ID: 1161597254

View in Genome Browser
Species Human (GRCh38)
Location 19:5156839-5156861
Sequence TCTAAAGCAGCTGCTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161597254_1161597262 30 Left 1161597254 19:5156839-5156861 CCAGCCCCAGCAGCTGCTTTAGA No data
Right 1161597262 19:5156892-5156914 CGCCTATAATCCCAGCACTTTGG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
1161597254_1161597258 0 Left 1161597254 19:5156839-5156861 CCAGCCCCAGCAGCTGCTTTAGA No data
Right 1161597258 19:5156862-5156884 AACACAAAGCCAGCCATGTACGG No data
1161597254_1161597259 3 Left 1161597254 19:5156839-5156861 CCAGCCCCAGCAGCTGCTTTAGA No data
Right 1161597259 19:5156865-5156887 ACAAAGCCAGCCATGTACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161597254 Original CRISPR TCTAAAGCAGCTGCTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr