ID: 1161602569

View in Genome Browser
Species Human (GRCh38)
Location 19:5193481-5193503
Sequence GCTCTTTGTCTGGGGGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161602560_1161602569 3 Left 1161602560 19:5193455-5193477 CCTTCCTTTGTGAGGTCCAGCTG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1161602569 19:5193481-5193503 GCTCTTTGTCTGGGGGGCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 366
1161602561_1161602569 -1 Left 1161602561 19:5193459-5193481 CCTTTGTGAGGTCCAGCTGCTGG 0: 1
1: 0
2: 3
3: 63
4: 191
Right 1161602569 19:5193481-5193503 GCTCTTTGTCTGGGGGGCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 366
1161602558_1161602569 26 Left 1161602558 19:5193432-5193454 CCTCAAGGCAAAGTGGCTTCGTG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1161602569 19:5193481-5193503 GCTCTTTGTCTGGGGGGCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161602569 Original CRISPR GCTCTTTGTCTGGGGGGCTG TGG Intronic
900164220 1:1238272-1238294 GGTCTTTGTTTGGGAGGCTGGGG - Intergenic
900537739 1:3187211-3187233 GCACTTTTTGTGGGGGGGTGGGG - Intronic
900694217 1:4000118-4000140 GCTCTGAGTCCAGGGGGCTGCGG + Intergenic
900990757 1:6097154-6097176 CATCTTGGTCTGGGGGTCTGAGG - Intronic
901068889 1:6507608-6507630 GCTCTGTTTCCGGGGGGCGGGGG + Intronic
901325235 1:8361340-8361362 TCTCATTGTCCTGGGGGCTGGGG + Exonic
901755453 1:11438936-11438958 GCTCTCTGTCTCAGGGTCTGGGG - Intergenic
902932447 1:19740997-19741019 GCTCCTTGTCTGGGGTACTGGGG - Intronic
903543382 1:24108999-24109021 ACTCATTGTCTGGGGAGCTGAGG - Intronic
904310455 1:29626135-29626157 TCTCTCTGTCTTTGGGGCTGTGG - Intergenic
904743054 1:32693329-32693351 GCACTTTGGTTGGGAGGCTGAGG - Intronic
905163924 1:36064916-36064938 GCACTTTGGGTGGGCGGCTGAGG + Exonic
905240479 1:36577740-36577762 GCTCTTTCTCTGGTGGGTGGGGG + Intergenic
905639032 1:39576142-39576164 GCCTTTTGTCTGCGGTGCTGCGG - Exonic
906286270 1:44589871-44589893 GCTCGTGGTCTGGGGGTATGAGG + Intronic
906629818 1:47357211-47357233 GCACTTTGTTTGGGAGGCCGAGG - Intronic
906746620 1:48226418-48226440 GCTCTGTGTTTGGGGCGCAGTGG - Intronic
907107939 1:51901060-51901082 GCACTTTATTTGGGAGGCTGAGG - Intergenic
907514337 1:54983810-54983832 GCTCTTTGACTTTGGGGATGGGG + Intronic
908051668 1:60239486-60239508 GCTCTTTGGCTGGGAGTCTTGGG - Intergenic
908327982 1:63042549-63042571 CCTCTCGGTCTGGGGGGATGTGG + Intergenic
908476630 1:64495007-64495029 TCTCTTTGTGTGGGGGGCTCTGG + Intronic
911624406 1:100104710-100104732 GCACTTTGGGTGGGAGGCTGAGG - Intronic
912372282 1:109183238-109183260 GCACTTTGGGTGGGTGGCTGAGG + Intronic
912411631 1:109484188-109484210 GTCCTTTGTTTGGGGGGCCGGGG - Intronic
915296512 1:154925293-154925315 GCTGTCTGTCTGGAGGGCTGAGG - Intronic
915519116 1:156431019-156431041 GTTCCTTGTCTAGGGAGCTGGGG + Intergenic
915741274 1:158120206-158120228 GATATTTGTCTGGGTGGCAGTGG + Intergenic
915915116 1:159936374-159936396 GCTCTCTGGCGGGAGGGCTGGGG - Intronic
915970568 1:160352213-160352235 GCTCTTTGGCTGGGGTGCAATGG + Intronic
916122835 1:161544295-161544317 GCTCTTTCTGTGAGGGGATGAGG + Intronic
916132737 1:161625739-161625761 GCTCTTTCTGTGAGGGGATGAGG + Intronic
916140123 1:161689687-161689709 GCACTTTGGGTGGGAGGCTGAGG - Intergenic
920521075 1:206626959-206626981 GCTCTTTTTTTGGGGGGGGGTGG - Intergenic
921434985 1:215108241-215108263 GGTCTGTGGCTTGGGGGCTGGGG + Intronic
922360481 1:224817189-224817211 GCTCCTTGCCTGGGAGACTGTGG + Intergenic
922950514 1:229555128-229555150 GTTTTTTGTGTGGGGGGCTTCGG - Intronic
923331104 1:232925580-232925602 GCTCTTCTTCAGGGGGGCTGCGG + Intergenic
923746090 1:236701470-236701492 GCCCTGTGACTGGAGGGCTGTGG + Intronic
924530457 1:244889497-244889519 GCACTTTTTTTGGGGGGTTGGGG + Intergenic
1062831387 10:608253-608275 GGGCTGTGTGTGGGGGGCTGTGG - Intronic
1062831413 10:608359-608381 GCTGTGTGTGGGGGGGGCTGTGG - Intronic
1063449926 10:6144680-6144702 GTTCCGCGTCTGGGGGGCTGCGG + Intergenic
1064275244 10:13899545-13899567 GCACTTTTTCTGGCAGGCTGAGG + Intronic
1065981206 10:30899650-30899672 GCCCTGTGTGTGGGGGGGTGGGG - Intronic
1068131398 10:52899890-52899912 GCTCTTTTTGTTGGGGGCTGGGG - Intergenic
1069714590 10:70512566-70512588 GGTCTGTGTCTGGGCTGCTGAGG + Intronic
1069769315 10:70887772-70887794 GCTGTTTGTGAGGGGCGCTGAGG - Intronic
1069860631 10:71468956-71468978 GCTCCTTCTCTGTGGGCCTGAGG + Intronic
1071087114 10:81876337-81876359 GCTCTGGTTCTGGGGGGGTGGGG + Intronic
1071265214 10:83958487-83958509 GATGTGTGTCTGGGAGGCTGGGG + Intergenic
1072446392 10:95502480-95502502 GCTCTGTGGCAGGGGGCCTGGGG - Intronic
1073102563 10:101014314-101014336 TCTCTTGGTGTGGGGGGCTTGGG + Intronic
1075679344 10:124321398-124321420 TCTCTTTGTCTGGGGCGGAGGGG - Intergenic
1075740775 10:124694700-124694722 GCTATGTGTCTGGGGCCCTGAGG + Intronic
1076086524 10:127637106-127637128 GCTTGATGTCTGGGGGCCTGGGG - Intergenic
1076500573 10:130933198-130933220 GCTCTGAGACTGGGAGGCTGTGG + Intergenic
1076614387 10:131746494-131746516 CCTCTTTGGCTTGGGGGGTGGGG - Intergenic
1076896722 10:133316822-133316844 TCTCTCTGTCTGGGGGGGTGCGG - Intronic
1076896939 10:133317637-133317659 TCTCTGTGTCTGGGGGGGGGGGG - Intronic
1076896982 10:133317772-133317794 TCTCTGTGTCTGGGGGTGTGTGG - Intronic
1076896990 10:133317811-133317833 TCTCTGTGTCTGGGGGGGGGGGG - Intronic
1076897098 10:133318176-133318198 TCTCTGTGTCTGGGGGTGTGTGG - Intronic
1076897113 10:133318241-133318263 TCTCTGTGTCTGGGGGTGTGTGG - Intronic
1077066562 11:643678-643700 GCTCTTGGTCAGGAGGGCAGGGG + Intergenic
1077094277 11:792711-792733 GATCTTCCTCTGGGCGGCTGGGG + Exonic
1077130227 11:968353-968375 GCTCTTCGTCTGGGGTCCCGCGG + Intronic
1077672455 11:4168256-4168278 GCACTTTATCTGGTGGGCAGTGG - Intergenic
1078235066 11:9477010-9477032 TCCCTTTGTTTGGGAGGCTGAGG - Intronic
1078604698 11:12764854-12764876 GCTCTTCCTCAAGGGGGCTGGGG - Intronic
1078860920 11:15245401-15245423 GCTCATTGTGTGGGGAGCTGGGG + Intronic
1079798971 11:24844990-24845012 GGACTTTGTGTGGGGGGCTGTGG - Intronic
1083452444 11:62754827-62754849 TCTCTTTTTTTGGGGGGGTGGGG - Intergenic
1084380045 11:68805933-68805955 GGCCTCCGTCTGGGGGGCTGGGG - Intronic
1084652531 11:70497623-70497645 GCTCATGGGCTGGGGGGCTCTGG - Intronic
1084703943 11:70804963-70804985 GCTCTATGTCTAAGGGACTGGGG + Intronic
1084840237 11:71840390-71840412 GCTCGTTGTCCAGGAGGCTGGGG + Intergenic
1084840257 11:71840500-71840522 GCACATTGTCTGGGAGCCTGGGG + Intergenic
1084944378 11:72630937-72630959 GGTCCTAGTCTGGAGGGCTGGGG + Intronic
1089209356 11:116790078-116790100 GCTCCTTGTCTGGGGAGCCTTGG - Exonic
1089356245 11:117855773-117855795 GACCTTTGCCTGGGGGCCTGAGG + Intronic
1091249572 11:134131224-134131246 GCTCTTTTTTGGGGGGGCGGGGG + Intronic
1091286072 11:134409301-134409323 TCTTTTTGCCTGGGGGCCTGGGG + Intronic
1092132674 12:6123605-6123627 TCTCTATGTCTGGGCTGCTGTGG - Intronic
1093446680 12:19267662-19267684 GCTATTTTTTTGGGGGGTTGGGG - Intronic
1096973207 12:55683821-55683843 GCTCTTTTTCTGGGAGCATGTGG + Exonic
1097328759 12:58310041-58310063 GCTGTTTGTGTGGGGTGGTGAGG - Intergenic
1098595190 12:72265541-72265563 TCTTTTTTTCTGGGGGGGTGGGG - Intronic
1101371837 12:104137899-104137921 GCTCTTTGTGCGCCGGGCTGAGG - Intronic
1102291245 12:111701982-111702004 GCTCTTCCTCTGGGGGTCTAAGG + Intronic
1102684416 12:114713504-114713526 GCACTTTGTTTGGGAGGCTGAGG + Intergenic
1103450510 12:121025475-121025497 GCTCTTTGAGTGGGGCGCAGTGG + Intronic
1103691188 12:122775442-122775464 GCTCCTTGCCTGGAGGTCTGTGG + Intronic
1103691879 12:122781785-122781807 GCTCTTTGTTTGGGAGGCTGAGG + Intronic
1103865178 12:124045877-124045899 GCTCTTTGCATGAGTGGCTGGGG + Intronic
1103916663 12:124379274-124379296 GCTCTGTGTGTGAGGAGCTGGGG - Intronic
1103922601 12:124406801-124406823 GCTGCTTGTCTGGCAGGCTGAGG - Intronic
1104226363 12:126838226-126838248 TCTCTTTCTCTGTGGGCCTGAGG - Intergenic
1104729176 12:131095543-131095565 GGTCTTACTCTGTGGGGCTGAGG + Intronic
1104753207 12:131252844-131252866 CCTGTGTCTCTGGGGGGCTGAGG + Intergenic
1104976301 12:132553420-132553442 GCTCCTTGTGTGGCAGGCTGCGG + Intronic
1104988541 12:132611243-132611265 GCCCAGTGTCTGGGGAGCTGAGG + Intergenic
1104994534 12:132645260-132645282 GCTCCCTGTGTGGAGGGCTGGGG + Intronic
1104994551 12:132645319-132645341 GCTCCCTGTGTGGAGGGCTGGGG + Intronic
1104994572 12:132645379-132645401 GCTTCGTGTGTGGGGGGCTGGGG + Intronic
1105551838 13:21404500-21404522 GCACTCTGTCTGGGAGGCTGAGG + Intronic
1106810184 13:33350813-33350835 GCTCCTTGAGTGGGGGGCCGTGG - Intergenic
1106859708 13:33892717-33892739 GGTTTTTGTCTGGGGGAGTGAGG - Intronic
1107570819 13:41656431-41656453 GCTCTTTTTCTTGGGGGGTAAGG + Intronic
1109005211 13:56865662-56865684 GTTCTTTGTTTGGGAGGCTCAGG + Intergenic
1111982605 13:95032910-95032932 GCACTTTGTTTGGGAGGCCGAGG - Intronic
1113652187 13:112041911-112041933 GCTCTCATTCTGAGGGGCTGGGG - Intergenic
1114521184 14:23337552-23337574 GCTCTTTCTCTTTGGAGCTGTGG - Intergenic
1115731285 14:36272313-36272335 GGGCTTTGTCTGGGGAGCTTTGG - Intergenic
1116908892 14:50436342-50436364 TGTCTTTGTCTGGGGGACTCTGG + Intronic
1119293781 14:73517028-73517050 GCACTTTGTTTGGGAGGCTAAGG + Intronic
1119847552 14:77841576-77841598 GCACTTTGGTTGGGAGGCTGAGG + Intronic
1121179476 14:91917997-91918019 GCTCTTGGGTTGGGGGGCAGGGG - Intronic
1121322809 14:93002456-93002478 GGTCTTTGACTGGAGGGCTCTGG - Intronic
1121637282 14:95462282-95462304 GCTCTTAGACAGGAGGGCTGTGG - Intronic
1121674213 14:95739373-95739395 GTTCTGTGGCTGGGGTGCTGGGG - Intergenic
1121694151 14:95899321-95899343 GAGCTTTTTGTGGGGGGCTGTGG - Intergenic
1121775787 14:96589713-96589735 GCTCTGTTTCTGGGGTGTTGGGG + Intergenic
1122076274 14:99237048-99237070 TCCCTTTTTTTGGGGGGCTGTGG + Intronic
1122450782 14:101805314-101805336 GCGCTTTCTTTGGGAGGCTGAGG - Intronic
1122913069 14:104843251-104843273 GCTCTTTGACTGATGGTCTGCGG + Intergenic
1122950838 14:105043670-105043692 CCTCATTGTCCGTGGGGCTGGGG + Intergenic
1123141322 14:106081915-106081937 GCTCTTTATCTGGGGAGGTGAGG + Intergenic
1123166489 14:106330136-106330158 GCTCTTTATCTGGGGAGGTGAGG + Intergenic
1123169170 14:106355172-106355194 GCTCTTTATCTGGGGAGGTGAGG + Intergenic
1124598367 15:31110513-31110535 TCTCTTTGTCTGGAAGGCAGAGG + Intronic
1124938730 15:34197999-34198021 GCACTTTGTGTGGGAGGCCGAGG - Intronic
1125144476 15:36450904-36450926 GCTCTTTGTGTGTTGGGGTGGGG - Intergenic
1126054174 15:44713906-44713928 CCTCCTTGTCTGGGAGGCTGTGG - Intronic
1126504194 15:49384420-49384442 GCTCACTGTCTGTGGGGATGGGG + Intronic
1127446990 15:59073222-59073244 GCACTTTGTTTGAGAGGCTGAGG + Intronic
1127884641 15:63189014-63189036 GCTCTGTGACTGAGGGGCTGCGG + Intergenic
1127943510 15:63725967-63725989 TCTTTTTTTCTGGGGGGCGGGGG + Intronic
