ID: 1161601823

View in Genome Browser
Species Human (GRCh38)
Location 19:5188852-5188874
Sequence CATGATTTGCAGGCAATGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161601819_1161601823 -10 Left 1161601819 19:5188839-5188861 CCATATTTATAACCATGATTTGC 0: 1
1: 1
2: 2
3: 16
4: 229
Right 1161601823 19:5188852-5188874 CATGATTTGCAGGCAATGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 121
1161601816_1161601823 21 Left 1161601816 19:5188808-5188830 CCTGGGCTCGCCTTTGGAGAACT 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1161601823 19:5188852-5188874 CATGATTTGCAGGCAATGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 121
1161601815_1161601823 22 Left 1161601815 19:5188807-5188829 CCCTGGGCTCGCCTTTGGAGAAC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1161601823 19:5188852-5188874 CATGATTTGCAGGCAATGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 121
1161601818_1161601823 11 Left 1161601818 19:5188818-5188840 CCTTTGGAGAACTTCTCATGGCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1161601823 19:5188852-5188874 CATGATTTGCAGGCAATGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161601823 Original CRISPR CATGATTTGCAGGCAATGTA GGG Intronic
900816177 1:4848022-4848044 CATGATTTTCAGGCAACATCTGG - Intergenic
900915986 1:5638950-5638972 CATGTTTTGCTGGCCATGCAAGG + Intergenic
901176146 1:7300733-7300755 AATGATTGGCAGGCAATGAGAGG + Intronic
901328942 1:8389641-8389663 CATGCTTTGCAGTCAATTTGAGG + Intronic
904388615 1:30164220-30164242 CATGTTTTGCAGGCAGTCCAAGG + Intergenic
904471601 1:30739893-30739915 CATGATTTGCAGGGACAGGAAGG + Exonic
905908841 1:41640109-41640131 CATGGTTTTCAGGCACTGCAGGG + Intronic
908737924 1:67295537-67295559 CATGAATTGCCGTAAATGTAGGG - Intergenic
910901764 1:92128774-92128796 TATGATTTACATGTAATGTAGGG + Intronic
912929359 1:113942846-113942868 CATGATTTGTATTTAATGTATGG - Intronic
915020050 1:152770710-152770732 CATGTTAGGCAGGCAAGGTAAGG + Intronic
918558805 1:185838667-185838689 AATGCTTTGCAGTCACTGTAGGG - Intronic
919807954 1:201391890-201391912 CCTGATTTGCAGACAATGCAGGG - Intronic
924673126 1:246148600-246148622 TATGATTTGGAGGCAAAGAATGG + Intronic
1065690663 10:28330214-28330236 AATGATTTGAAGGCACTGGAGGG + Intronic
1068876808 10:62005792-62005814 CATGTTTTGCTGGAAATGAAAGG + Intronic
1072516560 10:96188942-96188964 GATGGTTTGCAGGCAATCTTTGG + Intronic
1074026506 10:109641315-109641337 CATCATTTGTAGGAAATGGAAGG + Intergenic
1074285661 10:112095580-112095602 GATGATTTCCATGCAATGAAAGG - Intergenic
1075091968 10:119448849-119448871 CATGATTTATAGACCATGTAGGG - Intronic
1075970657 10:126649582-126649604 CTTGGTTTGAAGGCAATGTCAGG - Intronic
1080115160 11:28614072-28614094 CATGGTTTCCAGGCCATGGAGGG + Intergenic
1087995972 11:104809623-104809645 GATGATTTGCATGCACTTTATGG - Intergenic
1088721709 11:112598043-112598065 TAGGCTTTGCAGGCCATGTAAGG + Intergenic
1088953190 11:114590720-114590742 CTTGATTTGCAGGTAAAGGATGG + Intronic
1091014024 11:132033257-132033279 TGTTATTTTCAGGCAATGTAAGG + Intronic
1095430021 12:42123132-42123154 CCTGAGTTGAATGCAATGTATGG + Intronic
1095992756 12:48048369-48048391 CATGATTTTCAGGGAATATAAGG + Intronic
1098130869 12:67348501-67348523 CATGGTTTGCTGGCAATCTTTGG + Intergenic
1104515631 12:129423488-129423510 GATGATTTGTAGGGGATGTAGGG + Intronic
1108371042 13:49768923-49768945 CCTTATTTGCATGAAATGTAAGG - Intronic
1108964033 13:56274106-56274128 TATGATTTGCATGCAACATAGGG + Intergenic
