ID: 1161589816

View in Genome Browser
Species Human (GRCh38)
Location 19:5124281-5124303
Sequence TCCTCCCCAGGCCGGCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161589810_1161589816 10 Left 1161589810 19:5124248-5124270 CCCTTCAGGAGGGCAGAGATAAG No data
Right 1161589816 19:5124281-5124303 TCCTCCCCAGGCCGGCGCGGTGG No data
1161589806_1161589816 23 Left 1161589806 19:5124235-5124257 CCGCCTTGATGGACCCTTCAGGA No data
Right 1161589816 19:5124281-5124303 TCCTCCCCAGGCCGGCGCGGTGG No data
1161589811_1161589816 9 Left 1161589811 19:5124249-5124271 CCTTCAGGAGGGCAGAGATAAGA No data
Right 1161589816 19:5124281-5124303 TCCTCCCCAGGCCGGCGCGGTGG No data
1161589808_1161589816 20 Left 1161589808 19:5124238-5124260 CCTTGATGGACCCTTCAGGAGGG No data
Right 1161589816 19:5124281-5124303 TCCTCCCCAGGCCGGCGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161589816 Original CRISPR TCCTCCCCAGGCCGGCGCGG TGG Intronic