1128325617 15:66722261-66722283 GCTCATTGCCTGTGGGTCTGGGG + Intronic
1129278015 15:74460249-74460271 GGTCTTTTTCTGGGGGGCCGGGG - Intronic
1129789463 15:78331289-78331311 GCTGTTTGTAGTGGGGGCTGGGG - Intergenic
1129822809 15:78616356-78616378 GCTTTTTTTTTGGGGGGGTGGGG - Intronic
1129899805 15:79137946-79137968 GGTGTGTGTCTAGGGGGCTGAGG - Intergenic
1130088070 15:80795275-80795297 GCTCTCTGTCTGGGTAGGTGGGG + Intronic
1130683447 15:86016534-86016556 TCTCTTTGTATGGTGGGCTCAGG + Intergenic
1131144547 15:90002365-90002387 GCTCGCTGTCTGGGGGCGTGGGG + Intronic
1132752929 16:1467132-1467154 GCTCTTTGCCTGGGGAGAGGAGG - Intronic
1132900283 16:2250431-2250453 GCCCTGAGTCTGGGGGGTTGGGG + Intronic
1134134212 16:11668737-11668759 GTTCTTTGTCAGCGGCGCTGCGG + Intronic
1134522059 16:14923317-14923339 GCTCTCTGGCTGAGGAGCTGGGG + Intronic
1134683933 16:16145772-16145794 GATGTGTGTGTGGGGGGCTGGGG - Intergenic
1134709728 16:16321968-16321990 GCTCTCTGGCTGAGGAGCTGGGG + Intergenic
1134716941 16:16361998-16362020 GCTCTCTGGCTGAGGAGCTGGGG + Intergenic
1134949875 16:18346677-18346699 GCTCTCTGGCTGAGGAGCTGGGG - Intergenic
1134957810 16:18390161-18390183 GCTCTCTGGCTGAGGAGCTGGGG - Intergenic
1136047983 16:27630511-27630533 CCTCTTTGCCCTGGGGGCTGGGG - Intronic
1138225222 16:55289010-55289032 GCTCTTTGTGTCAGAGGCTGTGG - Intergenic
1138830434 16:60368142-60368164 GTTCTTTCTCTGGAAGGCTGGGG + Intergenic
1139450408 16:67024635-67024657 CCTCTTTGTCATGGGGGTTGGGG - Intergenic
1141025398 16:80541571-80541593 CCTCTTTTTCTGGGGGGGAGGGG - Intronic
1142139659 16:88467228-88467250 GCTCCTGGTCTGGGTGACTGTGG - Intronic
1142148722 16:88503370-88503392 GATCTGTGTCTGGGGGGCCACGG + Intronic
1142400162 16:89854419-89854441 GGTCTCTGCCTGGGGGGCCGTGG + Intronic
1142420539 16:89966910-89966932 GCCTTTTGTTTGGGGGCCTGAGG + Exonic
1142525908 17:540665-540687 GCTTTTTGTTTTGGGGGCTTGGG + Intronic
1143368748 17:6425425-6425447 GCTCCCTGCCTGGGTGGCTGTGG + Exonic
1143621770 17:8084889-8084911 GCCCCTTGTGTGGTGGGCTGGGG - Intronic
1143716819 17:8778623-8778645 GCCTTTTTTCTGGGGGGTTGGGG + Intergenic
1144970520 17:19106368-19106390 GCACTTTGAGTGGGTGGCTGAGG + Intergenic
1144990823 17:19232530-19232552 GCACTTTGAGTGGGTGGCTGAGG + Intronic
1146273656 17:31500509-31500531 GCTCCTTGTGTGAGGGCCTGTGG + Intronic
1147139486 17:38453377-38453399 GCTGTTTCTCTGGGTGGATGGGG + Intronic
1147602408 17:41754707-41754729 GCACATGGTGTGGGGGGCTGGGG - Exonic
1147848941 17:43426287-43426309 GTGCCTTGTCTAGGGGGCTGAGG - Intergenic
1148187678 17:45656290-45656312 GCTCCTAGTCTAGGGGGCTGGGG + Intergenic
1148427273 17:47610169-47610191 GCTTTTTTTTTGGGGGGGTGGGG - Intronic
1148451228 17:47778969-47778991 GGTCTTGGGGTGGGGGGCTGGGG - Intergenic
1148996461 17:51714485-51714507 GCTCTTTGGGAGGTGGGCTGGGG + Intronic
1149742226 17:59057496-59057518 GCTCTTTTTCTGGCCGGGTGTGG - Intronic
1150798824 17:68262469-68262491 GCTCTTTTTCTGGGGGGGTTGGG - Intronic
1150817051 17:68400637-68400659 GCTCTGTGTGTGGGGGGCACCGG - Intronic
1150867135 17:68864492-68864514 ACTCTTTTTTTGGGGGGGTGGGG + Intergenic
1151172592 17:72259797-72259819 GTTCTTGGGCTGGTGGGCTGGGG - Intergenic
1151275395 17:73030247-73030269 GTCCTTGGTCTGGGGGGTTGGGG + Intronic
1151351313 17:73533687-73533709 CCAATTTGTCTGGGGGGGTGGGG - Intronic
1151361830 17:73593568-73593590 GCTCCTTCCCTGGGGGGCTCTGG - Intronic
1151455497 17:74223275-74223297 GCTTTTTTTTTGGGGGGCGGGGG + Intronic
1151542013 17:74769442-74769464 GGTCTTTGGCTGGGAGGGTGGGG + Intergenic
1152107029 17:78336352-78336374 TCTCTTTTTTTGGGGGGGTGGGG - Intergenic