1110268006 13:73560349-73560371 CTTGATTTGTAGGAAATGAAGGG - Intergenic
1110497574 13:76187536-76187558 CAAGAGTAGCAGGCAAAGTAAGG + Intergenic
1115887987 14:37994903-37994925 GATGATTTGCTGGCAATGTTTGG + Intronic
1118949832 14:70426041-70426063 CAAAATTTGTAGGGAATGTACGG + Intergenic
1120083575 14:80242645-80242667 CCTGAGTAACAGGCAATGTAGGG + Intronic
1121580197 14:95024389-95024411 CAGGTTTTGCAGGCAATCTTGGG + Intergenic
1124592685 15:31067274-31067296 CCTGATCTGTAGGGAATGTAGGG - Intronic
1128038678 15:64550401-64550423 TATGATTTGCAGGCCAGGTATGG + Intronic
1128507113 15:68280914-68280936 CATGTTCTGGAGGAAATGTAAGG + Intronic
1129893559 15:79088085-79088107 GATGATTTGAAATCAATGTAGGG + Intronic
1130453932 15:84085086-84085108 CACTATTTTCAGGCTATGTATGG - Intergenic
1130621680 15:85469532-85469554 CATCATTTGCAGGCCATTTCTGG + Intronic
1133678512 16:8098491-8098513 CCTGAATTGCAGCGAATGTAGGG + Intergenic
1134073816 16:11276649-11276671 CATGCTTTACAGGCAAGGCAAGG - Intronic
1136035810 16:27539265-27539287 AATGATTTGAAGGCAAGGTCTGG - Intronic
1137834342 16:51576284-51576306 CATTAACTGCAAGCAATGTAGGG + Intergenic
1138019924 16:53469594-53469616 CATGATTTAGGGGCAATTTAAGG - Intronic
1139788453 16:69413012-69413034 CATTATTTGCAGGGAAAGGATGG + Intergenic
1141112525 16:81281860-81281882 CATGAGATGCTGGCAATGTCTGG - Intronic
1148403626 17:47389784-47389806 AATCATTTGCAGCCACTGTAGGG - Intronic
1149350575 17:55782835-55782857 CATGCTATGCAGACAAGGTAAGG - Intronic
1150203224 17:63378563-63378585 CATGATTTGCAAGAAAACTAAGG + Intronic
1153505012 18:5788060-5788082 CATGATTTTCAGGTCATGTCAGG - Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1156703554 18:39853128-39853150 CATGATCTGGAGGCTATTTAGGG + Intergenic
1158628284 18:59090318-59090340 CATGGTTTGCAGGCAATCTTCGG + Intergenic
1160375254 18:78406499-78406521 CATGATGAGCAGGCAAGGAAAGG + Intergenic
1161601823 19:5188852-5188874 CATGATTTGCAGGCAATGTAGGG + Intronic
1162887369 19:13705684-13705706 CAGGATTTGCCAGCTATGTACGG + Intergenic
1163886634 19:19971270-19971292 CATGTTTTTCAGGCAATGAGTGG + Intergenic
1163985100 19:20939083-20939105 AATCATTGGCAGGCACTGTATGG - Intronic
1165058278 19:33192681-33192703 CATGTTTTGCACGTTATGTAAGG - Intronic
1165549364 19:36570777-36570799 CTTGATTTACAGAAAATGTATGG + Intronic
1165775030 19:38399276-38399298 CCTGATTTGGGGGCAATGAAGGG - Intergenic
925606606 2:5666684-5666706 CATCATTTGAAGGCATTGAAAGG - Intergenic
927471010 2:23376703-23376725 CATGATTTCTAGACAATGGAAGG - Intergenic
935723749 2:106003736-106003758 CAGGCTCTGCAGGCCATGTATGG - Intergenic
938650456 2:133377658-133377680 CATTATTTCCAGGCAAATTAGGG - Intronic
939523614 2:143263761-143263783 ACTGATTTCCAGGCAATGGAAGG - Intronic
941722128 2:168823474-168823496 GATGATTTGCTGGCAATCTTTGG + Intronic
942653354 2:178191647-178191669 CATACTTTGCAGACAAGGTATGG - Intergenic
943706925 2:191045760-191045782 AACTATCTGCAGGCAATGTAAGG - Intronic
947244313 2:228030185-228030207 CCTGATGTGCATGCAATGTGGGG + Intronic
1172316372 20:33958098-33958120 CATGATTTGGAGGCCAGGCACGG - Intergenic
1173396760 20:42687534-42687556 CCTGATTAGCAGGCAAGGAAAGG - Intronic
1174231482 20:49048713-49048735 AAGGCTTTGTAGGCAATGTAAGG + Intronic
1174853579 20:54021034-54021056 AATGATTTCCAGACAATGTTAGG + Intronic
949164040 3:915479-915501 CATGATTTGGATGCAATCTTAGG - Intergenic
950968805 3:17166227-17166249 CAGGATTTGCAGGCAACATATGG - Intronic
951002052 3:17574253-17574275 CTTAATTTGGAGGCAATGGAAGG - Intronic
