ID: 1161601864

View in Genome Browser
Species Human (GRCh38)
Location 19:5189015-5189037
Sequence GAGACACTCAGCCTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 311}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161601858_1161601864 10 Left 1161601858 19:5188982-5189004 CCACGGGGCAGAAAATCCAGCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG 0: 1
1: 0
2: 4
3: 34
4: 311
1161601848_1161601864 29 Left 1161601848 19:5188963-5188985 CCCACCACCCCATCTCTTCCCAC 0: 1
1: 0
2: 6
3: 83
4: 820
Right 1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG 0: 1
1: 0
2: 4
3: 34
4: 311
1161601861_1161601864 -10 Left 1161601861 19:5189002-5189024 CCTTGCGGTATCCGAGACACTCA 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG 0: 1
1: 0
2: 4
3: 34
4: 311
1161601856_1161601864 20 Left 1161601856 19:5188972-5188994 CCATCTCTTCCCACGGGGCAGAA 0: 1
1: 0
2: 0
3: 22
4: 149
Right 1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG 0: 1
1: 0
2: 4
3: 34
4: 311
1161601855_1161601864 21 Left 1161601855 19:5188971-5188993 CCCATCTCTTCCCACGGGGCAGA 0: 1
1: 0
2: 2
3: 14
4: 166
Right 1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG 0: 1
1: 0
2: 4
3: 34
4: 311
1161601852_1161601864 25 Left 1161601852 19:5188967-5188989 CCACCCCATCTCTTCCCACGGGG 0: 1
1: 0
2: 2
3: 23
4: 276
Right 1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG 0: 1
1: 0
2: 4
3: 34
4: 311
1161601849_1161601864 28 Left 1161601849 19:5188964-5188986 CCACCACCCCATCTCTTCCCACG 0: 1
1: 0
2: 3
3: 64
4: 662
Right 1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG 0: 1
1: 0
2: 4
3: 34
4: 311
1161601860_1161601864 -6 Left 1161601860 19:5188998-5189020 CCAGCCTTGCGGTATCCGAGACA 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG 0: 1
1: 0
2: 4
3: 34
4: 311
1161601854_1161601864 22 Left 1161601854 19:5188970-5188992 CCCCATCTCTTCCCACGGGGCAG 0: 1
1: 0
2: 1
3: 24
4: 200
Right 1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG 0: 1
1: 0
2: 4
3: 34
4: 311
1161601857_1161601864 11 Left 1161601857 19:5188981-5189003 CCCACGGGGCAGAAAATCCAGCC 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG 0: 1
1: 0
2: 4
3: 34
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161601864 Original CRISPR GAGACACTCAGCCTGGAGCC TGG Intronic
900353234 1:2247313-2247335 GGCGCCCTCAGCCTGGAGCCAGG + Intronic
900502879 1:3015251-3015273 GGGACACTAAGTCTGGAGGCTGG - Intergenic
900530970 1:3153024-3153046 GAACCAGTCAGCCTGGGGCCGGG + Intronic
901182696 1:7352498-7352520 GCCACACACAGCCTGGAGCTGGG - Intronic
902404683 1:16176093-16176115 GTCACACTCCGCCTGGGGCCTGG + Intergenic
902448161 1:16480453-16480475 AAAACACTCAGCCAAGAGCCTGG + Intergenic
902793535 1:18785194-18785216 GAGGAGCTGAGCCTGGAGCCTGG - Intergenic
903736357 1:25532156-25532178 GAGACATACAGCATGGAGACAGG - Intergenic
904160731 1:28520373-28520395 TAGACAGTCTGCCCGGAGCCTGG - Intronic
904255402 1:29251483-29251505 GGGACAGTCAGCTGGGAGCCAGG + Intronic
904279415 1:29408447-29408469 GAGTCACTCTGACTGGAGACTGG + Intergenic
904292532 1:29497301-29497323 GACACACTGTGGCTGGAGCCAGG - Intergenic
904498305 1:30900107-30900129 AGGACTCTGAGCCTGGAGCCTGG - Intronic
904563468 1:31413595-31413617 GAGAGACTAAGCCTGGAGCCCGG + Intronic
905172250 1:36116181-36116203 GAGAGACTGAGACTGGGGCCGGG - Intronic
905225175 1:36474011-36474033 GAGCCACTCTGCCTGGAGACAGG - Intronic
906149717 1:43580624-43580646 CAGACACTCTGCCTGGGGCAGGG - Intronic
907972945 1:59402688-59402710 GGGACACTGAGCCTTGAGACAGG + Intronic
909543509 1:76817478-76817500 AAGACACCCAGGCTGGAGGCTGG + Intergenic
913178849 1:116299717-116299739 GGGAAAGTCAGCCTGGAGGCAGG - Intergenic
913538395 1:119795859-119795881 GAGACAGTCAGTCTCAAGCCTGG - Intronic
915526658 1:156480284-156480306 GAGACACTCAGCCTTGTGTAGGG - Intronic
919782256 1:201228600-201228622 GAGTGACTTAGCTTGGAGCCAGG - Exonic
920198810 1:204246711-204246733 GAAACAGTCTGCCTGGAGGCAGG - Intronic
920851358 1:209630256-209630278 GAGATTCTCATCCTGGAGACAGG - Intronic
921001329 1:211046693-211046715 GAGGTACTCAGCCTGGAACCTGG - Intronic
922720491 1:227897577-227897599 GAGCCATTCAGCCTGGAGGGAGG - Intergenic
923092013 1:230747934-230747956 GAGTCAGACAGCTTGGAGCCGGG - Intronic
1067688864 10:48487780-48487802 GAGCCACTGTGCCTGGTGCCTGG - Intronic
1069815394 10:71190705-71190727 GAGACACCCAGCATAGTGCCTGG - Intergenic
1069874277 10:71552088-71552110 GAGACACACAGCCTGAGGCCTGG - Intronic
1070675740 10:78410195-78410217 GAGAAGATCAGCCTGGAGCATGG - Intergenic
1070799758 10:79238338-79238360 GGGCCACTCATCCTGGACCCAGG - Intronic
1071288137 10:84167556-84167578 AAGACAGGCAGCCTGGTGCCAGG - Intergenic
1071309495 10:84328944-84328966 GAGAGGCTCACCCTGGAGGCCGG - Intronic
1072717702 10:97762584-97762606 GATGCACTCAGCATGGTGCCTGG - Intergenic
1072756258 10:98023180-98023202 GAGAAACTCAGCCTTGCTCCAGG + Intronic
1073123307 10:101134813-101134835 CAGACCCTCTGCCGGGAGCCCGG - Intronic
1073126813 10:101155976-101155998 GAGACAGTCAGGCTGGGGCTGGG + Intergenic
1073138647 10:101233523-101233545 AAAACTCTTAGCCTGGAGCCAGG - Intergenic
1073147454 10:101290156-101290178 GAGACCCACAGCCTGGGGACAGG - Intergenic
1073344343 10:102771066-102771088 GAGATACTTAGCATGGAGTCTGG + Intronic
1073543032 10:104327869-104327891 GCGACACGGGGCCTGGAGCCAGG - Intronic
1074183467 10:111082387-111082409 GGGACACACAGCCTGGGTCCTGG - Intergenic
1074674043 10:115828020-115828042 GAAACACCAAGCCTGAAGCCGGG + Intronic
1075295575 10:121272150-121272172 GAGACAGGCAGCCGGGAGGCCGG + Intergenic
1075765020 10:124886325-124886347 GAGATTCTCAGCCCTGAGCCAGG - Intergenic
1077326010 11:1964427-1964449 CAGCTTCTCAGCCTGGAGCCAGG + Intronic
1077635728 11:3840606-3840628 GAGACACTTATCTTGGAGCCCGG + Intronic
1078618854 11:12889445-12889467 GAGACACACAGCCTGGTGACCGG - Intronic
1079125254 11:17714298-17714320 GAGGCACTCAGGTTGGACCCAGG + Intergenic
1080986068 11:37467571-37467593 GAGAGGTTCAGCTTGGAGCCAGG + Intergenic
1083426951 11:62593057-62593079 GAGATAGGCAGCCTGGACCCAGG - Intergenic
1083670391 11:64296937-64296959 CAGCCACTCAGCCTGGGACCTGG + Exonic
1083694744 11:64435196-64435218 CAGACACTCAGGATGGGGCCAGG - Intergenic
1084023473 11:66432705-66432727 GAGACACCCAGCCTGTGGCCAGG - Intergenic
1084398106 11:68927880-68927902 GAAACCCTCAGCCTGAAGTCAGG - Intronic
1084556827 11:69880535-69880557 CAGACAGGCAGCCTGGAGGCTGG - Intergenic
1084696048 11:70756186-70756208 GAGACCTCCAGCCTGGAGTCTGG - Intronic
1085240459 11:75049761-75049783 AAGACAGGCAGCCTGGCGCCAGG - Intergenic
1085336995 11:75703871-75703893 TAGAGAGTCAGCCTGGAGACTGG - Intergenic
1088876758 11:113942688-113942710 GAGCCACTGAGTCTGGTGCCTGG + Intronic
1089393608 11:118118706-118118728 GTGATAATCAGCCAGGAGCCAGG + Exonic
1089720332 11:120412673-120412695 GGGACACTTAGACTGGAGACTGG - Intronic
1089993076 11:122879981-122880003 GAGACCCCAAGCCTGGAGACTGG + Intergenic
1090930816 11:131296579-131296601 GACACACTCAGACTAGTGCCTGG + Intergenic
1202808990 11_KI270721v1_random:19606-19628 CAGCTTCTCAGCCTGGAGCCAGG + Intergenic
1096526078 12:52211186-52211208 GAGACACTCAGCCGGGGGTGGGG - Intergenic
1096552674 12:52383625-52383647 GTTCCTCTCAGCCTGGAGCCGGG + Exonic
1098619533 12:72577410-72577432 GAGAGCCACAGCCTGGATCCAGG + Intronic
1098639155 12:72818679-72818701 AAGACAGGCAGCCTGGTGCCAGG - Intergenic
1100487084 12:95040465-95040487 AAAACACTCACCCTAGAGCCTGG + Exonic
1101558860 12:105836701-105836723 CAGGCACTTAGGCTGGAGCCTGG - Intergenic
1102223353 12:111209934-111209956 CAGACAGACAGCCCGGAGCCCGG - Intronic
1102252464 12:111396961-111396983 GAGGCATCCAACCTGGAGCCTGG + Intergenic
1102770372 12:115470885-115470907 GACACAGTCAGTCAGGAGCCAGG + Intergenic
1103208318 12:119147966-119147988 CAGACACTCAGCCTGGTGCTGGG + Intronic
1104388737 12:128373967-128373989 GGGCCACCCAGCCTGGACCCTGG + Intronic
1104693325 12:130843121-130843143 GAGAAAATCTGACTGGAGCCTGG + Intergenic
1104950195 12:132436546-132436568 GAGACCCTCAGCCTGAAGGAGGG + Intergenic
1106186977 13:27418236-27418258 GAGGCCCTCAGTCGGGAGCCCGG - Intergenic
1106232937 13:27835781-27835803 GAGAAACTCAGTCTGGAGTCAGG - Intergenic
1106294013 13:28393621-28393643 CTGACACTCAGGCTGGAGCATGG + Intronic
1107997074 13:45871495-45871517 AAGACAGGCAGCCTGGCGCCAGG - Intergenic
1112737789 13:102440528-102440550 AAGACAGGCAGCCTGGCGCCAGG - Intergenic
1113612226 13:111655227-111655249 GAGGTACTCAGCATGGTGCCTGG - Intronic
1114152267 14:20056316-20056338 GAAACACTTAGAATGGAGCCTGG + Intergenic
1114532489 14:23404535-23404557 GAGACACTCACCCTGAGGTCTGG - Intronic
1115506218 14:34096661-34096683 GACACACTCAGCATGGACCAAGG - Intronic
1116013986 14:39384672-39384694 GGCACACTCAGCCAGGTGCCTGG + Intronic
1116024012 14:39494543-39494565 ATGACACTCAGCCTAGAGTCTGG - Intergenic
1117665436 14:58051774-58051796 TGGACACTAAGCTTGGAGCCTGG - Intronic
1119325178 14:73755571-73755593 GAGCAGCTCAGCCTGGGGCCTGG + Intronic
1119667205 14:76493493-76493515 AAAGCACTCAGCCTGGTGCCTGG + Intronic
1121707867 14:96012959-96012981 AAGACAGGCAGCCTGGTGCCAGG + Intergenic
1122289115 14:100670261-100670283 AAAACACTCAGCGTGGTGCCTGG + Intergenic
1122813709 14:104301856-104301878 GAGCCACTCCACCTGGTGCCGGG + Intergenic
1123945074 15:25235033-25235055 GTGACTCTCCTCCTGGAGCCTGG + Intergenic
1124087352 15:26563297-26563319 GTGCCAATCAGCCTGGATCCAGG - Intronic
1124512760 15:30340666-30340688 GAGACACTCAGGGCAGAGCCTGG + Intergenic
1124730155 15:32190084-32190106 GAGACACTCAGGGCAGAGCCTGG - Intergenic
1124966008 15:34434144-34434166 GAGCCTGTCTGCCTGGAGCCAGG + Intronic
1124982628 15:34580243-34580265 GAGCCTGTCTGCCTGGAGCCAGG + Intronic
1125549594 15:40535653-40535675 GAGAGACTTAGCAAGGAGCCTGG - Intronic
1125653710 15:41338669-41338691 GAGCCACTGCGCCTGGCGCCTGG - Intronic
1125761274 15:42097214-42097236 GAGGCAGTCAGCCTGGAACAGGG + Intergenic
1125768215 15:42149071-42149093 GAGACAGCCAGCCTGTGGCCAGG - Intronic
1125891684 15:43271216-43271238 GAGACAGTCACCCTGGAGAAGGG + Intergenic
1126231311 15:46329100-46329122 GAGACACTCAGACTGAAAGCAGG - Intergenic
1126817259 15:52466248-52466270 GAGAGACTCAGGCTGGGGCTTGG + Intronic
1128426411 15:67545947-67545969 AAGCCAGTCAGCCTTGAGCCAGG - Intronic
1128471536 15:67957709-67957731 GAGAAACTCAGGCAGGTGCCTGG - Intergenic
1129756219 15:78100895-78100917 GAGACACTCTGATGGGAGCCTGG - Exonic
1131144305 15:90001603-90001625 GGGACACTCACCCTGGGTCCGGG - Exonic
1131253051 15:90843423-90843445 AAGACACTCAGCATCGTGCCTGG + Intergenic
1132121378 15:99179002-99179024 GAGATACACAGCCTGGACCAGGG - Intronic
1132539539 16:502060-502082 CAGGCTGTCAGCCTGGAGCCTGG + Intronic
1132579284 16:677728-677750 GGGCCTCTCAGCCTGCAGCCAGG + Intronic
1132623517 16:879374-879396 GAGACCCTCAGCCTGCAGCCCGG + Intronic
1132623988 16:881416-881438 GGGACACTCAGCCCGCGGCCAGG + Intronic
1132767279 16:1540893-1540915 CAGACACTCAGCCTGGAGTCAGG - Intronic
1133153439 16:3854327-3854349 GTGACAATCACCCTGTAGCCAGG + Intronic
1134021135 16:10922377-10922399 GAGAAACTCACCTTGGGGCCTGG - Intronic
1134669097 16:16041463-16041485 GAGATCCTCAGCGTGGAGCCAGG + Intronic
1134976502 16:18574892-18574914 GATGCCCTCAGTCTGGAGCCCGG + Intergenic
1135647953 16:24179906-24179928 CAGGCACTATGCCTGGAGCCAGG - Intronic
1135990288 16:27214685-27214707 GAGCCACACAGCCTTGAGCAGGG + Intronic
1139647065 16:68339009-68339031 GGGACACTGAGCCCAGAGCCAGG + Intronic
1139973705 16:70792244-70792266 GAGACACTAAACCTGGAACTGGG - Intronic
1141891134 16:86927074-86927096 GAGTGTCCCAGCCTGGAGCCGGG - Intergenic
1143551889 17:7635410-7635432 GAGTGACTCAGCCTGCTGCCTGG - Intergenic
1144740788 17:17581036-17581058 GGGACACTGAGCCTGGGGCCAGG + Intronic
1146624842 17:34427411-34427433 AACACACTCAGCCTGGTGCCTGG + Intergenic
1147263042 17:39219855-39219877 AAGTCCCTCTGCCTGGAGCCAGG - Intronic
1148329607 17:46805887-46805909 GAGACAAACTGCCTGAAGCCAGG - Intronic
1148608043 17:48944870-48944892 GAGACACTCAGCCTCGCGGCAGG - Exonic
1149536410 17:57436975-57436997 GACACTTACAGCCTGGAGCCTGG + Intronic
1149541741 17:57472713-57472735 GAAACACTCAGCGTGGATCCTGG + Intronic
1150438111 17:65169743-65169765 GAGCCACTCAGCCACTAGCCTGG - Intronic
1150462057 17:65361492-65361514 CAGACACTCAGGCAGGAGGCTGG + Intergenic
1150772587 17:68054206-68054228 GATACTCTCAGCCTGGGACCTGG - Intergenic
1151697238 17:75723871-75723893 GAGATGCTCAGCCTGAAGCCTGG - Intronic
1152206452 17:78977039-78977061 GAGATATTCTGCCTGGGGCCCGG - Intronic
1153046834 18:863651-863673 GAGAGACTCAGACTGCAGCAGGG + Intergenic
1153978677 18:10291151-10291173 GAGACACTCTTCCCTGAGCCTGG + Intergenic
1154411935 18:14146306-14146328 CTCACCCTCAGCCTGGAGCCTGG - Intergenic
1156298003 18:35810000-35810022 GAAGCACTCAGCCCAGAGCCTGG + Intergenic
1156315513 18:35965513-35965535 GAGACTCTCAACTGGGAGCCAGG + Intergenic
1156488542 18:37482379-37482401 GAGTCACTCTGCCTGGATTCTGG + Intronic
1157451471 18:47792260-47792282 GAGAGGCTCAGCCTGGAGGAAGG + Intergenic
1157606917 18:48931786-48931808 GAGACACTCGGCCTCAACCCAGG + Intronic
1159671455 18:71226264-71226286 CAGAAGCTCAGCCTGGGGCCTGG + Intergenic
1160450878 18:78965324-78965346 GAGGAGCTGAGCCTGGAGCCAGG - Intergenic
1160523758 18:79523705-79523727 GAGGCTCTCAGCCTGCAGCCAGG + Intronic
1160552400 18:79702994-79703016 GAGACCCTGAGGCTGGTGCCTGG + Intronic
1160731847 19:644809-644831 GAGCCCCACAGCCTGGAGCCAGG + Intergenic
1161215659 19:3094157-3094179 GGGACGCGCAGCCGGGAGCCGGG - Intergenic
1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG + Intronic
