ID: 1161602569

View in Genome Browser
Species Human (GRCh38)
Location 19:5193481-5193503
Sequence GCTCTTTGTCTGGGGGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161602560_1161602569 3 Left 1161602560 19:5193455-5193477 CCTTCCTTTGTGAGGTCCAGCTG No data
Right 1161602569 19:5193481-5193503 GCTCTTTGTCTGGGGGGCTGTGG No data
1161602561_1161602569 -1 Left 1161602561 19:5193459-5193481 CCTTTGTGAGGTCCAGCTGCTGG No data
Right 1161602569 19:5193481-5193503 GCTCTTTGTCTGGGGGGCTGTGG No data
1161602558_1161602569 26 Left 1161602558 19:5193432-5193454 CCTCAAGGCAAAGTGGCTTCGTG No data
Right 1161602569 19:5193481-5193503 GCTCTTTGTCTGGGGGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161602569 Original CRISPR GCTCTTTGTCTGGGGGGCTG TGG Intronic