ID: 1161594122

View in Genome Browser
Species Human (GRCh38)
Location 19:5142540-5142562
Sequence CCCCGGGGCTGGGTTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161594111_1161594122 15 Left 1161594111 19:5142502-5142524 CCACGAGGCGGAAGGGGATGGTG 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1161594122 19:5142540-5142562 CCCCGGGGCTGGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 24
4: 237
1161594107_1161594122 22 Left 1161594107 19:5142495-5142517 CCTGCTACCACGAGGCGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1161594122 19:5142540-5142562 CCCCGGGGCTGGGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 24
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161594122 Original CRISPR CCCCGGGGCTGGGTTTCTCC TGG Intronic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
900473450 1:2865501-2865523 CCTAGGTGCTGGGGTTCTCCTGG + Intergenic
900513433 1:3070618-3070640 CTCCGGGGCCGGGTCCCTCCAGG + Intronic
900591710 1:3463164-3463186 CCCGGAGGCTGGGTTCCCCCCGG - Exonic
900659695 1:3776346-3776368 CCCCCGGGGTGGGATCCTCCCGG + Intergenic
901797780 1:11690840-11690862 CCCCAGCGCTGGCTTTGTCCGGG + Intronic
902414644 1:16231589-16231611 CTCTGGGGCTGGGTCTCTGCAGG + Intergenic
903263494 1:22143286-22143308 CCGCGGGACTGGGCTGCTCCCGG + Intronic
903670217 1:25031048-25031070 CTCCAGGGCTGGGTTTCCCAGGG + Intergenic
906263142 1:44407845-44407867 CCCCGGGGCGGGGCTGCTCGGGG + Intronic
912492229 1:110068873-110068895 CCGGGGTGCTGGGTTTCTCCCGG + Intronic
913446644 1:118957341-118957363 TCCAGGAGCTGGGTTTCTCTAGG + Intronic
914902183 1:151716694-151716716 CCCCGGGCCTGGGCTGCTGCCGG + Exonic
915015580 1:152730073-152730095 CCCCGGGGTGGTGCTTCTCCTGG + Intergenic
915351209 1:155227521-155227543 CCCCAGGGCTGCTTTTCTCGCGG - Intergenic
915353982 1:155244647-155244669 CCCCAGGGCTGCTTTTCTCGCGG - Exonic
920736066 1:208534038-208534060 TCCCTGGGCAGTGTTTCTCCAGG + Intergenic
922730055 1:227945051-227945073 CGCCGGGGCTGCTTCTCTCCTGG - Intronic
1062858930 10:794720-794742 CACTGGGGCTGGGTATATCCTGG - Intergenic
1067058665 10:43066614-43066636 CCCAGTGGCTGGGTTGCTGCTGG - Intergenic
1067118597 10:43455436-43455458 CCACGGCGCAGGGATTCTCCCGG - Intronic
1068560843 10:58512961-58512983 GCCCGGGGCTGGGATGCGCCGGG + Intergenic
1069697047 10:70394194-70394216 CCCCAGGGCTTGGCTTCTCTTGG - Intergenic
1070818549 10:79340893-79340915 CCCTGGGGCTGGGTGAGTCCAGG - Intergenic
1071086224 10:81871699-81871721 CCCAGGTGTTGGGTTTCTTCTGG - Intergenic
1071857992 10:89645113-89645135 GCCCGGGGCTGGCGTGCTCCAGG - Exonic
1072238000 10:93469614-93469636 CCTCAGGGCTGGCTTTGTCCAGG + Intronic
1072591592 10:96832625-96832647 CCCCGGGGCTGGCTCTCGGCGGG + Intronic
