ID: 1161592928

View in Genome Browser
Species Human (GRCh38)
Location 19:5136832-5136854
Sequence CTGGGTCTGGAAATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 523}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161592928_1161592941 14 Left 1161592928 19:5136832-5136854 CCTTTCCCCATTTCCAGACCCAG 0: 1
1: 0
2: 2
3: 52
4: 523
Right 1161592941 19:5136869-5136891 GTGAGTCTCCCTTGCGGCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 88
1161592928_1161592939 8 Left 1161592928 19:5136832-5136854 CCTTTCCCCATTTCCAGACCCAG 0: 1
1: 0
2: 2
3: 52
4: 523
Right 1161592939 19:5136863-5136885 CCCACAGTGAGTCTCCCTTGCGG 0: 1
1: 0
2: 0
3: 29
4: 329
1161592928_1161592944 23 Left 1161592928 19:5136832-5136854 CCTTTCCCCATTTCCAGACCCAG 0: 1
1: 0
2: 2
3: 52
4: 523
Right 1161592944 19:5136878-5136900 CCTTGCGGCTTTGGCCTTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161592928 Original CRISPR CTGGGTCTGGAAATGGGGAA AGG (reversed) Intronic
900102751 1:969003-969025 TGGGGGCTGGAAATGGGCAACGG + Intronic
900234756 1:1582925-1582947 CTGGGCCTGGAACTGGGGCTGGG - Intergenic
900695635 1:4008128-4008150 CTGGGGCTGGAAACAGGGACAGG - Intergenic
900829049 1:4950939-4950961 CTGGGTCTTCAATTTGGGAAAGG + Intergenic
901484283 1:9547698-9547720 TTGGGTTTTGAAATGGGGGAGGG - Intronic
901842165 1:11960623-11960645 CTGGGGTTGGGGATGGGGAAGGG - Intronic
902091118 1:13904030-13904052 ATGTGTCAGGAAATGTGGAAAGG + Intergenic
902528755 1:17076879-17076901 GGGGGTCTAGAAATGAGGAAGGG - Intronic
902551031 1:17219786-17219808 CTGGGCCTGGAGGTGGGCAAGGG - Intronic
902902814 1:19531728-19531750 GTGGGTCAGGAAATTGGGAGTGG - Intergenic
903000952 1:20265433-20265455 CTGGGAGTGGAACTGGGGCAAGG - Intergenic
903137835 1:21320960-21320982 CCTGGTTTGGAAAAGGGGAAAGG + Intronic
903572144 1:24313864-24313886 CTGGGGCTGGAAATGGGAAGTGG + Intergenic
904014264 1:27407987-27408009 CAGGGCCTGAAAATGGGGAGAGG + Exonic
904370440 1:30044583-30044605 CTGGGGCTGGGAGTGGGGCAGGG + Intergenic
904751258 1:32742357-32742379 CTGGGTCTGGAAACTGCGGAAGG - Intronic
904941519 1:34167081-34167103 CTGAGTCTGGACAATGGGAAGGG - Intronic
905465605 1:38150980-38151002 CTGGGGCGGGAATTGGGGGAGGG - Intergenic
905828363 1:41044654-41044676 ATCTGTCTGAAAATGGGGAAGGG + Intronic
905994736 1:42371896-42371918 CTGGGTCTTGAAGTGTGGACAGG + Intergenic
906212430 1:44019636-44019658 CTGGCTCTGGCCATGGGGACAGG + Intronic
906521881 1:46471886-46471908 CTGGTTCTGCAAATGGTGACAGG + Intergenic
907526403 1:55056514-55056536 CTGGGGATGGAGATGGGGAGGGG - Intronic
907657652 1:56360451-56360473 CTAGGTCAGGAATTGGGAAAGGG + Intergenic
908380312 1:63592030-63592052 CTGGTTTTGGAATTGGGGAAGGG + Intronic
910643483 1:89489388-89489410 CTGGGGCTTGGAATGGGGGAAGG - Intergenic
910837841 1:91533691-91533713 CTTGGTCGGGAGCTGGGGAAAGG + Intergenic
911661917 1:100510893-100510915 CTGGCTCTGGAGATCAGGAAGGG - Intronic
912513738 1:110205464-110205486 ATGGGTCAGGAAATAAGGAAGGG - Intergenic
912759269 1:112352386-112352408 CTGAGTCTGGAAGTGGTGAGAGG - Intergenic
913254895 1:116944562-116944584 CCGGGTCTTGGAATGGGAAAGGG + Intronic
913257945 1:116972253-116972275 CTGTTCCAGGAAATGGGGAAAGG - Intronic
914420856 1:147527184-147527206 CCTGGTCTGGAAGTGGTGAAGGG + Intergenic
915534611 1:156527755-156527777 CTGTGTCAGGGCATGGGGAAAGG + Intronic
915604807 1:156943798-156943820 CTGGGTCAGGACAGGAGGAAAGG + Intronic
916078635 1:161218224-161218246 TTGGATCTGGAATGGGGGAAAGG - Exonic
916262042 1:162851692-162851714 ATGGGGGAGGAAATGGGGAAGGG + Intronic
916267045 1:162901009-162901031 CTGGCTTTGGAGATGGAGAAAGG - Intergenic
918612021 1:186503856-186503878 CAGGGTCTGAGAATGGGGAAAGG + Intergenic
920047105 1:203140426-203140448 CTGTTTCTGGGGATGGGGAAGGG + Intronic
920335743 1:205244045-205244067 CTGGGTTTGGAAATGTGCACAGG + Intronic
920442198 1:205988839-205988861 CCGGGTGTGGACATGGAGAAGGG - Intronic
920684095 1:208095978-208096000 CTGGGTCTGGATGTGGGTATGGG - Intronic
920711565 1:208300476-208300498 CTCCTTGTGGAAATGGGGAATGG - Intergenic
920987180 1:210901654-210901676 CAGGGGCTGGAGATGGGGCATGG + Intronic
921518522 1:216128902-216128924 CTGGGGAAGGAAATGGGGAGGGG - Intronic
921693177 1:218176727-218176749 CTGGGTCAGGAACTGGGGAAGGG - Intergenic
923349045 1:233085904-233085926 ATGGGTCAGGAATTTGGGAAGGG - Intronic
923362655 1:233226804-233226826 CTGGGTGTGGGCATGGGGAGAGG - Intronic
923405356 1:233653921-233653943 GTGGCTTTGGAAATGGGTAATGG + Intronic
1063424776 10:5942456-5942478 CTGTTTCTGGAGGTGGGGAAGGG - Intronic
1063588005 10:7370233-7370255 CTGTGTCTAGAAAGTGGGAAGGG - Intronic
1063596742 10:7442278-7442300 CTGGGCCTGGAGACGGGGCAGGG - Intergenic
1063860983 10:10307502-10307524 CTGGGTCTGACAAAGGGGACAGG - Intergenic
1064801256 10:19075479-19075501 CTGGCTTTGGAAATGAAGAAAGG + Intronic
1065420007 10:25532639-25532661 CTGGCTCTTAAAATGGGGAATGG - Intronic
1066001965 10:31112939-31112961 CTTGCTCTGGAAATGAAGAAAGG + Intergenic
1066098286 10:32094061-32094083 CTAGGTAAGGAAATGGGGAAGGG + Intergenic
1067081919 10:43216964-43216986 CAGGGTCAGAAGATGGGGAAGGG - Intronic
1067229728 10:44397720-44397742 CTGGGGCAGGGAATGGGGGAGGG + Intergenic
1067317247 10:45180334-45180356 CTGGGGCTGGGGCTGGGGAAGGG + Intergenic
1067799689 10:49350487-49350509 GTGGGTCAGGAATTTGGGAATGG - Intergenic
1068181661 10:53527480-53527502 CTGGGTCTGGAAAGGAAGGAAGG + Intergenic
1068286159 10:54938868-54938890 CTGGCTTTGAAAATGGAGAAAGG + Intronic
1068758846 10:60684493-60684515 TTGCAGCTGGAAATGGGGAATGG + Intronic
1068971053 10:62958838-62958860 AGGGGTCAGGAAATGGGGAGGGG + Intergenic
1069185727 10:65420268-65420290 CTGGATCTGGAAATGAAGGAAGG - Intergenic
1069862694 10:71481377-71481399 GGGAGTCAGGAAATGGGGAAAGG + Intronic
1070161287 10:73868163-73868185 CTGAGACTGGAGATAGGGAAGGG - Intronic
1070448916 10:76537572-76537594 CTGGCTCTGAAAATGGAGGAAGG - Intronic
1070551083 10:77491301-77491323 CTGGATCTGGAACTGGGGCCTGG + Intronic
1072067399 10:91884339-91884361 CAGGGTCTTTAAATGGGAAACGG - Intergenic
1072181268 10:92983294-92983316 CTGGGAGTGGAAATGGGGAAAGG - Intronic
1072296118 10:94010963-94010985 GTGGCTTTGGAAATGGGAAATGG - Intronic
1072306889 10:94116334-94116356 CTGATTTTGGAAATGGGAAAAGG + Intronic
1073127147 10:101158434-101158456 GTGGGGGTGGAGATGGGGAAAGG - Intergenic
1073179703 10:101576226-101576248 CTGGCTTTGAAGATGGGGAAAGG - Intronic
1073353484 10:102836008-102836030 CAGGGTCAGGAAATGGAAAAGGG - Intronic
1073555625 10:104448018-104448040 CTCTTTCTGGAAATGGAGAATGG - Intronic
1074186333 10:111102277-111102299 CTGAGGCTGGAAAGGTGGAAAGG + Intergenic
1074462837 10:113654096-113654118 ATTGGACTGGATATGGGGAAGGG - Exonic
1074702654 10:116106085-116106107 CTGGTTCTGAAAATGGAGGAAGG + Intronic
1075737943 10:124675572-124675594 CTGTGTCTGTAAAATGGGAATGG - Intronic
1075875827 10:125804857-125804879 CTGGGGCTGGAGGTGGGGTAGGG - Intronic
1076231420 10:128822844-128822866 CAGGGTCTAGGAATGGGGATGGG - Intergenic
1076579855 10:131499995-131500017 CAGGGACCTGAAATGGGGAAGGG - Intergenic
1077907111 11:6543272-6543294 CTAGGGCTGGAAATGAGGTAGGG - Intronic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079027593 11:16961198-16961220 CTGGGACTGGGGATGGGGACAGG - Intronic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1080614603 11:33935136-33935158 CTGTGTCTGGAAAGGGGTAAAGG - Intergenic
1081769559 11:45640453-45640475 CAAGGGCTGGGAATGGGGAAAGG + Intergenic
1083311762 11:61787422-61787444 ATGGGTCCAGAAATGGGAAAGGG + Exonic
1083387786 11:62324731-62324753 CTGGCTCTGGAAGTGGGCAGCGG - Intergenic
1083971963 11:66083498-66083520 CTTGGGCTGGAAATGGGTCATGG + Intronic
1084320389 11:68370289-68370311 CTGGGCCTGGACATGGAGACTGG - Intronic
1085304233 11:75476150-75476172 CTGGATCTGGACCTGGGCAATGG - Intronic
1085369537 11:75987589-75987611 CTGAGACTGGAAATGAGAAAAGG - Intronic
1085682499 11:78590863-78590885 CAGGGTCTGGTTATGAGGAATGG + Intergenic
1087422133 11:97942837-97942859 GTGGCTTTGGAAATGGGAAATGG + Intergenic
1088516175 11:110636871-110636893 TAGAGTATGGAAATGGGGAAAGG + Intronic
1088606865 11:111541035-111541057 CTGCGTCTGGGAGTGGGGCATGG - Intronic
1089019267 11:115195543-115195565 CTGGGCCTAGAAATGTTGAAAGG - Intronic
1089199409 11:116714790-116714812 CTGAGTGTGGAGAGGGGGAAAGG + Intergenic
1089215659 11:116833096-116833118 CTGTGTCTGGGCATGGGAAAGGG + Intergenic
1089287719 11:117418316-117418338 CTAGGCCTGGAAAGGGGCAAAGG + Intergenic
1089643159 11:119860857-119860879 CAGGGTCTAGAAGTGGGGCATGG - Intergenic
1090840853 11:130486667-130486689 CAGGGCCTGGAACTGGGGATTGG - Intergenic
1091014995 11:132042323-132042345 CTGGGACTGGAAATGCCCAAGGG + Intronic
1091392811 12:136250-136272 CCAGGTTTGGGAATGGGGAATGG + Intronic
1091558243 12:1592526-1592548 CTGTGACTGGAAATGGGGGTGGG - Intronic
1091646098 12:2273562-2273584 CTGGTTTTGGAGATGGGGAGAGG + Intronic
1091756757 12:3058171-3058193 CTGGGTCTGGGAGTGGGGCCTGG + Intergenic
1091846237 12:3658214-3658236 CTGGGCCAGGGCATGGGGAATGG - Intronic
1092132497 12:6122625-6122647 CTGGGTCTGCAAATGGCGGGAGG - Intronic
1094238287 12:28192672-28192694 CTGGGTATGGGAATAGGGCAGGG - Intronic
1096571488 12:52525999-52526021 CTGAGGGAGGAAATGGGGAAGGG - Intergenic
1096616857 12:52838181-52838203 CTGGGTCTGGAAAGCGAGAATGG + Intronic
1096741484 12:53696941-53696963 CTGGATCTTGAAATGGAGGAGGG - Intergenic
1097247150 12:57612875-57612897 CTGAGTCTGGAGCTGGGGCAAGG + Intronic
1098006167 12:65999123-65999145 CTGAGGGTGGAAATGTGGAAGGG - Intergenic
1098193848 12:67978483-67978505 CTGGGTATGGAAACAGGGGATGG + Intergenic
1098451304 12:70621168-70621190 CTGGGCGTGGAAAATGGGAAAGG - Intronic
1100323584 12:93519981-93520003 CTCAGACTGGAAATGGGGAACGG - Intergenic
1100393703 12:94166038-94166060 CAGTGTCTGGCAATAGGGAATGG + Intronic
1101308846 12:103557723-103557745 ACGGGTAGGGAAATGGGGAAGGG - Intergenic
1101320587 12:103669782-103669804 CTGGGTCTGGGATGGGGGATGGG + Intronic
1102488822 12:113276619-113276641 CTGTAGCTGGAACTGGGGAAAGG + Intronic
1103004470 12:117409787-117409809 CTTTGTCTGGAAATGGACAAGGG - Intronic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1107213329 13:37885540-37885562 CTAGAGCTTGAAATGGGGAAGGG - Intergenic
1107655673 13:42590120-42590142 CTGGGGCTGGAAATGTAGAAAGG - Intronic
1108268277 13:48733696-48733718 CTGGCTTTGAAAATGGAGAAGGG + Intergenic
1108339342 13:49482014-49482036 GTGGATCTGTAAATGGGGAGTGG - Intronic