1161918293 19:7247169-7247191 GAGACACTCAGTGCTGAGCCAGG + Intronic
1163577049 19:18117129-18117151 GAGACACAGAGCCTGGAACAGGG - Intronic
1163907703 19:20161518-20161540 AAGACAGGCAGCCTGGCGCCAGG + Intergenic
1163934725 19:20432491-20432513 AAGACAGGCAGCCTGGCGCCAGG - Intergenic
1164804947 19:31109357-31109379 GAGACTTTCTGCCAGGAGCCAGG + Intergenic
1165786519 19:38464945-38464967 CAGACCCTGAGCCTGGATCCTGG - Intronic
1165872295 19:38981408-38981430 GAAGCACTCAGCCGGGAGCCTGG + Intergenic
1168155247 19:54470634-54470656 GAGGCACTCAGGCTGGTGCCTGG - Intronic
925310127 2:2876043-2876065 GGGACACCCAGCCTGTACCCAGG - Intergenic
926383033 2:12310107-12310129 GAGAGAGTCAGCTTGGAGACAGG + Intergenic
927505967 2:23615111-23615133 AAGACACTGAACCTGGTGCCTGG + Intronic
927666424 2:25036056-25036078 AAGTCACCCAGCCTGGAGGCAGG + Intergenic
930002039 2:46868050-46868072 GTGACACTCAGCACAGAGCCAGG - Intergenic
930200299 2:48546313-48546335 GAGACAGCCAAGCTGGAGCCAGG - Intronic
932480648 2:72037064-72037086 GAGCACTTCAGCCTGGAGCCAGG + Intergenic
933973269 2:87487475-87487497 GAGCCTCACAGCCTGGAGGCTGG + Intergenic
934141399 2:89051046-89051068 GAGACAGGCAGCCCGGCGCCAGG + Intergenic
934227843 2:90149498-90149520 GAGACAGGCAGCCCGGCGCCAGG - Intergenic
936317322 2:111434680-111434702 GAGAACCGCAGCCTAGAGCCAGG - Intergenic
936320452 2:111462736-111462758 GAGCCTCACAGCCTGGAGGCTGG - Intergenic
937220703 2:120341740-120341762 GACGGCCTCAGCCTGGAGCCAGG - Intergenic
937413851 2:121698919-121698941 GAGTCACTGTGCCTGGACCCAGG - Intergenic
937881075 2:126865334-126865356 CGGACACTCAGCAGGGAGCCTGG - Intergenic
941618333 2:167748935-167748957 TGCACACTCAGCATGGAGCCTGG - Intergenic
943767845 2:191680860-191680882 AACACACTCAGCTTGGAGTCTGG + Intronic
948057664 2:235020895-235020917 GGGACACTCTGCCTAGAGTCTGG - Intronic
948283696 2:236768352-236768374 AAGACACTCAGCCCTGAGCCTGG - Intergenic
948362161 2:237429918-237429940 GAGGCACCCAGCCAGGAGGCGGG + Intergenic
948395507 2:237642406-237642428 GAAACCCTTAGCCTGGAACCTGG - Intronic
948395520 2:237642455-237642477 GAAACCCTCAGCCTGGAACCTGG - Intronic
948395528 2:237642483-237642505 GAAACCCTTAGCCTGGAACCCGG - Intronic
948395536 2:237642511-237642533 GAAACCCTTAGCCTGGAACCCGG - Intronic
948462751 2:238138317-238138339 GAGACCCTCAGCCCAGGGCCAGG - Intergenic
948602000 2:239112560-239112582 GGGGCACTCAGCCAGGGGCCTGG + Intronic
948686825 2:239675275-239675297 GAGGCACTCAGACTGGAGGGGGG + Intergenic
948692447 2:239715240-239715262 GAGAGACTATGCCTGGCGCCTGG + Intergenic
948835331 2:240623634-240623656 GTCCCACCCAGCCTGGAGCCTGG - Intronic
948939577 2:241189175-241189197 GAGGCTCCCAGCCTGGGGCCGGG + Intronic
1169488671 20:6053719-6053741 GAGACCCTTCCCCTGGAGCCTGG - Intronic
1170579175 20:17684942-17684964 GAGAGCCCCAGCCTGGAGGCTGG - Intergenic
1170839182 20:19909836-19909858 GAGGCACTCAGCAGGCAGCCTGG + Intronic
1171351663 20:24507313-24507335 GAGACACACAGCCGGGCACCAGG + Intronic
1172276163 20:33680469-33680491 GAGGCACCCAGCCTTAAGCCAGG - Intronic
1172481465 20:35274319-35274341 CAGAAACTGAGCGTGGAGCCAGG + Exonic
1172651534 20:36506180-36506202 GAGACAGTAAGCCTGGGGCAGGG + Intronic
1172897046 20:38307517-38307539 GAGAGGCACAGCCTGGAGCAGGG - Intronic
1172903420 20:38351086-38351108 AAGACACTCATCCAAGAGCCAGG - Intronic
1173016923 20:39234283-39234305 CAGCCACTCAGCCTGTGGCCTGG - Intergenic