1073053705 10:100685825-100685847 CTCAGGGACTTGGTTTCTCCAGG - Intergenic
1073111954 10:101067708-101067730 GCCAGGGGCTGGGCTTCGCCAGG - Intronic
1073576628 10:104631318-104631340 CCCGGGCGCTGGGCTTCTCCAGG + Intergenic
1074474222 10:113754804-113754826 CCCAGGGGCTTGCTTTCTCCAGG - Intronic
1076268842 10:129132882-129132904 CCCTGGGTCTCAGTTTCTCCTGG + Intergenic
1076335779 10:129705742-129705764 CTCCGGGGCTGTGGTCCTCCTGG + Intronic
1076817164 10:132920676-132920698 CCCGGGGGCTGGGCCTCCCCTGG + Intronic
1077090018 11:774113-774135 CCCCTGGGCTCTGCTTCTCCAGG - Exonic
1077540893 11:3146041-3146063 CCCTGGGTCTGGCTTGCTCCCGG - Intronic
1077718620 11:4605344-4605366 CCCCAGTTCTGGGATTCTCCTGG + Exonic
1079025386 11:16943807-16943829 GCCCTGGGCTTAGTTTCTCCTGG - Intronic
1082200396 11:49359339-49359361 CCCCTGGGCTGGGATTCACAAGG + Intergenic
1083260089 11:61518162-61518184 CCCTGGGGATGGGCCTCTCCTGG + Exonic
1083336365 11:61924022-61924044 CCCCGGGGCCTGGCTTCACCAGG - Intergenic
1083481214 11:62948957-62948979 CTCAGGGCCTGGGTTTCCCCAGG + Intronic
1083486306 11:62984798-62984820 CTCCGCAGCTGGGTTGCTCCGGG + Exonic
1083935468 11:65867724-65867746 CCCGGAGGCGGGGTTTCTGCAGG - Intronic
1083998040 11:66281907-66281929 CTCTGGGCCTGGGTTCCTCCTGG + Intronic
1084367737 11:68713891-68713913 CTCGGTGCCTGGGTTTCTCCGGG - Intronic
1085811217 11:79682974-79682996 ATCGGGGGGTGGGTTTCTCCAGG + Intergenic
1086655279 11:89346868-89346890 CCCCTGGGCTGGGATTCACAAGG - Intronic
1088583193 11:111334895-111334917 CCCGGGGACTGGGTTTCCACTGG - Intergenic
1088764648 11:112963212-112963234 CCGCAGGGCGGGGTTTCTCTTGG - Intronic
1089388453 11:118083441-118083463 CCCCGGGGCTTGGCTTCAGCAGG - Intronic
1090247315 11:125225573-125225595 CCTCTGGGCTGGCTTACTCCTGG + Intronic
1091301906 11:134513362-134513384 CTCCGGGGCTTCGTCTCTCCAGG - Intergenic
1092849325 12:12612357-12612379 CACCGGGGCTGCGTTTTTCCAGG + Intronic
1095559680 12:43551154-43551176 CCTCGGAGCTGCGTTTCTGCCGG + Exonic
1096848978 12:54423425-54423447 CACAGGGGAGGGGTTTCTCCTGG - Intergenic
1099171919 12:79375281-79375303 ACCCGGTTCTTGGTTTCTCCAGG - Intronic
1102019854 12:109674738-109674760 ACCCCGGGCTGGGCTTCTGCAGG + Intergenic
1103712695 12:122924668-122924690 CCCCAGGGCTGGCTTAGTCCTGG - Intronic
1103876404 12:124130941-124130963 CCCCTGGGCTGGCTTTCACAGGG - Intronic
1103913463 12:124364173-124364195 CCCCAGGTCTGGGCTTCTCTGGG - Intronic
1104898810 12:132176848-132176870 CCCCGGGGCTGCTGTGCTCCAGG - Intergenic
1105687009 13:22793649-22793671 CCCCAGGGCTGTGCTTCTTCTGG - Intergenic
1108296300 13:49021406-49021428 CCCTGGGACTGGGTGTTTCCAGG + Intronic
1113708098 13:112446976-112446998 CCCAGGGGCTGTGTGTCTGCGGG - Intergenic
1113851526 13:113421118-113421140 TCCCGGGGGTGGGTCTGTCCTGG - Intergenic
1114031853 14:18585699-18585721 CCTGGGGCCTGGGGTTCTCCTGG + Intergenic
1114085540 14:19234840-19234862 CCTGGGGCCTGGGGTTCTCCTGG - Intergenic
1121833429 14:97071460-97071482 CCACAGGGCTGGGTGTCTCTTGG + Intergenic
1122155362 14:99747339-99747361 CCCCGGGCCTGCCTTTCTCCTGG - Intronic
1122365762 14:101194053-101194075 CCCCAGGCCTGGATTTCTCCCGG + Intergenic
1122856805 14:104563881-104563903 CCACTGGGCTGGGATTCCCCCGG + Intronic
1202897086 14_GL000194v1_random:16554-16576 CCTGGGGCCTGGGGTTCTCCTGG - Intergenic
1123710059 15:22980401-22980423 TCCCGGGGCGGGGGCTCTCCCGG + Intronic
1124121438 15:26892353-26892375 CCACGGGGCTGCATTTCCCCGGG - Intronic
1129832350 15:78679214-78679236 CCCCAGGCCTGGCTTCCTCCTGG - Intronic
1130390053 15:83447418-83447440 CCCCGCGGCTGGGCTCCGCCGGG - Exonic
1132005041 15:98219000-98219022 CCCCTGGCCTGGGCCTCTCCAGG - Intergenic
1132285416 15:100658803-100658825 CCCTGGGGCTGCGTTGCTGCCGG + Intergenic
1132339751 15:101070591-101070613 GCCTGGGGCTGGGCTTTTCCAGG - Intronic
1132701045 16:1222252-1222274 CCCCGGGGCCGGGATAGTCCCGG + Exonic
1132853237 16:2034097-2034119 CTGCGGGGCAGGGTTTCTCAGGG - Intronic
1133771370 16:8868808-8868830 GCTCCGGGCTGGGTTTCTCGGGG - Intronic
1135412340 16:22244674-22244696 CCCCTGGGCTGAGTTCCACCTGG + Exonic
1135421735 16:22309513-22309535 ACCCGGGGCTGGGTGTCCCGCGG + Intronic
1135988738 16:27204098-27204120 CCCCGGGGCTGCATTTCTCGCGG - Exonic
1136297626 16:29312684-29312706 GCACGGGGCTGCGTTTCTCCAGG + Intergenic
1136342944 16:29656834-29656856 GCCCTGGGCTTGCTTTCTCCAGG + Intergenic
1136657384 16:31718186-31718208 CCCAGGTCCTGGGGTTCTCCAGG + Intronic
1137655157 16:50153215-50153237 CCCCGGGGCGGGGCCTCTGCCGG - Intronic
1140473833 16:75228870-75228892 CGCCGAGGCTGGGTGTCTCCTGG - Intronic
1141083610 16:81075843-81075865 CCCTGGGCCTTGGTTTCTCCTGG - Intronic
1141174367 16:81709529-81709551 CCCCGCTGCCTGGTTTCTCCGGG + Intronic
1141644914 16:85362110-85362132 CCCTGGGGCTGGGATTCCTCTGG + Intergenic
1142059179 16:88018762-88018784 GCACGGGGCTGCGTTTCTCCAGG + Intronic
1142198067 16:88747959-88747981 CCACCGGGCTGCGTTTTTCCAGG - Intronic
1142351757 16:89583883-89583905 CCCCGGGGCTGTGTAGCTGCCGG - Intronic
1142811419 17:2397223-2397245 GCGCAGGGCTGGTTTTCTCCCGG - Intronic
1142892813 17:2956372-2956394 CAGCAGGGCTGGGTCTCTCCAGG + Intronic
1143095586 17:4476795-4476817 CCCAGGGGCTGGGTTAGGCCAGG + Intronic
1143137063 17:4717927-4717949 GCTGGGGGCCGGGTTTCTCCGGG - Exonic
1143202746 17:5123347-5123369 CCCCGGGCCGGGGTCACTCCGGG - Intronic
1143520187 17:7440264-7440286 CGCCTGGGCTCGGTTCCTCCTGG + Intronic
1143733399 17:8894099-8894121 CCCTGGGCCTCAGTTTCTCCTGG + Intronic
1143988398 17:10935488-10935510 TCCCTGGGCTGAGTTTCTCCTGG + Intergenic