1108699524 13:52932081-52932103 TTTGGCCTGGAAAAGGGGAAAGG + Intergenic
1108701708 13:52949452-52949474 TAGAGTCTGGAGATGGGGAAGGG + Intergenic
1111182358 13:84685781-84685803 ATGGCTCTGGAATTGGGTAATGG + Intergenic
1111843024 13:93473435-93473457 CAGGCACTGGGAATGGGGAAAGG + Intronic
1112537259 13:100271547-100271569 CTTGGCCAGAAAATGGGGAAGGG + Intronic
1112822142 13:103349911-103349933 GTCTGCCTGGAAATGGGGAAGGG + Intergenic
1113807475 13:113118175-113118197 CTGGGTGTTGAGGTGGGGAAGGG - Intronic
1114473439 14:22979254-22979276 ATGGGCCTGGAATTGGGGAGTGG - Intronic
1114799514 14:25757563-25757585 CTGGGGCTGGAAAGCAGGAAGGG - Intergenic
1114965703 14:27956616-27956638 CTGGGTCTGCAAACTGGGAATGG + Intergenic
1115175702 14:30559269-30559291 CTTGGTGAGTAAATGGGGAACGG + Exonic
1115718471 14:36132645-36132667 CTGGGAAAGGAAGTGGGGAAGGG - Intergenic
1116178645 14:41507552-41507574 CTGGGTCAGGAATTTGGAAAAGG - Intergenic
1117022866 14:51589633-51589655 CTGGTTCTGGAATTGGGGACAGG + Intronic
1118810178 14:69267421-69267443 ATGGGTCTGGAAAAGTGGAAAGG - Intronic
1119642636 14:76326738-76326760 CTGGGTCCTGAAATTGGGAGAGG - Intronic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1120287312 14:82520342-82520364 CTGTGTCTTTAAATGGTGAAAGG - Intergenic
1121326088 14:93020315-93020337 CAGGATCTGGAACTGGGGAGGGG + Intronic
1121528106 14:94633453-94633475 CTGGGTCTGGAGTTGAGGATGGG + Intergenic
1122135773 14:99632010-99632032 CTGGGAGTGGACATGGGGCAGGG + Intergenic
1122473165 14:101986024-101986046 CTGGGTCTGGTATTCGCGAATGG - Exonic
1202878684 14_KI270722v1_random:35983-36005 CTGCTTCTGGAACTGGGAAAGGG - Intergenic
1124173251 15:27396934-27396956 CTGGGGCTGGAAAATGGGGAGGG + Intronic
1124412342 15:29446828-29446850 CTGGCTCTGGAAGTCAGGAATGG - Intronic
1125532592 15:40423331-40423353 CTGGGAGTGGGAATGGGGATAGG - Intronic
1125888649 15:43249180-43249202 CTGGGGTTGGAAGTGGGGTAGGG - Intronic
1126494365 15:49274051-49274073 CTCTGGCAGGAAATGGGGAAGGG - Intronic
1128317447 15:66670041-66670063 CTGGGTCTGGGGATTGGGGATGG + Intronic
1128582359 15:68818826-68818848 CTGGGTGTGGTGATGGGGGAGGG - Intronic
1130035902 15:80361256-80361278 CTGGGTCAGGAAAAGGGATAGGG + Intronic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1131789238 15:95946402-95946424 CTGGTTCTGGAAAAGAGGAAGGG + Intergenic
1131804710 15:96109271-96109293 ATGGGGCAGGAAGTGGGGAAAGG + Intergenic
1131873825 15:96784323-96784345 CAGGTTCAGGAAATGGAGAAGGG - Intronic
1132562945 16:606724-606746 CTGGCTCTGCAGATGGGCAAGGG - Intronic
1133632429 16:7633934-7633956 CTGTTGCAGGAAATGGGGAATGG - Intronic
1133857474 16:9563307-9563329 CTGGGGCTGGGGATGGGAAAAGG + Intergenic
1134240968 16:12506382-12506404 CTTGGTCTGGAAATGGGAAGTGG + Intronic
1135878599 16:26229611-26229633 ATGGGTCTGGGAGTGGGGATGGG + Intergenic
1135951115 16:26915203-26915225 CTGGGTGTGGTAATAGGGAGGGG - Intergenic
1137033472 16:35546675-35546697 ATGGGCTAGGAAATGGGGAAAGG + Intergenic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1137549192 16:49425278-49425300 CTGGTGGTGGAAGTGGGGAAGGG - Intergenic
1137626615 16:49912822-49912844 CTGGGTGTGGTCTTGGGGAAAGG - Intergenic
1138061257 16:53892975-53892997 CTGGGACAGGAAATGGGAAGTGG - Intronic
1138441510 16:57037729-57037751 CTGGGTCTGTGAGTGGGGTAGGG - Intronic
1138562489 16:57810209-57810231 CTGGGTGGGGAGATGGGGACAGG + Intronic
1139526288 16:67518721-67518743 CTGAGTCTGGGAATTGGGCAGGG + Intronic
1139647334 16:68341076-68341098 CTGCATCTGGGAATGGGGACTGG + Intronic
1139828980 16:69781274-69781296 AGGGGTGTGGAAATGGGGGAAGG + Intronic
1140045840 16:71440185-71440207 CAGGGACTGGCAAAGGGGAATGG + Intergenic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1140663779 16:77211456-77211478 CTGGGTGTGGCAGTGGGGCATGG - Intronic
1140999038 16:80290543-80290565 CTTGGTCTGTAACTGGGAAAGGG - Intergenic
1141225569 16:82111577-82111599 CTGGGGTTGGGAATGGGGAGGGG + Intergenic
1142482962 17:229819-229841 GTGGGTCTGGAAAGGGAGAAAGG + Intronic
1143273975 17:5696254-5696276 CTGGGTCTGGAGATCTGCAAGGG + Intergenic
1144276841 17:13678297-13678319 GTTGGTGTGGATATGGGGAAAGG + Intergenic
1144312650 17:14026928-14026950 CTGGGGCTAGAAATTAGGAAGGG + Intergenic
1144332105 17:14234397-14234419 CTGGGGCTAGAAATTAGGAAGGG - Intergenic
1144754261 17:17669774-17669796 CTGGGGCAGGGAGTGGGGAAGGG - Intergenic
1145866946 17:28247719-28247741 CTGGGGCTGGAGATGGGGCTTGG - Intergenic
1146243200 17:31249870-31249892 GTGGGTCTGGAATTTGGGATAGG + Intronic
1146496451 17:33326881-33326903 ATGGGTCTGGAAGAAGGGAATGG - Intronic
1146553628 17:33804067-33804089 CTGGGTGTTCAAATAGGGAAAGG - Intronic
1146608761 17:34286130-34286152 CAGTGTTTGGGAATGGGGAATGG + Intronic
1147453281 17:40519321-40519343 CTGTGACTGGAAATGGGGCCGGG + Intergenic
1148082063 17:44972355-44972377 CTGGGTTTGGGAGTGAGGAAGGG + Intergenic
1148219788 17:45853265-45853287 CTGGGTCTGGACCTGGGGGTGGG - Intergenic
1148441109 17:47711955-47711977 CAGGGAGTGGAAATGGGGAAGGG + Exonic
1148460863 17:47838336-47838358 CTGAGTCTGGAATCGGGGCAGGG + Exonic
1150575817 17:66430217-66430239 CAGGGACTTGAAATGGGGAAAGG - Intronic
1151013925 17:70532204-70532226 CTGGCTTTGGAAATGGGTAAGGG - Intergenic