1173943939 20:46935042-46935064 GAGACGCTGAGTCTGGAGGCAGG + Intronic
1174112932 20:48208543-48208565 GAGACACTCGTCTTGCAGCCTGG - Intergenic
1174444029 20:50578531-50578553 GGGTCACTCAGCCCGGAGCACGG + Exonic
1174492008 20:50906503-50906525 GAGCCACTCATCCAGGAGGCAGG - Intronic
1174571561 20:51505726-51505748 ACGACACCCAGCCTGCAGCCTGG - Intronic
1175097930 20:56556782-56556804 GAAACCCTTAGCATGGAGCCTGG + Intergenic
1175263409 20:57688736-57688758 CAAACACTAAGCCTAGAGCCAGG + Intronic
1175303728 20:57961385-57961407 CAGACAGCCAGCCCGGAGCCTGG + Intergenic
1179791640 21:43759332-43759354 GAGAGAATGAGGCTGGAGCCAGG - Exonic
1180259724 21:46661010-46661032 GAAACACTCAGACCAGAGCCTGG + Intronic
1180673135 22:17569032-17569054 GAGTCGCCCAGCCTGTAGCCAGG + Intronic
1181093416 22:20489783-20489805 GAGACACACAGCCAGGAGTCTGG + Intronic
1182086837 22:27566785-27566807 GGGACACTCAGCCTGTGTCCTGG - Intergenic
1182258014 22:29051852-29051874 GAGTCGCTCAGGCTGGAGCGCGG - Intronic
1182444434 22:30381886-30381908 AAGGCACTCAGCCTGGAGCTTGG - Intronic
1183586766 22:38757303-38757325 CAGACACTCAGACCAGAGCCAGG - Intronic
1183640480 22:39089656-39089678 GACAGACACAGCCTGGGGCCTGG - Intergenic
1184271199 22:43385253-43385275 GAGACCCCCAGCCTGAAACCTGG - Intergenic
1184342575 22:43894004-43894026 CAGAAACTCAGCCTGGCTCCAGG - Intergenic
1184655976 22:45942214-45942236 GAGACCCCCAGCCTGGACACGGG - Intronic
1184677785 22:46053154-46053176 AAGACCCTCAGCCTGGAGGGCGG - Intronic
1184792110 22:46706520-46706542 GTGTCTCCCAGCCTGGAGCCAGG + Intronic
1184881102 22:47304613-47304635 GTGACACTCAGCCCAGACCCAGG + Intergenic
1185056347 22:48580608-48580630 TAGACACTCAGAATGGAGCCCGG - Intronic
1185289672 22:50017133-50017155 GAGTGACTCAGCCTGGGGCTCGG - Intronic
950133567 3:10564493-10564515 GACAAGATCAGCCTGGAGCCAGG - Intronic
950675448 3:14551546-14551568 GGCTCACTCAGCCTGGAGCAGGG + Intergenic
950715598 3:14845632-14845654 GAGACCCAGACCCTGGAGCCTGG + Intronic
951962830 3:28348590-28348612 GAGTCACTCACCCAGAAGCCAGG + Exonic
952991621 3:38835756-38835778 TAGAAACACAGCCTGGAGCAGGG + Intergenic
953735457 3:45490395-45490417 TAGATATTCAGCCTAGAGCCAGG - Intronic
954581903 3:51707481-51707503 GAGTCAGACAGCCAGGAGCCTGG - Intronic
954981733 3:54752073-54752095 GAGAGACACAGCCTGTGGCCAGG - Intronic
955000265 3:54920928-54920950 GAAATACCCAGACTGGAGCCTGG + Intronic
955070085 3:55565431-55565453 GGGACACTCTGCCTGTGGCCTGG - Intronic
955971718 3:64444236-64444258 GTGAAACGCAGCCTTGAGCCCGG + Intronic
960589775 3:119354120-119354142 GAGCAAGGCAGCCTGGAGCCCGG - Intronic
960620522 3:119632599-119632621 GAAACACTCAGAATGGTGCCTGG - Intergenic
960955221 3:123026847-123026869 GAGCCACTGCCCCTGGAGCCTGG + Intronic
961044530 3:123699605-123699627 GGGACACAGAGGCTGGAGCCAGG - Intronic
962909673 3:139836544-139836566 GAGACACTCAGACTCCAGCAGGG + Intergenic
963199807 3:142574752-142574774 GGGACACTCAGCCCTGAGCAGGG + Intronic
964982951 3:162709289-162709311 AAGACAGGCAGCCTGGCGCCAGG - Intergenic
965267357 3:166560923-166560945 GAAACACACAGACTGGATCCAGG + Intergenic
967100286 3:186210430-186210452 GGGACACACAACCTGGCGCCTGG + Intronic
969110080 4:4839088-4839110 GACACACACAGCCGGGAGCTGGG - Intergenic
969219359 4:5749581-5749603 GAGTCACTCAGCATCTAGCCAGG - Intronic
969557121 4:7919138-7919160 GAGACACTCAGCCCGGCCCCCGG + Intronic
969851896 4:9963997-9964019 GAGATAAAGAGCCTGGAGCCAGG + Intronic
971209418 4:24601475-24601497 GAGTCACTGAGTCTGGAGCAGGG + Intergenic
971253572 4:24993413-24993435 GTAACACTCTGCCTGGTGCCTGG + Intergenic
971757502 4:30721612-30721634 GTGACTTTCAGCCTGGAGTCCGG + Exonic
972274693 4:37546277-37546299 AAGACAGGCAGCCTGGCGCCAGG + Intronic
973769147 4:54190712-54190734 GAGACACTGAGATGGGAGCCGGG - Intronic
976139966 4:81981002-81981024 GCGACTCACAGCCAGGAGCCTGG + Intronic
976990542 4:91359326-91359348 AAGACAGGCAGCCTGGCGCCAGG - Intronic
977379842 4:96258436-96258458 TTGACACTCAGCTTGGAGCCTGG - Intergenic
977706488 4:100076623-100076645 GAGCCACTGTGCCTGGACCCAGG + Intergenic
978309244 4:107367717-107367739 GAGACAATCAGACTGAAACCTGG - Intergenic
978342627 4:107734450-107734472 GAGACACTGAGCCTGGAGCAGGG + Intergenic
978765294 4:112399145-112399167 GGGACACTCAGCCTGTACCATGG - Intronic
980994687 4:139769179-139769201 CAGTGACTCAGCCTGGAGCTGGG + Intronic
985579712 5:690219-690241 CAAACCCTCAGCCAGGAGCCAGG - Intronic
985594558 5:782278-782300 CAAACCCTCAGCCAGGAGCCAGG - Intergenic
985902153 5:2805077-2805099 CAGACATTCAGCCTGTAGCAGGG - Intergenic
987131002 5:14860134-14860156 AAGACACCTGGCCTGGAGCCTGG - Intronic
988000871 5:25346468-25346490 GAGACATTTGGTCTGGAGCCTGG + Intergenic
990057341 5:51599774-51599796 GAAAAACTGGGCCTGGAGCCAGG - Intergenic
990211102 5:53482001-53482023 GAGAGGCTCTGCCTGGTGCCCGG + Intronic
999302655 5:150500710-150500732 GAGCCCCTCAGCCTGTGGCCAGG - Intronic
1001638236 5:173227918-173227940 GAGACAAACTGCCTGGAGGCCGG - Intergenic
1001929070 5:175659810-175659832 GAGAAAGTGAGCCTGAAGCCTGG + Intronic
1002423332 5:179161972-179161994 GAGACACTCACACTGCAGCAGGG - Intronic
1003080271 6:3015954-3015976 GAGATACTCTCTCTGGAGCCAGG - Intronic
1003956361 6:11168980-11169002 GAAATACTCTACCTGGAGCCTGG - Intergenic
1006032386 6:31186661-31186683 AAGACAGGCAGCCTGGCGCCAGG - Intergenic
1007239896 6:40417298-40417320 GAGGCACTGAGCATGGAGACAGG - Intronic
1007382061 6:41496628-41496650 GAAACACACAGCCCGGTGCCTGG - Intergenic
1007481538 6:42153603-42153625 AAGACACTGAGCCTGGAGAGGGG + Intergenic
1007718616 6:43871935-43871957 GGGAGAATCAGCCAGGAGCCAGG + Intergenic
1007836567 6:44678469-44678491 GAGACACACACCCTGGAGCAGGG - Intergenic
1017223372 6:151991989-151992011 GAGAGACTCAGCCTGGTGTCAGG - Intronic
1017563645 6:155660812-155660834 GAAACACTCCGCATGGATCCAGG + Intergenic
1018031359 6:159844558-159844580 GAGCCAGTGAGTCTGGAGCCGGG + Intergenic
1018686163 6:166306856-166306878 GAGACCCTCTGCCTGGAGGCGGG - Exonic
1018763333 6:166909429-166909451 GAGACCCTCAACCTGGTGTCTGG - Intronic
1019348238 7:540992-541014 GAGACAGCCTGCCTGGATCCAGG - Intergenic
1019624127 7:2007207-2007229 GAGACACACAGATTGAAGCCAGG + Intronic
1019761230 7:2814301-2814323 GTGAGACTCACCCTGGACCCAGG + Intronic
1021081342 7:16369450-16369472 AAGACAGGCAGCCTGGTGCCAGG - Intronic
1022245449 7:28554655-28554677 CAGACACTGTGCCTGGAGGCAGG + Intronic
1022403689 7:30065947-30065969 CAGACACTGAGGCTGGGGCCTGG + Intronic
1023410747 7:39886841-39886863 GAGCCACTGCGCCTGGAGCCTGG + Intergenic
1024194427 7:47045222-47045244 GAGACAGAAAGCCTGCAGCCAGG + Intergenic
1026792351 7:73342529-73342551 GCGAGACTCAGCCCGGAGCCTGG + Intronic
1026930425 7:74220377-74220399 GAGACACACAGGCTGGGGCAGGG + Intronic
