ID: 1161589529

View in Genome Browser
Species Human (GRCh38)
Location 19:5123023-5123045
Sequence AGTCCTAGTGCCCCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161589529_1161589531 -9 Left 1161589529 19:5123023-5123045 CCTGCTGGTGGGGCACTAGGACT 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1161589531 19:5123037-5123059 ACTAGGACTGTGCAGATGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 154
1161589529_1161589530 -10 Left 1161589529 19:5123023-5123045 CCTGCTGGTGGGGCACTAGGACT 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1161589530 19:5123036-5123058 CACTAGGACTGTGCAGATGCAGG 0: 1
1: 0
2: 0
3: 16
4: 158
1161589529_1161589533 21 Left 1161589529 19:5123023-5123045 CCTGCTGGTGGGGCACTAGGACT 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1161589533 19:5123067-5123089 AACTAACCAACCTCCATCGATGG 0: 1
1: 0
2: 0
3: 3
4: 58
1161589529_1161589536 27 Left 1161589529 19:5123023-5123045 CCTGCTGGTGGGGCACTAGGACT 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1161589536 19:5123073-5123095 CCAACCTCCATCGATGGAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 83
1161589529_1161589534 26 Left 1161589529 19:5123023-5123045 CCTGCTGGTGGGGCACTAGGACT 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1161589534 19:5123072-5123094 ACCAACCTCCATCGATGGAGAGG 0: 1
1: 0
2: 0
3: 0
4: 57
1161589529_1161589532 -4 Left 1161589529 19:5123023-5123045 CCTGCTGGTGGGGCACTAGGACT 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1161589532 19:5123042-5123064 GACTGTGCAGATGCAGGGACAGG 0: 1
1: 1
2: 6
3: 39
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161589529 Original CRISPR AGTCCTAGTGCCCCACCAGC AGG (reversed) Intronic
900438474 1:2642250-2642272 AGCCCTACCGCCCCACCGGCTGG + Intronic
900514758 1:3076324-3076346 AGCCCCAGGTCCCCACCAGCCGG - Intronic
901438747 1:9264827-9264849 AGTCCATGTACCACACCAGCTGG - Exonic
903125641 1:21245569-21245591 GCTCCTACTGCCCCACCTGCAGG + Intronic
906514256 1:46429555-46429577 AGTCCCTGTGGCACACCAGCTGG + Intergenic
914429837 1:147611378-147611400 AGTCCTAGTCACCCTCCAGCTGG + Intronic
919811318 1:201410555-201410577 AGTCCTAGGACCTTACCAGCTGG - Intronic
922536499 1:226384977-226384999 ACTGCTAGAACCCCACCAGCCGG + Intronic
923517933 1:234713170-234713192 AGGACTATTGCCCTACCAGCTGG - Intergenic
1062861753 10:815813-815835 AGACCTAGAGCCCTTCCAGCTGG + Intronic
1064296467 10:14083527-14083549 AGTCCTTAGGCCCCTCCAGCAGG + Intronic
1068677848 10:59786006-59786028 TGTGCCAGTGCCCGACCAGCAGG + Intergenic
1076726451 10:132416328-132416350 AGCCCCAGTTCTCCACCAGCCGG - Intronic
1078730085 11:13965496-13965518 AGTCCCAGTTCCCCACCTGCTGG - Intronic
1081545893 11:44071319-44071341 AGTCCTAGGGCCCCTCTAGGGGG + Intronic
1084215702 11:67645811-67645833 AGGCCTTGGGCCCCAGCAGCTGG + Exonic
1091771053 12:3151550-3151572 AGCCCCAGTGCCCACCCAGCTGG - Intronic
1092183348 12:6461238-6461260 AGGCCCAGTGCCCCATGAGCTGG - Intronic
1096217820 12:49808284-49808306 AGTCCTAGCCCCACTCCAGCTGG - Intronic
1102020522 12:109679026-109679048 ACCCCTAGTCCCCCACCAGGAGG - Intergenic
1108753138 13:53469173-53469195 AGTCCTAGTGACTGACTAGCAGG + Intergenic
1113987194 13:114327679-114327701 TGTCCTAGTTCCCCACCCGCTGG + Intergenic
1118896466 14:69949724-69949746 GGCCCGTGTGCCCCACCAGCAGG + Intronic
1119557722 14:75566440-75566462 AGTCCTGGTGGCACACAAGCTGG - Intergenic
1126521878 15:49605204-49605226 AGTCCATGGACCCCACCAGCTGG - Intronic
1128111128 15:65076884-65076906 AGCCACAGTGCTCCACCAGCAGG - Exonic
1128769500 15:70271249-70271271 ACTCCTAGTGACCCTCTAGCAGG + Intergenic
1130878455 15:88034056-88034078 AGACCTAGAGCCTCTCCAGCTGG + Intronic
1137580499 16:49630836-49630858 AAGCCCAGTGCCCCACCAGGAGG - Intronic
1141999967 16:87658683-87658705 AGTCCTCCTGCTCCACCTGCTGG - Intronic
1142182754 16:88679187-88679209 ATGCCCAGTGTCCCACCAGCAGG - Intronic
1148800173 17:50220206-50220228 AGAGCTAGTGACCCACCAGAAGG - Intergenic
1149446581 17:56717858-56717880 TGTCCTTCTGCCCTACCAGCTGG + Intergenic
1152308155 17:79533153-79533175 AGTCCCAGCTGCCCACCAGCTGG - Intergenic
1152878896 17:82804184-82804206 ATGCCTAATGCCCCACGAGCAGG - Intronic
1157621185 18:49018303-49018325 ACTCCTAGGGCCCCTTCAGCAGG + Intergenic
1158960570 18:62584520-62584542 TGTCCTCGTCCCCCACCAGGTGG - Intronic
1161589529 19:5123023-5123045 AGTCCTAGTGCCCCACCAGCAGG - Intronic
1162088013 19:8260098-8260120 AGCCCTGCAGCCCCACCAGCTGG - Intronic
1165049554 19:33132664-33132686 AGTCCTGGTTCCCCAGCAGGTGG - Intronic
1165101575 19:33441546-33441568 AGTCCTCCTTCCCCACCACCAGG + Intronic
1165738868 19:38193935-38193957 ACACCCAGTGCCCCACCATCAGG - Intronic
925045979 2:773581-773603 GGTGCCAGTGCCCCCCCAGCAGG + Intergenic
925868116 2:8246550-8246572 AGCCCTAGTGCCCCAGCAGGAGG + Intergenic
930041594 2:47129283-47129305 AGACCTAGTGAGACACCAGCTGG - Intronic
932304272 2:70690863-70690885 AGGCCATGTCCCCCACCAGCAGG + Exonic
938409993 2:131055646-131055668 TGTCCTGTTCCCCCACCAGCGGG - Exonic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947463694 2:230323730-230323752 AGTCCTTGTGCAGCACCAGGAGG - Intergenic
948683640 2:239656568-239656590 GGTCCTATTTCCCCAACAGCTGG + Intergenic
1179185577 21:39083161-39083183 AGTCCTCCTGCTCCTCCAGCTGG + Intergenic
1179707503 21:43190733-43190755 AGTCTGAGAGCCCCGCCAGCAGG - Intergenic
1180624985 22:17188432-17188454 TGTCCTCATGCCCCACCTGCAGG + Exonic
1180744541 22:18078505-18078527 AGTCCAGGTGCACCACCAGGAGG - Exonic
1181635603 22:24172976-24172998 TCTCCTGGGGCCCCACCAGCTGG - Intronic
1182304537 22:29358770-29358792 AGCCCTGGTCCTCCACCAGCTGG + Exonic
1185184874 22:49393047-49393069 AGTCCTAGAGCCACAGAAGCTGG + Intergenic
955123877 3:56089955-56089977 AGTACTCCTGCCCCACCACCTGG - Intronic
962240046 3:133744537-133744559 ATTCCTACTGCCCCTGCAGCAGG - Intergenic
963783398 3:149509538-149509560 AGTCCAAGCTCCCCACCACCTGG + Intergenic
963940402 3:151091175-151091197 AGCTGTAGAGCCCCACCAGCAGG + Intronic
964257571 3:154794564-154794586 AGTCCAAGTGCCTCACAAACAGG - Intergenic
967085981 3:186095827-186095849 AGTGTTACTTCCCCACCAGCTGG + Intronic
969570976 4:8008108-8008130 AGTCCTTGTCCCACAGCAGCGGG - Exonic
973242140 4:47968590-47968612 ACTCCTACTGCCCCAAGAGCAGG + Intronic
981727460 4:147862333-147862355 AGGCCCACTGCCCCACCAGCAGG - Intronic
997292631 5:132748278-132748300 ACTCCTGGTCCCCCAGCAGCAGG - Intronic
1000849949 5:166327919-166327941 AGTCCCTGTTCCCCACCAGCAGG - Intergenic
1006097707 6:31666187-31666209 AGTCCTGGTCCCCGTCCAGCCGG + Exonic
1006288268 6:33114390-33114412 AGTCCTCCTGTCACACCAGCTGG + Intergenic
1007389788 6:41544428-41544450 AGTCCTTGTGTCAGACCAGCTGG - Intergenic
1007406043 6:41637064-41637086 TGTCCTAGTGCCCCAGGAGCCGG - Intronic
1007631334 6:43275143-43275165 AGTCCTCGTGCCCTCCCGGCCGG - Intronic
1014066744 6:117135870-117135892 AGTCTTAGTTCCACTCCAGCAGG + Intergenic
1014189303 6:118474548-118474570 AGAACCAGTGCCCCACAAGCTGG - Intronic
1017815330 6:158012119-158012141 AGTCCGAGTGTCTCACCAGTGGG + Intronic
1019310392 7:357606-357628 AGCCCCAGGGCCCCACCCGCAGG - Intergenic
1020985543 7:15129628-15129650 AGTATTAGTGGCCCACCACCTGG + Intergenic
1022830811 7:34064619-34064641 CCTCCCAGTGCCCCTCCAGCTGG - Intronic
1023805929 7:43872989-43873011 AGCCCTTGTGCCTCACCAGAAGG - Intronic
1034431225 7:151042133-151042155 TGTCCCAGTGCCTCACCACCTGG - Intronic
1041102594 8:54411631-54411653 AGTGCTAGTGTCCCAACATCAGG - Intergenic
1049695701 8:143983446-143983468 AGGCCGAGTGCACCACCAGCTGG + Exonic
1051376771 9:16410143-16410165 AGGCCTAGTCCATCACCAGCAGG + Exonic
1060939279 9:127534462-127534484 AGTCCTGGGTCCCCACCAGGAGG + Intronic
1062041002 9:134404288-134404310 ACTCCTATTCCCCCACCAGGAGG - Intronic
1191116809 X:56861066-56861088 AGACCTAGTGAGACACCAGCTGG - Intergenic