCCTTGG + Intronic
1148772032 17:50072849-50072871 CTTGGGGACCAATCGGACCTGGG + Intronic
1152446467 17:80347559-80347581 CTGGGTGTACTCTTGGTCCTTGG - Exonic
1157623575 18:49030139-49030161 CATGGTGACCACCCTGTCCTGGG + Intergenic
1158473215 18:57757196-57757218 TTTGGTGTCCACATGGTCCCTGG + Intronic
1160357813 18:78243503-78243525 CTGGGTGAGCACCTGGTTCTGGG - Intergenic
1160443777 18:78912132-78912154 CTTGGTGCCCAGCTGGTCCTTGG + Intergenic
1160626026 18:80205691-80205713 CATGGTGACCATCTGCTCCTGGG - Intronic
1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG + Intronic
1162363837 19:10236040-10236062 CTTGGGGCGCACTTGGACCTTGG + Intergenic
1162452491 19:10763529-10763551 GTAGGTGCCCACTTGGTGCTGGG + Intronic
1163403389 19:17107994-17108016 CTTGGTGACATCTTGTGCCTGGG + Intronic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
1168281679 19:55309178-55309200 GATGGTGACCAATTTGTCCTGGG - Intronic
925294296 2:2767454-2767476 CTTGGTCAGCACTTGGACATCGG - Intergenic
927478086 2:23429289-23429311 CTTGGTGCCCACATGTCCCTGGG + Intronic
930235484 2:48885001-48885023 CCTGGTCACCACTTATTCCTGGG + Intergenic
931047541 2:58373337-58373359 CATGTTGTCCACTGGGTCCTTGG + Intergenic
931171752 2:59810651-59810673 GTTGGGGGCCACTTGCTCCTGGG + Intergenic
931320875 2:61174065-61174087 CTTGGTGCCCACTATGTGCTGGG + Intergenic
931775062 2:65533225-65533247 CTTGGTGCCCACTGGCGCCTGGG + Intergenic
937384711 2:121418369-121418391 CATTGTGACCACTTGCTCTTGGG - Intronic
943528090 2:189043231-189043253 CTTTGTCACCACGAGGTCCTTGG + Exonic
946095837 2:217273476-217273498 CTTGGTGATCACTTTTCCCTGGG - Intergenic
946888463 2:224248450-224248472 CTTGGGGACAAATTTGTCCTTGG - Intergenic
948269841 2:236665856-236665878 CATGGTGGCCACGTGGTCATTGG - Intergenic
1170072063 20:12380093-12380115 CTTGGTCACGACCAGGTCCTTGG - Intergenic
1171520478 20:25771334-25771356 CTAGGTGAACACTAGGTCTTAGG + Intronic
1171556441 20:26085159-26085181 CTAGGTGAACACTAGGTCTTAGG - Intergenic
1176616195 21:9029556-9029578 CCTGGTGTCCACCTGGGCCTTGG + Intergenic
1176708962 21:10134181-10134203 CCTGGTGTCCACCTGGGCCTTGG - Intergenic
1177920806 21:27150142-27150164 CTTGGAGACTACTTGGTTTTAGG - Intergenic
1178135872 21:29626550-29626572 CTTGGTGACACCTTGATGCTGGG + Intronic
1179680560 21:43018169-43018191 CTGTGTGACCACTTGGCCTTGGG - Exonic
1179829480 21:43987646-43987668 CTGGGTGTCCACATGCTCCTGGG + Intergenic
1180293063 22:10861444-10861466 CCTGGTGTCCACCTGGGCCTTGG - Intergenic
1180456586 22:15515846-15515868 CCTGGTGTCCACCTGGGCCTTGG - Intergenic
1180484474 22:15782855-15782877 CTTGCTCACCACTGAGTCCTTGG - Intergenic
1180495868 22:15890866-15890888 CCTGGTGTCCACCTGGGCCTTGG - Intergenic
1181871890 22:25905985-25906007 CTGGGGGACCACTTAGTGCTCGG + Intronic
1184499246 22:44861922-44861944 CTTGGTGACCTCTCTGGCCTCGG - Intronic
1185090925 22:48772728-48772750 CCAGGTGTCCACTGGGTCCTGGG + Intronic
950112806 3:10430870-10430892 CTTGGTGGCCTCTTGGGGCTTGG + Intronic
953580907 3:44155539-44155561 CTTGGTAGACAGTTGGTCCTTGG - Intergenic
962952120 3:140228956-140228978 AAAGTTGACCACTTGGTCCTTGG + Intronic