1029304278 7:99607319-99607341 GAGCCTCTCAGGGTGGAGCCTGG - Intronic
1029697377 7:102222776-102222798 GAGACACACAGCCAGGAGCTAGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1032003580 7:128282522-128282544 GAGACATTTAGCCTGGTCCCTGG - Intergenic
1032398901 7:131610184-131610206 CAGTCACCCAGCCTGGACCCAGG - Intergenic
1033719049 7:144037537-144037559 GAGACACTCTCCTTGGAGACTGG - Intergenic
1035394569 7:158526682-158526704 GACCCAGTCAGCCTGGATCCGGG - Intronic
1035584927 8:765137-765159 GAGAAACTCATCCTGAAACCTGG - Intergenic
1036923286 8:12878889-12878911 TACACAGCCAGCCTGGAGCCAGG - Intergenic
1037454854 8:19052996-19053018 GAGATGAGCAGCCTGGAGCCAGG + Intronic
1037744027 8:21629187-21629209 GGGACAGGCAGCCTGGAGACAGG - Intergenic
1040021080 8:42741884-42741906 AAGACAGGCAGCCTGGCGCCAGG - Intergenic
1044389484 8:91632738-91632760 AAAACACTTAGCCTGGTGCCTGG + Intergenic
1044738724 8:95304276-95304298 GAGACAGACTGCCAGGAGCCAGG - Intergenic
1044991318 8:97798668-97798690 GACACACTGAGCCAGCAGCCAGG + Intronic
1045028601 8:98114148-98114170 GTGTCACCCAGGCTGGAGCCGGG - Intronic
1045910964 8:107409456-107409478 GAGCCACTGAGCCTGGGTCCTGG - Intronic
1047197858 8:122737845-122737867 AAATCACTCAGCCTGGTGCCAGG + Intergenic
1047292006 8:123539925-123539947 GAGACTCTCAGCATTTAGCCCGG - Intronic
1048199026 8:132356120-132356142 GAGACTCTCAGCACAGAGCCAGG + Intronic
1048321918 8:133406662-133406684 GACACACCCTGCCTGGAGTCAGG + Intergenic
1048869463 8:138785227-138785249 GAGAAGCTCTGCGTGGAGCCAGG + Intronic
1049541862 8:143212311-143212333 GAGACGCTCAGGCTTGACCCTGG + Intergenic
1049645077 8:143732548-143732570 ATTACACACAGCCTGGAGCCTGG - Intronic
1052734303 9:32324626-32324648 AAAACACTCTGCTTGGAGCCTGG + Intergenic
1053511005 9:38687733-38687755 GAGACACCCCGCCCCGAGCCAGG - Intergenic
1054821297 9:69522972-69522994 GAGACCCTCATCCTGTAGCCAGG - Intronic
1056733730 9:89186445-89186467 GAAGCACTCAGCATGGTGCCAGG - Intergenic
1059395274 9:114030508-114030530 GAGACACTGAAGCTGGAGACCGG - Intronic
1060846036 9:126838507-126838529 GAGACACTCTGGGTGGAGCCTGG + Intergenic
1060938653 9:127530549-127530571 CTGACCCTCAGGCTGGAGCCAGG + Intronic
1061006621 9:127931705-127931727 CAGGCACTCAGCCAGGAGGCAGG - Intergenic
1061191196 9:129083685-129083707 GAGACACCCAGCTTGGTCCCTGG - Intronic
1061383817 9:130276514-130276536 GGGACACTCAGGGTGGAGCTGGG + Intergenic
1062104915 9:134750127-134750149 GAGGCACTGGGCCTTGAGCCTGG + Intronic
1062248803 9:135584058-135584080 CAGACACTCATCCTGGAGGAGGG - Intergenic
1062509996 9:136899879-136899901 GAGACACTGAGCCCGGCCCCTGG - Intronic
1062568405 9:137173354-137173376 GGCACACCCAGCCTGGGGCCAGG + Intergenic
1187398634 X:18939847-18939869 GAGTCAGCAAGCCTGGAGCCAGG - Intronic
1188803884 X:34563332-34563354 GAGATAATCAGCTAGGAGCCAGG - Intergenic
1188877104 X:35443322-35443344 AAGACAGGCAGCCTGGCGCCAGG - Intergenic
1189498430 X:41530566-41530588 GAGAAACTGATCCTGGGGCCTGG - Intronic
1193538805 X:82745850-82745872 AAGACAGGCAGCCTGGCGCCAGG + Intergenic
1197472644 X:126882423-126882445 GAGAAACACTGCCTTGAGCCTGG - Intergenic
1197597814 X:128488219-128488241 GACACACTTAAGCTGGAGCCAGG + Intergenic
1198045087 X:132893645-132893667 GAGACATTCACCCAGGAGCTAGG + Intronic
1199924593 X:152449599-152449621 CAGCAACTCAGCCTGGAGCCGGG - Intronic
1201373337 Y:13289329-13289351 AAGACAGGCAGCCTGGCGCCAGG + Intronic