1152315979 17:79580409-79580431 CCTGTCTGGCTGGGGGGCTGTGG - Intergenic
1153519310 18:5937239-5937261 GATCTGTGTCTCGGGGGTTGGGG - Intergenic
1153949075 18:10042531-10042553 TGTCTTTTTTTGGGGGGCTGGGG - Intergenic
1154273881 18:12942962-12942984 GCTGTGTGTCTGGGGGGTTGTGG + Intergenic
1154379309 18:13835447-13835469 GGTCTGTGGCTGGGGGGATGGGG + Intergenic
1155475018 18:26228776-26228798 GTTCTTTCTTTGGGGGGTTGGGG - Intronic
1155809997 18:30220245-30220267 GCTGGGGGTCTGGGGGGCTGGGG + Intergenic
1156476348 18:37408178-37408200 GCTCTTAGACTGATGGGCTGGGG + Intronic
1159041079 18:63323167-63323189 GCTTTTTGTTTGGTGGCCTGGGG - Intergenic
1161023301 19:2022010-2022032 GCTCTTTTGCTGGGTGGCTGTGG - Intronic
1161602569 19:5193481-5193503 GCTCTTTGTCTGGGGGGCTGTGG + Intronic
1165387545 19:35519676-35519698 CCTCTTTGTCTGGGGGGAAATGG + Intergenic
1165585869 19:36915587-36915609 CCTCTTTTTTTGGGGGGGTGGGG + Intronic
1165946499 19:39445965-39445987 GGTCTGTGGCTGGGGCGCTGGGG + Exonic
1167001274 19:46746736-46746758 GCTCTTTCTCTGGGGCGAAGTGG - Exonic
1167052316 19:47086734-47086756 GCTGTGTGTCTGGGGTGCTGAGG - Intronic
1167700979 19:51045428-51045450 GCACTTTGTTTGGGAGGCTGAGG - Intergenic
1168249377 19:55133112-55133134 GTTCTATGACTGGGGGGCAGCGG + Intronic
1168315749 19:55484124-55484146 GCTCAGTGGCTGGGGCGCTGCGG - Exonic
924997295 2:373927-373949 GCACTTTGTTTGAGAGGCTGAGG - Intergenic
925910375 2:8569828-8569850 GCTCATTTCCTGGGGGCCTGTGG - Intergenic
926891686 2:17644319-17644341 ACTCCTTGTCCTGGGGGCTGAGG - Intronic
927774823 2:25894506-25894528 GAGCTTTGTTTGGGAGGCTGAGG - Intergenic
928483494 2:31706973-31706995 GCTCCATGTCTAGGAGGCTGGGG - Intergenic
928622805 2:33108212-33108234 CTTCTGTCTCTGGGGGGCTGTGG + Intronic
928868280 2:35944965-35944987 GCTCTTGGTGTGGTGGTCTGTGG - Intergenic
930764410 2:55070257-55070279 GCCTTTTGTTTGGGGGGGTGGGG - Intronic
931058644 2:58501700-58501722 GCTCTTTGGATGGGAAGCTGTGG + Intergenic
933940788 2:87243495-87243517 GCGGTTTGTCTGTGGAGCTGAGG + Intergenic
934503726 2:94876789-94876811 GCTGTTTATTTGGGGGACTGGGG - Exonic
934599925 2:95649440-95649462 GCGCTTTGCCGGGGGGGATGGGG - Intergenic
934660978 2:96143619-96143641 GCTCTTCTGCTGGGGGACTGAGG - Exonic
934874874 2:97908281-97908303 GATCCTTCTCTGGGGGCCTGCGG + Intronic
934944910 2:98533508-98533530 GGTCTCTCTCTGAGGGGCTGTGG + Intronic
936352351 2:111722517-111722539 GCGGTTTGTCTGTGGAGCTGAGG - Intergenic
937316263 2:120933777-120933799 GCTCCTGGTTCGGGGGGCTGGGG + Intronic
937622925 2:124009590-124009612 ACTGTTTGTTTGGGGGGTTGGGG + Intergenic
938173650 2:129104620-129104642 GCTGTCTGTCTGGGAGGCTGGGG + Intergenic
938275608 2:130018759-130018781 GCTCTGTGCCTGGGGAGCAGGGG - Intergenic
938326552 2:130409465-130409487 GCTCTGTGCCTGGGGAGCAGGGG - Intergenic
938363385 2:130711985-130712007 GCTCTGTGCCTGGGGAGCAGGGG + Intergenic
938439759 2:131318571-131318593 GCTCTGTGCCTGGGGAGCAGGGG + Intronic
940474410 2:154143608-154143630 GCACTTTGGGTGGGAGGCTGAGG + Intronic
940565374 2:155353651-155353673 CTTCTGTTTCTGGGGGGCTGGGG + Intergenic
940676757 2:156732820-156732842 GTTCTTTATCTGGGGGGCAAAGG - Intergenic
941215330 2:162700216-162700238 TCCCTTTGTCTGGGGCTCTGGGG - Intronic
943453562 2:188075111-188075133 GCACTTTGGCTGGGATGCTGGGG + Intergenic
943693967 2:190903152-190903174 GATTTTTGGCTGGGGGGCAGGGG - Intronic
943694872 2:190915747-190915769 CCTCTTTTGCTGGTGGGCTGAGG - Intronic
944490866 2:200256484-200256506 CCTCGTCTTCTGGGGGGCTGGGG - Intergenic
944942126 2:204640170-204640192 CCTCTGTGTCTGGGAGGTTGAGG + Intronic