951389978 3:22090838-22090860 CAAGATTTGCAGGCCAAGGAAGG - Intronic
957710342 3:83849607-83849629 CATGACTTGCAGGCTAAATATGG + Intergenic
959667733 3:108940545-108940567 CATGATTGGCAGCCATTGCAAGG + Intronic
960808208 3:121604408-121604430 CATGTTTTGCATGGAATGTAGGG - Intronic
960961327 3:123072488-123072510 CATGATTTGAATGCCAGGTACGG + Intronic
962981364 3:140493389-140493411 AATCATTTACAGGCAATATAGGG + Intronic
964041061 3:152262362-152262384 CATGATTTGAAGGTAATTTCAGG + Intronic
971449119 4:26783817-26783839 CATGGTTGCCAGGCATTGTAGGG - Intergenic
974436035 4:61858216-61858238 CAGTCTTTGCAGGCTATGTATGG + Intronic
977305490 4:95318675-95318697 CAGGAATGGCAGGCAATGAATGG - Intronic
978041277 4:104065959-104065981 CAGGAATTGCAGACAATGAAGGG - Intergenic
981073765 4:140570911-140570933 CATGATATGGATGCAATGAAAGG + Intergenic
989640857 5:43581678-43581700 CATGATTTTCAGGTCATATAAGG - Intergenic
991236481 5:64405457-64405479 AAAGATTTTCAGGCAATATAGGG + Intergenic
996460670 5:123737904-123737926 CAATATTTGCAGGTATTGTAAGG + Intergenic
998893297 5:146769498-146769520 CTAGATTTGCAAGCACTGTAAGG + Intronic
1000709519 5:164554332-164554354 CATGATTTCTAGGTAATGTTCGG + Intergenic
1001248562 5:170125364-170125386 CATACTTTGCAGGAAATGGAGGG - Intergenic
1002330926 5:178440100-178440122 CATGATTTTTAGTAAATGTATGG - Intronic
1008558031 6:52694243-52694265 CATGGTGTGCAGGCCATGCAAGG + Intergenic
1011859086 6:91733027-91733049 CAAGATTCGTAGGCAATCTAAGG - Intergenic
1013452043 6:110291921-110291943 CTTGATTTCAAGACAATGTAAGG - Intronic
1015195356 6:130519471-130519493 CATAATTTGATGTCAATGTAAGG - Intergenic
1017496643 6:154989457-154989479 AATGGTTTGAAGGCAATGGAGGG + Intronic
1021318229 7:19177913-19177935 TATGATTTGCTGCCAATTTAAGG - Intergenic
1021408992 7:20306718-20306740 TAGGAATTGCAGGCAATGTTAGG - Intergenic
1021421299 7:20448177-20448199 GATGATTGGCAGGGAATGTTGGG + Intergenic
1023227754 7:37989281-37989303 CATGCTTTGCTGCCAGTGTAAGG + Intronic
1035626880 8:1077079-1077101 CCTGATTTGCTGTCAATGTTTGG + Intergenic
1035966636 8:4199282-4199304 ATTGATATGCAGGCAGTGTATGG + Intronic
1038902782 8:31862851-31862873 CTTAATTTGCAGGCACTGTGGGG + Intronic
1040724899 8:50370608-50370630 TAGGTTTTTCAGGCAATGTAAGG - Intronic
1041404189 8:57479705-57479727 CCTGTTTTGCAGGCAACCTACGG - Intergenic
1045075795 8:98566434-98566456 CATAATTTTCAGAAAATGTATGG - Intronic
1047497867 8:125421352-125421374 CAGTGTTTGCAGGCATTGTAGGG - Intergenic
1048550019 8:135425479-135425501 CATTATTTGGAGGCAACGAAAGG + Intergenic
1055278588 9:74648261-74648283 CACCCTTTGCAGGCAATTTAGGG + Intronic
1055997968 9:82182216-82182238 CAGGATTTGGAGGCAATAGAAGG + Intergenic
1058025183 9:100135204-100135226 CATTATTTGTAGGGAAGGTAAGG + Intronic
1058449386 9:105081827-105081849 TAAGCTTTGCAGGCTATGTAAGG + Intergenic
1186368730 X:8924843-8924865 AATGTTTTGCAAGCAATATAAGG + Intergenic
1186970053 X:14832246-14832268 GGTGATTTGCAGGCAATATTTGG + Intergenic
1187023096 X:15405181-15405203 AATGAATTGCAGGGAATGAAGGG - Intronic
1187304171 X:18080131-18080153 TATGACTTGCAGGCAAATTAAGG + Intergenic
1187515972 X:19970524-19970546 TAGGCTTTGCAGGCCATGTAAGG + Intergenic
1188206390 X:27364208-27364230 AATGATTTGCTGGCAATCTTTGG + Intergenic
1188822460 X:34792250-34792272 CATGATTTAAAGACAATGTATGG - Intergenic
1188996582 X:36893755-36893777 TAAGATTTGGAAGCAATGTAAGG + Intergenic
1196188077 X:112765622-112765644 CATGATTTCCAGGAAATGAAAGG - Intergenic