1149639424 17:58193300-58193322 CCCCAGGACTGGGTCTCTGCTGG + Intronic
1149651714 17:58280064-58280086 CCCCTGGGCTGGGGCTCTGCTGG - Intronic
1150642685 17:66960243-66960265 CCCTGGAGCTGGGATTGTCCAGG + Intergenic
1151470913 17:74317203-74317225 CCCACGGGGTGGGTTTTTCCAGG - Intergenic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1151766479 17:76135863-76135885 CCCTGGAGCTGGGTCCCTCCAGG + Intergenic
1152610767 17:81314115-81314137 CCCCGGGCCTGGGTTCCCTCTGG - Intronic
1152891412 17:82883685-82883707 CCCCGGGGCAGGGGCTGTCCAGG - Intronic
1157320030 18:46627291-46627313 GCCTGGGGCTGGGTCTCTGCTGG - Intronic
1157908712 18:51595039-51595061 CCCCGGAGCTGGGATACTGCAGG + Intergenic
1158513832 18:58114721-58114743 CGCCAGGGCTGTGTTCCTCCCGG + Intronic
1158574978 18:58629147-58629169 CCCTGGGGCTGCATTTCACCAGG - Intergenic
1160014046 18:75127419-75127441 GCCCGGAGCTGGCTATCTCCTGG - Intergenic
1160802455 19:976710-976732 CCCAGGAGCTGGGTTCCCCCGGG - Intergenic
1161021433 19:2013416-2013438 CCCCGGAGCTGGGGGTCTCTGGG + Intronic
1161247178 19:3259548-3259570 CCCAGGAGCTGGGGTCCTCCTGG - Intronic
1161594122 19:5142540-5142562 CCCCGGGGCTGGGTTTCTCCTGG + Intronic
1161596795 19:5154692-5154714 TGCTGGGCCTGGGTTTCTCCGGG - Intergenic
1162035725 19:7937676-7937698 TCCAGGGCCAGGGTTTCTCCAGG - Intronic
1162070191 19:8148523-8148545 CCCCTTGGCTGGGTCTTTCCTGG + Intronic
1162514347 19:11139030-11139052 CCCCTGGGCTGGGCTGCTCTGGG + Intronic
1165182628 19:33985831-33985853 CTCCTGGGGAGGGTTTCTCCAGG - Intergenic
1165311063 19:35029939-35029961 TCCCGGGGCTGCTTCTCTCCAGG + Intergenic
1166193673 19:41193095-41193117 CCCCGCCGCCGGGTTTCTCCCGG - Exonic
1168161866 19:54515822-54515844 CACTGGGGCTGGGTCTCTCCTGG + Intergenic
1202633409 1_KI270706v1_random:20531-20553 CCCAGTGACTGGCTTTCTCCTGG + Intergenic
925203708 2:1989369-1989391 CTCCTGGGCTGGGTTTCTCCTGG - Intronic
925917243 2:8615478-8615500 CTTCTGGGCTGGGCTTCTCCCGG - Intergenic
927713084 2:25337888-25337910 GCCTGAGGCTGGGTTTCTGCAGG - Intronic
928124847 2:28608159-28608181 CACCAGGGCTGGGCTTCTACTGG - Intronic
928420922 2:31137625-31137647 CCCAGGGGCTGGCGGTCTCCGGG - Intronic
931578079 2:63741366-63741388 GCACAGAGCTGGGTTTCTCCTGG + Intronic
931690538 2:64831525-64831547 CCCTGGGGGTGGGGCTCTCCAGG + Intergenic
935129290 2:100249377-100249399 CCCCCGCACAGGGTTTCTCCAGG + Intergenic
936104036 2:109609497-109609519 GCCAGGGGCTGGGGTTCTCTGGG + Intronic
936639382 2:114295045-114295067 CCCCAGGGCAGTGATTCTCCAGG + Intergenic
937969424 2:127537782-127537804 AGCCTGGGCTGGGTTTCTCTGGG + Intronic
938082916 2:128379784-128379806 GCTCGGGGCTCAGTTTCTCCAGG + Intergenic
938491224 2:131762244-131762266 CCTGGGGCCTGGGGTTCTCCTGG + Intronic
938496339 2:131800093-131800115 CCTGGGGCCTGGGGTTCTCCTGG - Intronic
941728742 2:168892190-168892212 ACCCAGGGTTGGGTTTCTGCAGG + Intronic
946908260 2:224436592-224436614 CCGAGGGGCTTGGGTTCTCCTGG - Intergenic
948385385 2:237577625-237577647 CCCCGTGGCTGGCAGTCTCCTGG - Intronic
948667774 2:239546895-239546917 CCACCCGTCTGGGTTTCTCCTGG + Intergenic
949027506 2:241773487-241773509 GCCCTGGGCCGGGTTCCTCCTGG + Intergenic
1171085718 20:22236483-22236505 GCCCGGGGCTGGATCTCTCAGGG + Intergenic
1172276093 20:33680159-33680181 CCACCTGGCTTGGTTTCTCCAGG - Intronic
1173280064 20:41619106-41619128 CCCCGGGGCTGGAAAACTCCCGG - Intergenic
1174088238 20:48025469-48025491 CCAGGGGTCTGTGTTTCTCCTGG + Intergenic
1174353229 20:49982719-49982741 CCCCGGTGCTGGGGCTGTCCGGG - Intergenic
1175561515 20:59934032-59934054 GCGCGGGGATGGGCTTCTCCTGG - Intronic
1175952090 20:62588927-62588949 CCCCGGCACTGGGCCTCTCCTGG - Intergenic
1176616772 21:9032543-9032565 CCTGGGGCCTGGGGTTCTCCTGG - Intergenic
1176708358 21:10131104-10131126 CCTGGGGCCTGGGGTTCTCCTGG + Intergenic
1178855881 21:36250130-36250152 CCCCGGCCCTGGGTTCCTCAGGG - Intronic
1180004552 21:45014278-45014300 CCCCGGTGCTGGATTTGACCCGG - Intergenic
1180105736 21:45617035-45617057 CACGGGGGGTGGGTTCCTCCAGG + Intergenic
1180144710 21:45912747-45912769 GCCCGAGGCTGGGCATCTCCAGG + Intronic
1180292433 22:10858353-10858375 CCTGGGGCCTGGGGTTCTCCTGG + Intergenic
1180455967 22:15512756-15512778 CCTGGGGCCTGGGGTTCTCCTGG + Intergenic
1180495239 22:15887775-15887797 CCTGGGGCCTGGGGTTCTCCTGG + Intergenic
1181009738 22:20033185-20033207 CCCAGGGGCTGGCTTTCCTCTGG + Intronic
1181032866 22:20156728-20156750 CTCAGGGGCAGGGTGTCTCCGGG - Intergenic
1181307708 22:21926499-21926521 CCCCAGGCCTGGGTTCCTCCAGG + Intronic
1184072896 22:42157078-42157100 CCCATGGGATGGGTTTCTGCTGG + Intergenic
1185088333 22:48752653-48752675 ATAAGGGGCTGGGTTTCTCCTGG + Intronic
1185219560 22:49622628-49622650 CCCCGGGGCTTGGGTGCTACCGG - Intronic
1185222409 22:49635800-49635822 CCGCGGGGCTGGGGTGCTGCAGG + Intronic
1185249255 22:49791160-49791182 CCCCGGGGCTGCGTGTCAGCTGG - Intronic
949943519 3:9172682-9172704 CCCAGGAGCTGGGCCTCTCCTGG + Intronic
950430013 3:12945185-12945207 CCCCGGGGCAGGGTATCTTTGGG + Intronic
950430300 3:12947108-12947130 CCCCGAGGCTGCTTTCCTCCCGG - Intronic
950457121 3:13099485-13099507 CCCCCGAGCTGGGTGTCCCCGGG + Intergenic
950522573 3:13505594-13505616 CCCTGGGCCTGGGTTCCTGCAGG - Exonic
961634272 3:128322955-128322977 CCCCGGGGCAGAGTATTTCCTGG + Intronic
961785550 3:129344649-129344671 CCCTGGGGCAGGGATCCTCCAGG + Intergenic
966732695 3:183163649-183163671 CCTAGTGGCTGGCTTTCTCCCGG - Intronic
967877669 3:194277848-194277870 CCTCGGGGCCTGGCTTCTCCAGG - Intergenic