948563733 2:238870626-238870648 GCTGTGTGTGTGGGGGGGTGTGG - Intronic
948563854 2:238871212-238871234 GCTGTGTGTGTGGGGGGGTGTGG - Intronic
1171341434 20:24431955-24431977 GAGTTTTGTCTGGGAGGCTGTGG - Intergenic
1171386515 20:24772964-24772986 GCTCTATGGCTGGGGGCCTGGGG + Intergenic
1172541399 20:35720031-35720053 TCTCTTTGTTTGGGAGGCCGAGG - Intronic
1173822529 20:46028802-46028824 GCTGCTTGACTGGGGGTCTGGGG - Intronic
1174317176 20:49712775-49712797 GCTGAAAGTCTGGGGGGCTGGGG + Intronic
1174394458 20:50238071-50238093 GCACTTTGGTTGGGAGGCTGAGG - Intergenic
1175493179 20:59393052-59393074 TCTTTGTGTCTGGGTGGCTGAGG - Intergenic
1176105623 20:63384500-63384522 GCTCGTCCTCTTGGGGGCTGTGG - Intergenic
1179935301 21:44600190-44600212 TCTGCTTGTCTGGGTGGCTGTGG - Intronic
1180157365 21:45984039-45984061 GCTCCTGGTCTGAGGGCCTGAGG + Intronic
1180599694 22:17007925-17007947 GCTCTTTGTGAGTGGGGCAGTGG - Exonic
1182366124 22:29780595-29780617 GCTCTTTGGCTGGGGGTCCTTGG + Intergenic
1182712199 22:32330084-32330106 GGTGTGTGTGTGGGGGGCTGTGG + Intergenic
1183144216 22:35974436-35974458 GCACTTTGTTTGGGAGGCCGAGG + Intronic
1183315642 22:37135546-37135568 GGCCTGCGTCTGGGGGGCTGGGG + Intronic
1184676316 22:46045171-46045193 AGTCTTTGTTTGGGAGGCTGGGG - Intergenic
1184737805 22:46409479-46409501 GCTCCGTGGCTGGGGTGCTGGGG + Intronic
1185387496 22:50542115-50542137 GCACTTTGGGTGGGAGGCTGAGG - Intergenic
949913015 3:8929891-8929913 GCACTTTGTTTGGGAGGCCGAGG - Intronic
950571461 3:13802864-13802886 CCTCTCTGTATGGGGTGCTGGGG + Intergenic
950623483 3:14226635-14226657 CCTCATTGTTTGTGGGGCTGGGG - Intergenic
952866271 3:37857308-37857330 GGGCTTTATTTGGGGGGCTGTGG - Intergenic
953040201 3:39249568-39249590 GCTCTCTGCCAGGAGGGCTGAGG + Intergenic
953680572 3:45035466-45035488 GCTCTTTGCCTGGGGAACAGGGG + Intronic
953919787 3:46943927-46943949 ACTCTTTGTCAGGAAGGCTGAGG - Intronic
954575998 3:51676513-51676535 GGTGCTTGTCTGGGGGACTGTGG + Intronic
955997015 3:64688022-64688044 GCTTCTTGAATGGGGGGCTGGGG + Intergenic
956118008 3:65937454-65937476 TCTCTTTCTCTGTGGGCCTGTGG - Intronic
957431434 3:80113360-80113382 CCTCATTGTCTGGGCGTCTGTGG + Intergenic
959051826 3:101531676-101531698 GCCTTTTGTCTGTGGGGATGTGG - Intergenic
960014545 3:112871812-112871834 GCGCATTGCCTGGGGGCCTGGGG - Intergenic
961551672 3:127673240-127673262 GCGCTTCCGCTGGGGGGCTGCGG - Intronic
964787599 3:160415456-160415478 GCTTTTTTTTTGCGGGGCTGGGG - Intronic
965901430 3:173645488-173645510 ACTCTTGGTCTAGTGGGCTGTGG + Intronic
967075675 3:185999824-185999846 TCTTTTTTTCTGGGGGGGTGGGG - Intergenic
967099091 3:186201221-186201243 GCTGTCTGTCTGGGAAGCTGAGG + Intronic
968581358 4:1396872-1396894 TCTCTTTCCCTGGGAGGCTGTGG - Intergenic
969781331 4:9406393-9406415 GCTCGTTGTCCAGGAGGCTGGGG + Intergenic
969781351 4:9406503-9406525 GCACATTGTCTGGGAGCCTGGGG + Intergenic
974625263 4:64418250-64418272 GCCCTTTGTTTTGGGAGCTGAGG + Intergenic
975729781 4:77326894-77326916 CCTGTTTGCCTGGGAGGCTGCGG + Intronic
976246375 4:83010419-83010441 TCTCTTTATTTGGGGGGATGGGG - Intronic
978510515 4:109512910-109512932 GCTCTTGGGTTGGGAGGCTGAGG - Intronic
978751730 4:112256495-112256517 GCTTTTTGTTTGGTTGGCTGAGG + Intronic
979324692 4:119365168-119365190 GCACTTTGTTTGGGAGGCTGAGG + Intergenic
981079363 4:140623198-140623220 GGTGTGTGCCTGGGGGGCTGAGG - Intronic
981128573 4:141133216-141133238 GCTCGTAGTCTGGGGTGCTGCGG + Intronic
986395086 5:7321499-7321521 TCTCCTTTTCTGGGGGGCTGGGG - Intergenic
989420178 5:41228997-41229019 GCTATTTATTTGGGAGGCTGAGG + Intronic