1151334445 17:73431768-73431790 CTGGCTCTGGAAATGCTGGAAGG + Intronic
1151573834 17:74941376-74941398 CAGGGGCTGGAGATGGAGAAAGG - Intronic
1151788717 17:76290130-76290152 CAGGGGCTGGAAATGGAGATTGG - Intronic
1152740644 17:82016965-82016987 CAGGGGCTGGCAATGGGGAAGGG - Exonic
1152972646 18:178762-178784 CTAGGACTGGAGATGGGGAGAGG - Intronic
1153003336 18:475839-475861 CTGGGTTTGGAAGGAGGGAACGG + Intronic
1153117665 18:1679135-1679157 CTGGCTTTGAAGATGGGGAAAGG - Intergenic
1154127486 18:11704585-11704607 CTGGGTCTGGAAACTGGGGAGGG - Intronic
1156336613 18:36178336-36178358 CAGGGGCTGGGAATGGGGAGAGG + Intronic
1157481631 18:48058947-48058969 CTGGGACTGGAGGTGGGGACAGG - Intronic
1158077900 18:53552552-53552574 CTGGGACTCCAAATGGGGCAAGG + Intergenic
1158302160 18:56064364-56064386 CAGGCTCTGGCCATGGGGAAAGG + Intergenic
1160863107 19:1245876-1245898 CTGGGGCTGGAACTGGGGGCGGG - Intergenic
1160864677 19:1251421-1251443 CTGGATCTGGAAGCCGGGAAGGG + Intronic
1161149954 19:2702466-2702488 CTGGGGTTGGAATTGGGGACGGG - Intronic
1161228520 19:3160098-3160120 GTGGGTCAGGAATTTGGGAAAGG + Intronic
1161439389 19:4281902-4281924 CCTTGTCTGGAAAAGGGGAATGG + Intronic
1161592928 19:5136832-5136854 CTGGGTCTGGAAATGGGGAAAGG - Intronic
1162010720 19:7812874-7812896 CTGAGTATTTAAATGGGGAAAGG + Intergenic
1162393452 19:10403335-10403357 CGGGGTCCGGGAGTGGGGAAAGG + Intronic
1162807178 19:13144134-13144156 CTGGAACTGGAAATGGAGACAGG + Exonic
1162927652 19:13938279-13938301 ATGGGTCTGGAGATGGGGGGCGG - Exonic
1163514746 19:17756054-17756076 CAGGGCCTGCAACTGGGGAAGGG - Intronic
1163691989 19:18743214-18743236 CGGGGTCTGCTGATGGGGAATGG - Intronic
1164305291 19:24000770-24000792 CTGGGGCTTGAAATGGGGCTGGG - Intergenic
1164619033 19:29682806-29682828 CTGGCTCTAGAAATGGGCACAGG + Intergenic
1164857387 19:31535709-31535731 CTGGGAAGGGAAATGGAGAATGG + Intergenic
1166093427 19:40524946-40524968 CTGGGTCTGGAAGATGAGAAAGG - Intronic
1166117922 19:40667193-40667215 CTGTGTCTGGGGTTGGGGAAGGG + Exonic
1166749937 19:45159805-45159827 CAGGGTTTGGAAACGGGGCAGGG + Intronic
1167043941 19:47039261-47039283 CTGGGTCTGGGAATGGGACTGGG + Intronic
1167166391 19:47802692-47802714 CTGGGCCTGGGATTGGGGCAGGG + Exonic
1167267951 19:48492921-48492943 CAGGGCCTGGCAATGGGGCAGGG - Intronic
1167567067 19:50263289-50263311 CTGGGTGGGGAAATGGGTGAGGG - Intronic
1167579393 19:50332868-50332890 CAGGCCCTGGAATTGGGGAAGGG + Intronic
1167664382 19:50815308-50815330 CTGGGGCTGAGAATGGGGAATGG + Intergenic
1167831196 19:52024113-52024135 ATAGGTCAGGTAATGGGGAAGGG - Intronic
1168143455 19:54405006-54405028 CTGGGCCTGGAAAGGAAGAAGGG + Intergenic
1168284955 19:55326581-55326603 CTGGGTCTGACACTGGAGAAAGG + Intronic
1168452051 19:56474243-56474265 CTGGGTATTGAATTGGGGGAGGG + Intronic
1168495347 19:56843220-56843242 CTGTTTATAGAAATGGGGAAAGG - Intergenic
1202654306 1_KI270708v1_random:5017-5039 CTGCTTCTGGAACTGGGAAAGGG - Intergenic
925041593 2:735342-735364 GTGGCTCTGGAAGTGAGGAAGGG + Intergenic
926763722 2:16303806-16303828 CTTGGACTAAAAATGGGGAAAGG - Intergenic
926796941 2:16627083-16627105 GTGGGACAGGACATGGGGAAAGG - Intronic
926982838 2:18590063-18590085 CTGAGTCTAGCCATGGGGAAGGG - Intergenic
927448057 2:23183215-23183237 CTGGGTTTAGAGATTGGGAAGGG - Intergenic
928089008 2:28362911-28362933 CAGGGTCTGGAGATGGGGAGTGG - Intergenic
929458870 2:42086526-42086548 TTGGGTCTGGATTTGGGGAGGGG - Intergenic
930725923 2:54681354-54681376 CTGGCTTTGAATATGGGGAAGGG - Intergenic
930918363 2:56721313-56721335 CCGTATGTGGAAATGGGGAAAGG + Intergenic
931528555 2:63186352-63186374 CTGGGACTGGAGGTGGGGAAGGG - Intronic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932330231 2:70894520-70894542 CTGGTTCAGGAAATGAGAAATGG - Intergenic
935038051 2:99398106-99398128 CTGGTTCTTGTAATGGGCAATGG + Intronic
935341474 2:102063413-102063435 CTGGGGCTGGAACTAGGGGAAGG - Intergenic
937083186 2:119154835-119154857 CTAGGTCTGGAACTGGGGGAGGG + Intergenic
937730981 2:125228884-125228906 CTGTTTCTTGATATGGGGAAAGG - Intergenic
937944376 2:127319070-127319092 CAAGGCCTGGAAAAGGGGAATGG + Intronic
938093371 2:128447378-128447400 CTGGGTCTGGAGCTGGGCAAAGG + Intergenic
938168764 2:129056702-129056724 CTGGCAGTGGAAATGGGGGAGGG - Intergenic
938781008 2:134584920-134584942 CTGGGTCTGGAGCTGGGCATTGG - Intronic
940295658 2:152121495-152121517 CTGGATTGGGAGATGGGGAAGGG - Intronic
940611705 2:156000645-156000667 ATGGGTCAGAAAATGTGGAAAGG - Intergenic
941475825 2:165951068-165951090 GGGGGTCTGGAGATGGGGTATGG - Intronic
942187123 2:173434463-173434485 ATGGGTCTGGAAGTGGGTACCGG + Intergenic
944273863 2:197813140-197813162 CTGGTTCAGGAAAAGGGTAATGG + Intronic
944454072 2:199875598-199875620 ATGGGTTTGGGAATGGGGATTGG - Intergenic
944476665 2:200113430-200113452 GTGGGTCAGGGGATGGGGAAGGG - Intergenic
944733409 2:202537749-202537771 TTGGATATGGAAATGGGGAGAGG + Intronic
944862514 2:203828512-203828534 CTGGCTTTGAAAATGGAGAAAGG - Intergenic
946452370 2:219791775-219791797 GTGGGTCAGGAATTTGGGAAAGG - Intergenic
947659403 2:231855474-231855496 CTGGGGCTGGAGTTGGGGACCGG + Intergenic
947838377 2:233191022-233191044 CTGGGCCTGGGATTGGGGAAAGG + Intronic