967940351 3:194761507-194761529 CCCCGGGGCTGAGTGCCACCTGG - Intergenic
968288949 3:197524426-197524448 TCCCGGGGTTGGGGTTCTTCTGG - Intronic
968545513 4:1195719-1195741 TCCTGGGGCTGGGGGTCTCCGGG - Intronic
968660315 4:1796049-1796071 CCCAGGGGCTTGGGGTCTCCTGG + Intronic
968958019 4:3728831-3728853 CCCCAGGGCTGAGCTTCCCCAGG + Intergenic
969417060 4:7067851-7067873 CCCCGGAGCTGGGCATCTCCGGG - Intronic
972723268 4:41722128-41722150 TCCCTGGGCTGATTTTCTCCAGG - Intergenic
976743306 4:88378981-88379003 CCCCGGGGCTGAGCTACTGCAGG + Exonic
977600322 4:98928628-98928650 CCCCGGAGCTGGGGTTCTGCAGG + Intronic
981542437 4:145859825-145859847 CCCCAGTCCTGGGTGTCTCCAGG + Intronic
982096479 4:151927878-151927900 CCCCTCGGATGGCTTTCTCCAGG - Intergenic
982693316 4:158572041-158572063 CCCAGGGGATTGGTTTCACCAGG - Intronic
984758968 4:183347729-183347751 CCCAGGGGTTGGGGTTCTCAGGG + Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
998011057 5:138695979-138696001 CCCTGGTGCTGGCTTCCTCCCGG + Intronic
998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG + Exonic
998943045 5:147305485-147305507 CTTGGAGGCTGGGTTTCTCCGGG + Intronic
999633991 5:153600909-153600931 CCCCGAGGCTAGGATGCTCCAGG - Intronic
1001939420 5:175729949-175729971 CCCCGTGCCTGGGCTTCCCCTGG - Intergenic
1002468690 5:179421849-179421871 CCCAGAGGCTGGGTTTCCCCAGG - Intergenic
1002593065 5:180304466-180304488 CCCTGGGGCAGGGTTTCCCCAGG - Intronic
1002888644 6:1316533-1316555 CCCCGGGGCTGGGTGTGTGAAGG - Intergenic
1003633804 6:7812882-7812904 CCCCAGGTCTGGGCTTTTCCTGG + Intronic
1004231946 6:13841720-13841742 CAGCTGTGCTGGGTTTCTCCTGG - Intergenic
1008520135 6:52355299-52355321 CCCCGGGGCATGTTTTCTTCTGG + Intergenic
1013305503 6:108843761-108843783 CACCAGGGCTGAGGTTCTCCAGG + Intergenic
1015024689 6:128519701-128519723 CCCCAGCTCTGGGTTGCTCCCGG - Intronic
1017484564 6:154890808-154890830 TCCAGGGGGTGGGTGTCTCCAGG - Intronic
1018470083 6:164087185-164087207 CCCCAGAGGTGGGCTTCTCCTGG + Intergenic
1019457503 7:1138122-1138144 CCCCGGGGCTCTGGGTCTCCTGG + Exonic
1021236405 7:18148247-18148269 CCGCAGGGCTGTGTTTCTTCTGG + Intronic
1022110170 7:27225340-27225362 CCCAGGGGCTGGGTGTCTGCAGG + Intergenic
1022904794 7:34845306-34845328 CCCCAGGGCTGGGGTTCACAAGG + Intronic
1026847789 7:73707354-73707376 CCCCGGGGCGGGCATTCTCAGGG - Intronic
1027176283 7:75905897-75905919 TCCAGGGGCTGGGAGTCTCCAGG - Intronic
1029189689 7:98762617-98762639 CCCTGGGACTCGGTTCCTCCTGG - Intergenic
1033658690 7:143389552-143389574 CCTCAGGGCTGGCTTTCTGCAGG + Intronic
1034040880 7:147875424-147875446 TCATGGGGCTGGGTTTTTCCTGG - Intronic
1034188509 7:149196551-149196573 CCCTGGGGCTGGGCTGCTCAGGG + Intronic
1034426816 7:151018344-151018366 CGCCGGGGCCGGGCTCCTCCGGG + Exonic
1034442825 7:151095599-151095621 TCCTGGGCCTGGGTTTTTCCAGG + Intronic
1034965377 7:155387455-155387477 TCCCTGGGCTGGGCTCCTCCTGG - Intronic
1035018927 7:155788980-155789002 CCCCAGGGCTGGGCTGCTCGTGG - Intergenic
1035662787 8:1360212-1360234 TTCCGGGGCGGGGCTTCTCCGGG + Intergenic
1035662794 8:1360228-1360250 CTCCGGGGCGGGGCTTCTCCGGG + Intergenic
1035662801 8:1360244-1360266 CTCCGGGGCGGGGCTTCTCCGGG + Intergenic
1035662808 8:1360260-1360282 CTCCGGGGCGGGGCTTCTCTGGG + Intergenic
1035662815 8:1360276-1360298 CTCTGGGGCGGGGCTTCTCCGGG + Intergenic
1035662821 8:1360292-1360314 CTCCGGGGCGGGGCTTCTCCGGG + Intergenic
1035662827 8:1360308-1360330 CTCCGGGGCGGGGCTTCTCCAGG + Intergenic
1036586386 8:10127937-10127959 CACCAGGGCAGTGTTTCTCCTGG + Intronic
1038495979 8:28003096-28003118 CCATGTGGCTGGATTTCTCCTGG + Intergenic
1038619931 8:29132352-29132374 CCACAGGGCGGGGTTTTTCCGGG + Exonic
1039441582 8:37598818-37598840 CTCCTGGGCTCGTTTTCTCCAGG - Intergenic
1042518610 8:69685765-69685787 CCCCAGGGCTGGTTTTCTTGAGG - Intronic
1045326650 8:101122300-101122322 CCCAGAGGCAGGGTTACTCCAGG + Intergenic
1048197034 8:132339817-132339839 CCCAGGGTCTGGGTGTCGCCAGG - Intronic
1048360366 8:133692315-133692337 CAGCAGGGCTGGGTTCCTCCTGG + Intergenic
1049641710 8:143718946-143718968 CCCCGGGGCTGGGTGGGGCCGGG - Intronic
1053645318 9:40116617-40116639 CCTGGGGCCTGGGGTTCTCCTGG + Intergenic
1053760396 9:41346910-41346932 CCTGGGGCCTGGGGTTCTCCTGG - Intergenic
1054326340 9:63714518-63714540 CCTGGGGCCTGGGGTTCTCCTGG + Intergenic
1054539254 9:66259354-66259376 CCTGGGGCCTGGGGTTCTCCTGG - Intergenic
1057028266 9:91753576-91753598 ACCTGTGGCTGGGTTTCTCTAGG - Intronic
1057696316 9:97325189-97325211 CCCCGGGTGTGGGTCTCACCTGG - Exonic
1061545634 9:131302568-131302590 CCCCTGGGCTGGGTCTTCCCAGG - Intronic
1062453439 9:136625023-136625045 CCCTGGGCCTCGGTTTCCCCAGG - Intergenic
1062517601 9:136944204-136944226 CCACGGGGCTGCGTGTCTGCAGG + Intronic
1062610592 9:137371689-137371711 CCCCGGGGCTGGGCACCCCCAGG + Intronic
1062726549 9:138077283-138077305 CCCCGGTGCTGGCTGTGTCCAGG + Intronic
1202793119 9_KI270719v1_random:100073-100095 CCTGGGGCCTGGGGTTCTCCTGG + Intergenic
1185849881 X:3475390-3475412 CTCCCGGGCTGAGTTGCTCCTGG - Intergenic
1187562242 X:20413727-20413749 TGCAGGGGCTGTGTTTCTCCTGG - Intergenic
1190325401 X:49204266-49204288 CACCGGCTCTGGGTTTCTCTCGG - Intergenic
1190844990 X:54183150-54183172 CCCCGGGACAGCGCTTCTCCAGG + Exonic
1194533044 X:95074374-95074396 CCCAGGGGATTGGTTTGTCCAGG + Intergenic
1200003215 X:153072580-153072602 TCCCGGGGCAGGGTCCCTCCTGG - Exonic
1200004508 X:153077429-153077451 TCCCGGGGCAGGGTCCCTCCTGG + Intergenic
1201150174 Y:11091394-11091416 CCTGGGGCCTGGGGTTCTCCTGG - Intergenic