990097826 5:52140141-52140163 TCTCTTTGTCTCTGGGACTGTGG - Intergenic
991288343 5:65005578-65005600 ACTTGTTGTCTGGGGGCCTGAGG - Intronic
996847480 5:127915887-127915909 GCTGAAGGTCTGGGGGGCTGTGG + Intergenic
997361778 5:133299789-133299811 GCTCTGTGATTGGGGGGCTGGGG + Intronic
998005102 5:138651530-138651552 GCTCTGTGTGTGTGGGGGTGGGG - Intronic
999256048 5:150210550-150210572 GGTCTTTGTCTGAAGTGCTGGGG - Exonic
1000205146 5:159051347-159051369 GGGATTTGTTTGGGGGGCTGGGG - Intronic
1002058876 5:176614458-176614480 GCTCTGTGTGTGGGGGGGGGAGG + Intergenic
1002196679 5:177504962-177504984 GCCCTGGGTGTGGGGGGCTGAGG + Intronic
1002394976 5:178945684-178945706 TCTCTGTGTGTGGGGGGGTGTGG + Intronic
1002451530 5:179321657-179321679 GCGCTCTGTATGGAGGGCTGTGG - Intronic
1002497626 5:179626037-179626059 GCACTTTCTCTGCGAGGCTGAGG - Intronic
1004026106 6:11820194-11820216 GCTCTTTTTTTTGGGGGATGGGG - Intergenic
1005145990 6:22690610-22690632 GAACTCTGTCTGGAGGGCTGAGG + Intergenic
1005714625 6:28535052-28535074 TCTTTCTGTCTGGGGGGCTCAGG - Intergenic
1005840720 6:29743192-29743214 GCTCCTTGTCAGGGCAGCTGTGG - Intergenic
1006487490 6:34355679-34355701 GCTGTTTTTTTGGGGGGGTGGGG + Intronic
1006660837 6:35642638-35642660 TCTCTTTCTGAGGGGGGCTGGGG - Intronic
1008646481 6:53519546-53519568 GCTCTGTCTCTGTGGAGCTGGGG - Intronic
1010309775 6:74371397-74371419 TCTGTTTTTGTGGGGGGCTGGGG - Intergenic
1012584046 6:100900733-100900755 TCTGTTTGTCTGGGGGACTTGGG - Intergenic
1017948629 6:159117055-159117077 GCTGTGTGTGTGGAGGGCTGAGG + Intergenic
1018599741 6:165526414-165526436 GCTCCTTGACTGGGAGGGTGAGG + Intronic
1018892798 6:167994927-167994949 GTTCTTTTTTTGGGGGGCGGGGG + Intergenic
1019360134 7:600615-600637 GAGCTCTTTCTGGGGGGCTGGGG - Intronic
1019520984 7:1460346-1460368 GCTTTTCTTCTGGGGGCCTGTGG + Intergenic
1019550700 7:1601042-1601064 GCTCTGTTTGTGGGGTGCTGTGG + Intergenic
1019709609 7:2512151-2512173 GTTCTGTGCATGGGGGGCTGTGG + Intergenic
1021284089 7:18757737-18757759 GCTCTGTGTGTGGGTGGGTGTGG + Intronic
1021896351 7:25239678-25239700 TTTCTTTTTCTGGGGGGCGGGGG + Intergenic
1022259447 7:28690295-28690317 GCTCTGTGTCTGGTGGGCAGAGG - Intronic
1022899938 7:34797411-34797433 GCTCTGTGTATGGGGGACAGGGG + Intronic
1023464664 7:40440747-40440769 TCTCATTGTTTGGGGGGCTGAGG + Intronic
1023933264 7:44720059-44720081 ACTCTTTTTTTGGGGGGGTGCGG + Intergenic
1025912411 7:65839350-65839372 GAGCTTTGCCTGGGAGGCTGTGG - Intergenic
1028024681 7:85821961-85821983 GCTCTTTCTTTGGGGTCCTGTGG + Intergenic
1028985841 7:97007380-97007402 GCTGTTTGTCTGAGGGCCTCTGG + Intronic
1029371102 7:100151321-100151343 GCACTTTGGGTGGGAGGCTGAGG - Intronic
1030063847 7:105643924-105643946 GACCTGCGTCTGGGGGGCTGTGG + Intronic
1032640275 7:133758823-133758845 GCTGTATCTCTGGGGGGCAGGGG - Intronic
1032727613 7:134605676-134605698 CTCCTTTATCTGGGGGGCTGAGG - Intergenic
1034271428 7:149805180-149805202 TCTGCTTTTCTGGGGGGCTGAGG - Intergenic
1034457095 7:151176476-151176498 GTACTTTCTATGGGGGGCTGCGG + Intronic
1034470103 7:151250333-151250355 GCTCTGTGTGTGGGGGTGTGTGG - Intronic
1034693048 7:153029241-153029263 CTTCGTTGTCTGGGGTGCTGTGG - Intergenic
1035056868 7:156041622-156041644 GCCCTGTGTCTGGGGGGCCCAGG - Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036566420 8:9942073-9942095 GCTCTTGGTCTGGTGGACTTGGG + Intergenic
1036637485 8:10561730-10561752 GCACTGTGTCTTGGAGGCTGAGG + Intergenic
1036642804 8:10594557-10594579 GATCTATCTCTGTGGGGCTGGGG + Intergenic
1036838087 8:12092203-12092225 GCACATTGTCTGGGAGCCTGGGG - Intergenic