947899664 2:233711104-233711126 CAGGGTCTGGAGATGAGGAGGGG - Intronic
947900362 2:233716888-233716910 CAGGGTCTGGAGATGAGGAGGGG - Intronic
947901764 2:233727258-233727280 CAGGGTCTGGAGATGAGGAGGGG - Intronic
948021352 2:234736318-234736340 CTGGGCCTGGAGTAGGGGAAGGG - Intergenic
948969699 2:241415438-241415460 CAGGGGCTGGACATGAGGAAGGG + Intronic
1168759777 20:342107-342129 GTGGGTCAGGAATTTGGGAAGGG - Intergenic
1168849215 20:965236-965258 CTGGGTCTTGAAGTGGGGGTGGG + Intronic
1169410708 20:5367380-5367402 GTGGGTGGGGAAATAGGGAATGG + Intergenic
1169551743 20:6708204-6708226 CTGGGTCAGGAATTTGGGCAGGG - Intergenic
1170428706 20:16258948-16258970 GTGTGTTTGGAATTGGGGAAGGG - Intergenic
1170446550 20:16433954-16433976 CTGTGTCTGGAGTTGGGGGAGGG - Intronic
1171164076 20:22955406-22955428 CTGGGTTTGGAAGAGGGGACTGG + Intergenic
1171187060 20:23130112-23130134 CTGGGCCAGGAACTGGGAAATGG - Intergenic
1171205830 20:23280196-23280218 CTGGGTCTGGAGATGGAAACAGG - Intergenic
1171543492 20:25984243-25984265 CTGGGTCTGGATCTGGGGCTGGG + Intergenic
1171933096 20:31246333-31246355 CTGGGTCTCAACTTGGGGAAGGG - Intergenic
1172033149 20:31995550-31995572 TTGGCTCTGGCAACGGGGAAGGG - Intronic
1172339290 20:34143579-34143601 CTTGCTCTGGAATGGGGGAAGGG - Intergenic
1172483745 20:35286763-35286785 CTGGGTCTGGGGATGAGAAACGG - Exonic
1172780995 20:37437087-37437109 CTGGGTCTGGGAGTGGGGGTGGG - Intergenic
1172893888 20:38286121-38286143 TTGGCACTGGAAATGGTGAAGGG + Intronic
1173325387 20:42028130-42028152 ATGGGTAGGGAAGTGGGGAAGGG + Intergenic
1173474917 20:43352152-43352174 CAGGCTCTGGAGATAGGGAAAGG + Intergenic
1173706284 20:45112344-45112366 CTGGGGCTGGCCTTGGGGAATGG + Intronic
1173930866 20:46817221-46817243 ATGGGTCTGGGGAGGGGGAAAGG + Intergenic
1174500735 20:50982195-50982217 CTGGGGCTGGGATTGGGGCAAGG + Intergenic
1174702810 20:52626091-52626113 CTGGGTCAGGAATTAGGAAAGGG + Intergenic
1174848167 20:53964286-53964308 CTGGGTGTGGCAATAGGGAGTGG + Intronic
1175529239 20:59662768-59662790 CCTGGGCTGGAAATGGGGAGTGG + Intronic
1175725334 20:61314270-61314292 CTGGGGCTGGGAGTGGGGAGAGG - Intronic
1175994995 20:62808033-62808055 CTGGCTGGCGAAATGGGGAAGGG + Intronic
1176265294 20:64206134-64206156 GTGTGTCTGTAAGTGGGGAAGGG + Intronic
1178349541 21:31862727-31862749 GTGGGTCTGGAATTTGGGAGTGG - Intergenic
1180031679 21:45213559-45213581 CTGGGGATGGGAATGGGGATCGG - Intronic
1180416751 22:12725065-12725087 CTGCTTCTGGAACTGGGAAAGGG - Intergenic
1180798775 22:18621612-18621634 CTGGGGCAGGAAATGGGCACTGG - Intergenic
1181222941 22:21373650-21373672 CTGGGGCAGGAAATGGGCACTGG + Intergenic
1181255800 22:21561970-21561992 CTGGGGCAGGAAATGGGCACTGG - Intronic
1181850852 22:25749003-25749025 CTGGGCGTGGAAAGAGGGAATGG - Intronic
1183498231 22:38162774-38162796 CTGGGCCTGGAGGTGGGGTAGGG - Intronic
1183669139 22:39262088-39262110 GTGGGTCAGGAATTTGGGAAGGG - Intergenic
1183991283 22:41598619-41598641 CTGGATCTGGAAGAGGAGAAAGG + Exonic
1184295456 22:43521293-43521315 TTGGGTTTGGAGATGGGAAATGG - Intergenic
1184651321 22:45920622-45920644 CTGGTTCGGGAGATGGGGGATGG + Exonic
1184989483 22:48157232-48157254 CTGGGTCTGGAAGGGTGGAGAGG + Intergenic
1185224305 22:49644174-49644196 GTGGGTCTGGAGATGGGGGTGGG + Intronic
949323018 3:2832635-2832657 ATGAGTATGGACATGGGGAAGGG + Intronic
949609605 3:5690939-5690961 CTGCCGCTGGAAAAGGGGAAGGG + Intergenic
949839042 3:8300500-8300522 GTGGGTCTGGGAATGGGTCATGG - Intergenic
950333863 3:12178236-12178258 CTGAGACAGGAAATTGGGAAAGG - Intronic
950490344 3:13300805-13300827 TTGGGTTTGGGAGTGGGGAAGGG + Intergenic
951300132 3:20986520-20986542 CTGGATCTGGAAAGGAAGAAAGG + Intergenic
952079914 3:29745485-29745507 ATGTTTCTGGAAATGGGAAATGG - Intronic
952176654 3:30871116-30871138 CAGGGTCTGTAAATGAGGGAAGG + Intronic
952738409 3:36712602-36712624 CTGGAGATGGAAATGGGGAGAGG - Exonic
952994749 3:38868690-38868712 TTGGGTCTGGAAAGGGGGGTTGG + Intronic
953062391 3:39438184-39438206 CTTGGTCTGGAACTTTGGAATGG + Intergenic
953091492 3:39730824-39730846 CTGGTTGTGGGAAAGGGGAAAGG - Intergenic
953224020 3:40999910-40999932 CTGTGTCTGGAGGTGGGGAAGGG - Intergenic
953412549 3:42698457-42698479 CTGGCTCTGGAAGAGAGGAAGGG - Intronic
954638528 3:52084724-52084746 CAGGATGTGGATATGGGGAAGGG - Intronic
954916988 3:54156861-54156883 GTGGGTCAGGAATTGGGGAAGGG - Intronic
955124728 3:56099866-56099888 ATGTGTCTGGCAAGGGGGAAAGG - Intronic
955687834 3:61563114-61563136 CTGGGTCTGGACGCGGGGAGGGG + Intronic
955815761 3:62841058-62841080 CTCTGCCTGGAAATGGGGAATGG - Intronic
956724460 3:72145756-72145778 CTGGGGCTGGAGAGTGGGAAGGG - Intergenic
960694256 3:120380550-120380572 CTGGGCCTTGAAGTGGGCAAGGG + Intergenic
961208403 3:125106129-125106151 ATGGGACTGGAAATAGAGAAGGG + Intronic
961801462 3:129453323-129453345 CTGAGAGTGGCAATGGGGAAGGG + Intronic
961814599 3:129543058-129543080 CTGGGGCTGGAGGTGTGGAATGG - Intergenic
963064884 3:141255780-141255802 CTGGAGATGGAAAGGGGGAAAGG + Intronic
963319301 3:143795810-143795832 TTGGGACTGGCAATGAGGAAGGG + Intronic
963749081 3:149156390-149156412 CTGGGTCTTGAACTGGAGAAGGG - Intronic
964691481 3:159454564-159454586 CTGGGTTTGGGAAGGGGGCATGG + Intronic