966257315 3:177931774-177931796 CATGGTGTTCCCTTGGTCCTTGG + Intergenic
969464813 4:7349994-7350016 CTTGGTGACAACTGGGGCCAGGG - Intronic
972139276 4:35936813-35936835 CTTTGTGTCCATTTGTTCCTGGG - Intergenic
977209590 4:94204010-94204032 CTTTGTCACCTCTTGGACCTTGG - Intergenic
985791461 5:1930748-1930770 CTTGGTCACCACCTGGGCCCTGG - Intergenic
986445272 5:7815902-7815924 CTTGCTGACGACTTGATCTTTGG - Intronic
988270421 5:29007064-29007086 TTTAATGACCACTTGCTCCTGGG - Intergenic
988499948 5:31776223-31776245 CTTGGTGACCACTTGGAATGAGG - Intronic
992185779 5:74242920-74242942 CTTGGTGACCCCTCAGACCTAGG + Intergenic
992919349 5:81497394-81497416 GTTGGTGATCACTTGGTCAATGG - Intronic
995523868 5:113035329-113035351 AGTGATGACCACTTGGACCTGGG - Intronic
995589717 5:113686850-113686872 CGTGGTGTCCACTTGGCCCAGGG + Intergenic
996480208 5:123967271-123967293 CTTGGAGACCCCTCAGTCCTGGG + Intergenic
999547794 5:152649985-152650007 CTGGATGACCCCTTGCTCCTGGG + Intergenic
999793334 5:154964212-154964234 CTTGGTCACCACTATATCCTTGG + Intronic
1007709792 6:43815246-43815268 CTCGATGACCACTTGGCCCAAGG + Intergenic
1010909856 6:81540278-81540300 CATGCTAACCACTTGGTACTGGG - Intronic
1013428493 6:110035624-110035646 CTTGGTTACCACCTGTTCCCTGG + Intergenic
1013894280 6:115066466-115066488 GTTCCTGACCACTTAGTCCTGGG - Intergenic
1019079819 6:169422691-169422713 CTTTGAGACCACTTGGTACCAGG - Intergenic
1021767469 7:23964264-23964286 CTTGCTGACCCCTTGATCTTGGG - Intergenic
1027827292 7:83132139-83132161 CTTGGTGACCTCTGGTTTCTAGG - Intronic
1028835945 7:95375170-95375192 CTTGGTGACAAATTGGTTATGGG - Intronic
1031663220 7:124453420-124453442 CTTGGTGGGTACTTGGTCCTTGG + Intergenic
1034026363 7:147708584-147708606 CTTGGGGCCCACTAGGTCCTAGG + Intronic
1036286706 8:7449135-7449157 GGTGGAGACCCCTTGGTCCTTGG + Intronic
1036334772 8:7862388-7862410 GGTGGAGACCCCTTGGTCCTTGG - Intronic
1038441891 8:27576419-27576441 CTTAGTAACCACTTGGTGCTAGG + Intergenic
1038977869 8:32721348-32721370 CTTGGTGTCAACTTGTTCTTTGG + Intronic
1042106557 8:65333606-65333628 CTTGGTATGCACTTGGTCCTTGG - Intergenic
1044618014 8:94162321-94162343 CTTGGTGACCACTTGGGTACAGG - Intronic
1046978408 8:120310023-120310045 CTTGCTGGCCCTTTGGTCCTCGG - Exonic
1049029262 8:140022269-140022291 CTTGGGGACCACTTAGACTTAGG + Intronic
1053645939 9:40119700-40119722 CATGGTGTCCACCTGGGCCTTGG - Intergenic
1053759779 9:41343840-41343862 CATGGTGTCCACCTGGGCCTTGG + Intergenic
1054326948 9:63717597-63717619 CATGGTGTCCACCTGGGCCTTGG - Intergenic
1054538633 9:66256276-66256298 CATGGTGTCCACCTGGGCCTTGG + Intergenic
1055096155 9:72416341-72416363 CTTGCTCATCACTTTGTCCTTGG + Intergenic
1059539366 9:115115373-115115395 CTTGGTGATCACGGGGACCTGGG + Intronic
1202793723 9_KI270719v1_random:103151-103173 CCTGGTGTCCACCTGGGCCTTGG - Intergenic
1192229145 X:69252796-69252818 CTTGCTGGGCCCTTGGTCCTGGG - Intergenic
1192788059 X:74354099-74354121 TGTGGTGACCAGTTGGTGCTGGG - Intergenic
1196950254 X:120869746-120869768 CTTGGTCACGACCAGGTCCTTGG + Intergenic