965788447 3:172361676-172361698 CTGGCTTTGGAAGTGGGTAATGG - Intronic
966968214 3:185017460-185017482 CCGTATGTGGAAATGGGGAAAGG - Intronic
966984670 3:185168225-185168247 CTGGGTTTGAAATGGGGGAAAGG + Intergenic
967117244 3:186352967-186352989 ATGAGTCTGGAAATGTGGACAGG - Intronic
967212343 3:187180106-187180128 CGGGGTGTGGAAATAGGGGATGG + Intronic
967309809 3:188095269-188095291 CTGGGACTGAAAATGTGGATGGG - Intergenic
967370709 3:188742643-188742665 CTGAGGCTGGGAGTGGGGAAAGG + Intronic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968598870 4:1499747-1499769 CTGAGTCTGCAGATGGGGACAGG - Intergenic
968836005 4:2964326-2964348 CTGGGCCAGGAGATGGGGACTGG - Intronic
969028543 4:4193338-4193360 GTGGGTGTGGTGATGGGGAAGGG - Intronic
969065305 4:4474706-4474728 CTGGTTTTGAAGATGGGGAAAGG + Intronic
969550136 4:7860431-7860453 CTGAATCTGGAAATTGGAAATGG - Intronic
969672796 4:8598892-8598914 CTGATTCAGGAAATGGGGAGAGG + Intronic
969855406 4:9995146-9995168 TGGGGTCTGTAGATGGGGAATGG - Intronic
970125833 4:12809672-12809694 ATGAGTCTGGCCATGGGGAAAGG - Intergenic
970807408 4:20052642-20052664 ATGAGTGTGGACATGGGGAAAGG - Intergenic
971192754 4:24443399-24443421 CTGGCTCTGGCACTGGGGAAGGG + Intergenic
971294962 4:25379782-25379804 CTGAGTGTGGAAATGGGGAGGGG + Intronic
972184985 4:36517813-36517835 CTGGTTAAGAAAATGGGGAAAGG - Intergenic
972624783 4:40786100-40786122 TTGCACCTGGAAATGGGGAATGG + Intronic
972912708 4:43837884-43837906 ATGGGTCTGGAAATGTGTAATGG + Intergenic
973933392 4:55816883-55816905 TTGGATATGGAAATGGAGAAAGG - Intergenic
973976425 4:56267466-56267488 CTGATTTTGGAAATGAGGAAGGG + Intronic
974064599 4:57065951-57065973 CTGGGGCTGGAGATGGGGGTAGG - Intronic
975603719 4:76130610-76130632 CTGGCCCTGGAAGTAGGGAAAGG - Intronic
976698798 4:87946935-87946957 CTGGGTCAGGAATTCAGGAAGGG + Intergenic
977334807 4:95684395-95684417 CTGGGTGTGAAGATGGGGGAAGG + Intergenic
978842314 4:113229332-113229354 CTGGCTTTGGAGATGGAGAACGG - Intronic
979206334 4:118042768-118042790 CTGGGTTTGGATATGAGGATGGG - Intronic
979858573 4:125664999-125665021 CTGAGTCTGGTGATGGGGAGTGG + Intergenic
980655083 4:135772155-135772177 TTTGGTCAGGAAAGGGGGAATGG - Intergenic
980840814 4:138258714-138258736 GTGGGTGAGGATATGGGGAAAGG + Intergenic
981150648 4:141376533-141376555 CTTGCTCTGGAGTTGGGGAAGGG - Intergenic
981548355 4:145917160-145917182 GTGGTTCTGGAACTGGGTAATGG - Intronic
981617568 4:146657375-146657397 ACGGGGCTGGAAATGAGGAAAGG + Intergenic
982112267 4:152067513-152067535 CTAGGACTGGAAAAGGGGATTGG + Intergenic
982376403 4:154695798-154695820 CTGGTTACAGAAATGGGGAATGG - Intronic
982482743 4:155932586-155932608 CTGGGGATGGAAATGGGGACTGG - Intronic
983076328 4:163331721-163331743 CTGGGTTAGGAGATTGGGAATGG - Intronic
983941687 4:173539583-173539605 CTGTGTCTGAAAAGGGGGATGGG - Intergenic
984153453 4:176164010-176164032 ATGGGACTTGCAATGGGGAAAGG - Intronic
984539963 4:181024923-181024945 CTGAGTAGGGAAGTGGGGAAAGG - Intergenic
984640650 4:182160676-182160698 CTGGGATGGGACATGGGGAAGGG + Intronic
985625302 5:982498-982520 CTGGGCCTGGAGCTGGGGAAAGG - Intergenic
986338208 5:6770168-6770190 CTGGATCTGGGAGTGGGGCAAGG + Intergenic
986734612 5:10659900-10659922 CTGGGACGGGAAAAGGGAAATGG + Intergenic
987361002 5:17106372-17106394 TTGCAGCTGGAAATGGGGAAAGG + Intronic
988738346 5:34044943-34044965 CTGGAGCTGGAGCTGGGGAAAGG + Intronic
989069582 5:37496796-37496818 CTGAGTCTGGGAATGAGGAGAGG + Intronic
989411795 5:41127783-41127805 CTGGGTTTGAAGATAGGGAAAGG + Intergenic
989846627 5:46152249-46152271 GTGGGTGGGGGAATGGGGAAGGG + Intergenic
991037143 5:62138787-62138809 CTTGGTCTGGAAAAGTGGGAGGG + Intergenic
991999940 5:72426311-72426333 ATGGGTCAGGAATTGGGGAGTGG - Intergenic
992255391 5:74915749-74915771 CAGCTTCTTGAAATGGGGAATGG + Intergenic
993321446 5:86472576-86472598 CTGGACCTGAGAATGGGGAAAGG + Intergenic
995282840 5:110355149-110355171 CTGGATCTGGAATGGGAGAAGGG - Intronic
995745409 5:115397214-115397236 GTAGGTCTGGAAAAGGAGAATGG + Intergenic
995785947 5:115827756-115827778 GTGGGGCAGGAAAGGGGGAAAGG + Intergenic
998173768 5:139887596-139887618 TTTGGGCTGGAACTGGGGAAGGG + Intronic
998250589 5:140549513-140549535 CAGGGGCTGGAACTGGGGAATGG + Exonic
998361424 5:141591344-141591366 CTTAGTCTGGAAATGGGTAGAGG - Intronic
998377769 5:141702508-141702530 CTGGGCCTGGCGGTGGGGAAGGG - Intergenic
998568632 5:143237830-143237852 CTGGGTGTGGAATTGGAGGAGGG + Intergenic
998568646 5:143237876-143237898 CTGGGTGTGGAATTGGAGGAGGG + Intergenic
998819273 5:146043374-146043396 CGAGGTCTGGAATTAGGGAAGGG - Intronic
998875008 5:146590445-146590467 CTGGGTTTGGAAATGAGGGATGG + Intronic
999265529 5:150264611-150264633 ATGGGTGTGGGTATGGGGAATGG + Intronic
999441894 5:151607903-151607925 CTAGGGCTGGAAGTGAGGAATGG - Intergenic
999646208 5:153719349-153719371 ATGGGTCAGGAAATTTGGAAAGG + Intronic
1000209214 5:159095676-159095698 CTAGGGTTGGAAATGGGGGAAGG + Intronic
1000755064 5:165147915-165147937 CTGGCTTTGGAGATGGAGAAAGG + Intergenic
1001309658 5:170601890-170601912 TTGGCCCTGGCAATGGGGAATGG + Intronic
1001491998 5:172162590-172162612 CTGGGTTTGGAGAGGAGGAAGGG - Intronic
1001706116 5:173742132-173742154 CTGGGTGTAGGAGTGGGGAATGG + Intergenic
1001752755 5:174144205-174144227 GTGGGTCAGGAATTGGAGAATGG + Intronic
1001818778 5:174693431-174693453 CTGGGGCAGGGAATGGGGAGGGG + Intergenic
1002206980 5:177569570-177569592 CTGGGTCAGAAAATGAGGGAAGG - Intergenic
1003414999 6:5899324-5899346 CTGGGCCTGAAAAGGGGTAAAGG - Intergenic
1003888480 6:10542515-10542537 TTGGGTGTGGAAATGGGAAGTGG - Intronic
1004745353 6:18503510-18503532 CTGAGACTGGAATTGAGGAAGGG + Intergenic
1004752040 6:18572099-18572121 TTGTGTCTGGAATTTGGGAAGGG + Intergenic
1004961989 6:20800433-20800455 ATTGGTCTGGGAGTGGGGAAGGG + Intronic
1004977152 6:20980901-20980923 CTGAGTCTTCAAATGGGCAAAGG - Intronic
1005335769 6:24794547-24794569 CTGGGAGTGTAAATGGGGAAGGG + Intergenic
1005933548 6:30501135-30501157 TAGGGTCTGGACAAGGGGAAGGG + Intergenic
1006025268 6:31142784-31142806 CTGGCACAGGAAATGAGGAATGG + Intronic
1006067374 6:31471731-31471753 CTGGATTTGGGAATGGGGTATGG + Intergenic
1006255778 6:32830801-32830823 CAGGGTCTGGAAAACAGGAATGG + Exonic
1006803125 6:36771924-36771946 CTGCTTCTGGACATGGGGGAGGG + Intronic
1006839447 6:37019119-37019141 CTGGGTCAGGGAGAGGGGAAAGG - Intronic
1007227920 6:40327894-40327916 ATGGGGCCAGAAATGGGGAAGGG + Intergenic
1007635801 6:43299075-43299097 CTGGGACTGGAAAAGAGGAAGGG - Exonic
1007777531 6:44232153-44232175 GTTGGGCTGGAAGTGGGGAAGGG + Intronic
1008122428 6:47633780-47633802 GTGGCTTTGAAAATGGGGAAAGG - Intergenic
1008789916 6:55217829-55217851 GTGGCTTTGGAAATGGGTAATGG - Intronic
1011378274 6:86714649-86714671 CTGGGAATGGTAAGGGGGAAAGG + Intergenic
1011730788 6:90261148-90261170 CTGGGTGTGGATATGGATAAGGG - Intronic
1012450876 6:99351135-99351157 CTAGGTCTAGACATGGGGATGGG + Intergenic
1013830534 6:114267460-114267482 CTGGGCCTGGAGGTGAGGAAGGG + Intronic
1014417543 6:121201373-121201395 GTGGGTTAGGAAATGGGCAAAGG + Intronic
1014851087 6:126340417-126340439 CTCGGGCTGGGAATGGGGCACGG + Exonic
1015499594 6:133918734-133918756 CTGAGGCTGGAAGTGGGAAAAGG - Intergenic
1016273416 6:142318686-142318708 ATGGATCTAGAAATGGAGAAGGG + Intronic
1017111255 6:150934956-150934978 TTGCACCTGGAAATGGGGAATGG + Intronic
1017743334 6:157426251-157426273 CTGGGTGGGGAGGTGGGGAAGGG + Intronic
1018064719 6:160116985-160117007 CTAGGTCTGAAAATGGGGGAGGG + Intergenic
1019433145 7:1008635-1008657 CGGGCTCAGGAAATGGGGATGGG - Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1020797063 7:12688243-12688265 TTGCACCTGGAAATGGGGAATGG + Exonic
1021058945 7:16085700-16085722 TTGGGGATGGAGATGGGGAAAGG + Intergenic
1021241008 7:18201162-18201184 CTGAGACTGGGAATGGGGAGTGG - Intronic
1021738586 7:23662906-23662928 CTGGCTTTGGAAATGGGAAAAGG - Intergenic
1022981230 7:35606682-35606704 CTGGCTTTGAAAATGGGGAAAGG - Intergenic
1023296658 7:38721847-38721869 ATGGGACTGGAGAAGGGGAATGG + Intergenic
1023371554 7:39517197-39517219 CTGGGGCTGGAAATTGGGCAGGG - Intergenic
1026320955 7:69267241-69267263 CTGAGTCTGGAAAAGGTGAGAGG - Intergenic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1027943631 7:84717678-84717700 CTGGCTTTGAAGATGGGGAAGGG + Intergenic
1027971518 7:85088886-85088908 CTGAGTCGGGAAAAGGGAAAGGG - Intronic
1028561486 7:92180391-92180413 CTGGGTGTGGAAAAGGGGGCTGG - Intergenic
1029180841 7:98700650-98700672 GTGGGTCTGGAATTCAGGAAAGG - Intergenic
1029487700 7:100853345-100853367 CCGGTTCTGGAAAGGGGCAAAGG - Intronic
1029538987 7:101172116-101172138 CTGGGACTGGAGCTGGTGAAGGG - Exonic
1029989586 7:104950883-104950905 ATGGGTCAGGAATTTGGGAAGGG - Intergenic
1032180028 7:129667424-129667446 CTGAGTTGGGAAATGGGCAAAGG - Intronic
1032548338 7:132762024-132762046 TTGGGGCTGGGGATGGGGAAGGG + Intergenic
1033552145 7:142457320-142457342 CTGGGTCTTGGAATGGACAAAGG - Intergenic
1033559049 7:142513819-142513841 CTGGGTCTTGGAATGGACAACGG - Intergenic
1033585104 7:142768925-142768947 ATGGGTCTGGAACTGTGGCAAGG + Intergenic
1035657377 8:1320190-1320212 CTGTTTCCGGAAATGGGGAAGGG + Intergenic
1036031357 8:4977632-4977654 CTGGGTCTGCACGTGGGGTAAGG - Intronic
1036334203 8:7856933-7856955 CTGGGTCTGTGATTTGGGAATGG + Intronic
1036769323 8:11567707-11567729 CTGGCTCTGGAATGGAGGAATGG - Intergenic
1037273428 8:17154769-17154791 CAGGGTCTTGAAATCGGAAATGG - Intergenic
1037595208 8:20349108-20349130 CTGGTTCAGGCAGTGGGGAAAGG + Intergenic
1037597211 8:20364203-20364225 CTGAGTCTGGAAAGGTGGGAGGG + Intergenic
1037668808 8:20996979-20997001 CTGGGGCTGGAGACGGGGGATGG - Intergenic
1037927809 8:22858183-22858205 GTGGGTGTTGAAATGGTGAAAGG + Intronic
1038189126 8:25302897-25302919 CAGGGGCTGGAGAGGGGGAATGG + Intronic
1038222419 8:25623341-25623363 CTAGTTCTGAAAATGGTGAAGGG - Intergenic
1039466064 8:37786309-37786331 CTGGATGTGGAGAGGGGGAAAGG + Intronic
1039848737 8:41344349-41344371 CTGGGACTGGAAGGAGGGAAAGG - Intergenic
1039888217 8:41667564-41667586 TGGGGCCTGGGAATGGGGAAGGG + Intronic
1040568610 8:48588910-48588932 CTGGGCCAGCATATGGGGAAGGG - Intergenic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1040987257 8:53309368-53309390 ATGGGTATGGATATGGAGAAAGG - Intergenic
1041099766 8:54384134-54384156 CTAGGTCTGGGAGTGGGGCAGGG - Intergenic
1041734175 8:61092618-61092640 CTGGCCCTGGAAATGGAGAAGGG - Intronic
1042148851 8:65759774-65759796 CTAGGTTTGAGAATGGGGAAAGG + Intronic
1042525913 8:69764529-69764551 CTGTGTTTGGAAATGGAGAATGG + Intronic
1042562738 8:70085287-70085309 ATGGGTCTGGAAATTTGCAAAGG + Intergenic
1042927994 8:73986526-73986548 GTAGGTCTGGAAATGAGGAGTGG + Intergenic
1043109706 8:76165285-76165307 TGGGGTCTGTAAATGGTGAATGG - Intergenic
1043821721 8:84874444-84874466 TTGGGGCTGTAAATGGGAAAGGG - Intronic
1044282620 8:90374578-90374600 CTTGCACTGGAAATGAGGAAAGG + Intergenic
1045790644 8:105978941-105978963 CTGGATGGGCAAATGGGGAAGGG + Intergenic
1045934134 8:107659186-107659208 GTGATTCTGGAAATGGGCAAAGG + Intergenic
1046263215 8:111798256-111798278 AAGGGTCTAGAAATGGGAAATGG + Intergenic
1046807353 8:118494145-118494167 CTGGCTCTGAAGATGTGGAAGGG + Intronic
1047356323 8:124125548-124125570 CTGGCTTTGAAAATGGAGAAAGG - Intergenic
1047760765 8:127952473-127952495 AGGGGTCTGGAAACAGGGAAGGG - Intergenic
1048293496 8:133197839-133197861 CTGAGTCTGGGAGTGGAGAAAGG + Intronic
1048949425 8:139483092-139483114 CAAGGTCTGGCAATGTGGAAGGG + Intergenic
1048987753 8:139744364-139744386 CAGGGTCTGGAAGCGGGGAAGGG - Intronic
1049099128 8:140566867-140566889 CTGTTTCTGGACAAGGGGAATGG - Intronic
1049212588 8:141393512-141393534 CTGGACCTGGAGATGGGGCATGG + Intronic
1049431266 8:142566395-142566417 CTGGGGCTGGATGTGGGGAAAGG - Intergenic
1049718629 8:144105308-144105330 GTGGGCGTGGAGATGGGGAATGG + Intronic
1050218445 9:3357584-3357606 CTGGGAAGGGAAATGAGGAAGGG + Intronic
1051083390 9:13319196-13319218 ATGGGTGAGGAAATGTGGAAGGG + Intergenic
1052882572 9:33612772-33612794 ATGGGTCTGGAACTGTGGCAAGG - Intergenic
1052900811 9:33793498-33793520 ATGGGTCTGGAACTGTGGCAAGG + Intronic
1052902353 9:33804193-33804215 ATGGGTCTGGAACTGTGGCAAGG + Intergenic
1053241007 9:36495589-36495611 CTGGATCTGGAAATGAAGGAAGG - Intergenic
1053293590 9:36898090-36898112 CTGGGTTTGGAAATGGAGGATGG + Intronic
1053365550 9:37520156-37520178 GTGGGTCGGGAAATGGAGGAAGG - Intronic
1053411069 9:37916482-37916504 CTGGTTCTGGGAATGGGCAGAGG + Intronic
1055237704 9:74143882-74143904 CTGGAAATGGGAATGGGGAAGGG - Intergenic
1055625412 9:78172281-78172303 CTGGGGGTGAAGATGGGGAAAGG + Intergenic
1055935082 9:81597343-81597365 GTGGGTCAGGGAATGCGGAAAGG + Intronic
1056000411 9:82210452-82210474 GTGGCTCTGGGAATGGGGCAGGG + Intergenic
1057031171 9:91776263-91776285 GTGGGTCTGGGGATGGGGAGGGG - Intronic
1057314804 9:93961294-93961316 CTAGGCCTGGGATTGGGGAAGGG + Intergenic
1058186697 9:101863784-101863806 CTGGCTCTTGAAAGGGAGAAAGG + Intergenic
1058421731 9:104839060-104839082 CTGTGGTTGGAAATGGAGAAAGG + Intronic
1059252105 9:112895065-112895087 CTGGGTCTGAATCTGGGAAATGG + Intergenic
1059350727 9:113662934-113662956 CTGGGTTGGGGAATGGGGAGTGG + Intergenic
1059435894 9:114276022-114276044 GTGTGTCTGGATATGGGGGATGG - Intronic
1060235854 9:121862186-121862208 TTTGGTCTGGAAATGTGGAGGGG + Intronic
1060543782 9:124448798-124448820 CTGGCTCTGGAAACTGGGACTGG + Intergenic
1061470487 9:130821295-130821317 CTGGGGCTGGAAGTGGGGGTAGG - Intronic
1061791847 9:133063258-133063280 CAGGGTGGGGAAATGGGGAGGGG - Intronic
1061795522 9:133083824-133083846 CAGGGTGGGGAAATGGGGAGGGG - Intronic
1061885630 9:133589886-133589908 GTGGGTCAGGAAATGGGGGGTGG + Intergenic
1185833170 X:3320640-3320662 CTGGGTTTGGACATGTGCAATGG + Exonic
1186173833 X:6904587-6904609 CTGGTACTGGAAATGGGGAGAGG + Intergenic
1187744884 X:22398499-22398521 ATGGGTCAGGAATTGGGGCAGGG + Intergenic
1187902752 X:24039855-24039877 CTGGGACTGGAGATGGGAACAGG + Intergenic
1188285882 X:28324950-28324972 TTGGGTCTGGGATTGGGGAATGG + Intergenic
1189234204 X:39475294-39475316 CTGGGTCCTGAAATGGGCTATGG - Intergenic
1189535394 X:41929754-41929776 CTGGGGGTGGGAATGGGGATAGG + Intergenic
1189549888 X:42082144-42082166 CGGGGTTAAGAAATGGGGAAAGG - Intergenic
1190738120 X:53269177-53269199 CTGGGTCAGGAAATTCAGAAAGG - Intronic
1192142469 X:68657695-68657717 CTCAGCCTGGAAATGGGGATGGG + Intronic
1194017236 X:88638202-88638224 CTGGGTCAGGATGTGGAGAAAGG + Intergenic
1195618741 X:106932858-106932880 CTGTGTCAGGAAATGTGCAAAGG + Intronic
1196216475 X:113058145-113058167 CTGGGTCCAGAAATGGGAAAAGG - Intergenic
1196588330 X:117456759-117456781 CTGGCTTTGAAAATGGGGGAAGG - Intergenic
1197603026 X:128553086-128553108 CTGGGGAGGGTAATGGGGAAGGG + Intergenic
1199546271 X:149009963-149009985 TTGTTTCTGGAAATGGGGAGTGG + Intergenic
1199889737 X:152066134-152066156 CTGGGTCTGGGGATGGGAATGGG - Intergenic
1199894795 X:152118773-152118795 ATGGGGATGGAAATGGGGATGGG + Intergenic
1199949894 X:152699163-152699185 GTGGGGATGGGAATGGGGAATGG - Intronic
1199959780 X:152769298-152769320 GTGGGGATGGGAATGGGGAATGG + Intronic
1199983837 X:152936540-152936562 CTGTGTCTGGCAATGGGATAGGG - Intronic
1199995340 X:153021171-153021193 CTGAATCTGGAAATCGAGAAGGG + Intergenic
1200391295 X:155949493-155949515 CTGGGGCTGGAAATGGTAATGGG + Intergenic
1200398016 X:156002550-156002572 CTGGGCCCGGGAATGGGGGATGG + Intronic
1201169768 Y:11246640-11246662 CTGCTTCTGGAACTGGGAAAGGG + Intergenic
1202103692 Y:21339066-21339088 GTGGGTCTGGAAACTGGGCATGG + Intergenic