1036859877 8:12338451-12338473 GCACATTGTCTGGGAGCCTGGGG - Intergenic
1038225553 8:25654080-25654102 GCACATTGTCTGGGGACCTGGGG - Intergenic
1038410067 8:27351472-27351494 ATTCTTTGTCTGTGTGGCTGTGG - Intronic
1038694995 8:29798573-29798595 GCTCTATGGCCTGGGGGCTGGGG - Intergenic
1039515371 8:38128285-38128307 GATCTTTAACTGGGGAGCTGCGG - Exonic
1040599599 8:48870552-48870574 GCTCGGTGTCTGCGGGGCTCTGG + Intergenic
1041268966 8:56092000-56092022 GTTAGTTGTCTGGAGGGCTGTGG - Intergenic
1042098986 8:65252995-65253017 GCTTTTTGTCTGGGCTCCTGGGG + Intergenic
1042360369 8:67876220-67876242 GCTCCTTTTTTGGGGGGGTGGGG - Intergenic
1047273898 8:123390227-123390249 GCACTTTGTTTGGGAGGCCGAGG - Intronic
1047348582 8:124051928-124051950 GCTCTCTGTTAGGGGAGCTGAGG + Intronic
1047740246 8:127800901-127800923 GGTCAGTGTCTGGAGGGCTGGGG + Intergenic
1047792129 8:128214334-128214356 ACACTTTGTTTGGGGGGCTGAGG - Intergenic
1048370263 8:133771059-133771081 ACTCTCTGTCTGGGCAGCTGAGG - Intergenic
1048884931 8:138902273-138902295 TCTCTTTTTCTGGAGGGTTGAGG - Intronic
1049049884 8:140186009-140186031 GCTCCTTGTCTGTGACGCTGGGG + Intronic
1049225561 8:141448968-141448990 GCAGCTTGTCTGGGGGGCTCTGG + Intergenic
1049676769 8:143892809-143892831 GCTCTTTCTCAGGGGGTCCGAGG - Intergenic
1049701704 8:144017492-144017514 GGGCTTGGTCTGGTGGGCTGTGG + Intronic
1050285636 9:4099028-4099050 GCACTTTGTCTTGAGGGCAGTGG - Intronic
1050543924 9:6693624-6693646 CATTTTTGTCTGGTGGGCTGGGG + Intergenic
1050971957 9:11889026-11889048 GCTCTTTTTTTGGGGGGTGGGGG + Intergenic
1052999203 9:34568262-34568284 GCTCCTTGTCCTGTGGGCTGTGG + Intronic
1054702158 9:68423696-68423718 TCTCTTTCTTTTGGGGGCTGAGG + Intronic
1056542833 9:87588880-87588902 CATCTTTTTCTGGGGGGCGGGGG + Intronic
1056752666 9:89363474-89363496 GCTCTCTGCCTGGAGGGCTGTGG - Intronic
1057320835 9:94011005-94011027 GCTCTGTGGCTTGGGGCCTGGGG - Intergenic
1059462845 9:114445626-114445648 CCTCTATGTTTGGGGGTCTGGGG + Intronic
1059715759 9:116911777-116911799 GCCTGTTGTCTGGGAGGCTGAGG + Intronic
1060191443 9:121595934-121595956 ACACTTTGTTTGGGAGGCTGGGG + Intronic
1061033757 9:128102231-128102253 GCTCTTTCTCCTGGGGGCAGAGG + Intronic
1061041440 9:128143027-128143049 GCACTTTGTTTGGGAGGCTGAGG + Intergenic
1062174600 9:135153919-135153941 GCTCTTTGTATGGGAGACAGGGG + Intergenic
1062300296 9:135863360-135863382 GCTGTTTGGCAGTGGGGCTGGGG - Intronic
1062450238 9:136612197-136612219 TCTTTATGGCTGGGGGGCTGGGG + Intergenic
1203760880 EBV:12653-12675 GGGGTCTGTCTGGGGGGCTGAGG - Intergenic
1203761809 EBV:15725-15747 GGGGTCTGTCTGGGGGGCTGAGG - Intergenic
1203762738 EBV:18797-18819 GGGGTCTGTCTGGGGGGCTGAGG - Intergenic
1203763667 EBV:21869-21891 GGGGTCTGTCTGGGGGGCTGAGG - Intergenic
1203764596 EBV:24941-24963 GGGGTCTGTCTGGGGGGCTGAGG - Intergenic
1203765525 EBV:28013-28035 GGGGTCTGTCTGGGGGGCTGAGG - Intergenic
1203766454 EBV:31085-31107 GGGGTCTGTCTGGGGGGCTGAGG - Intergenic
1203767383 EBV:34157-34179 GGGGTCTGTCTGGGGGGCTGAGG - Intergenic
1186078895 X:5909096-5909118 CATCTTTGGCTCGGGGGCTGGGG - Exonic
1187338182 X:18398830-18398852 GCTCTTTGCCTGGTGGACAGAGG - Intergenic
1187888236 X:23908779-23908801 GGTCTTTGGCTGGAGGGCAGTGG - Intronic
1187923949 X:24233499-24233521 GCACTTTGGTTGGGAGGCTGAGG - Intergenic
1190203068 X:48380873-48380895 ACTCTGTGTCTGCGGTGCTGTGG - Intergenic
1190207470 X:48414540-48414562 ACTCTGTGTCTGCGGTGCTGTGG + Intergenic
1191693031 X:63960280-63960302 CCTCTGTCTCTGGGGGGTTGGGG + Intergenic
1192903318 X:75522983-75523005 TGGCTCTGTCTGGGGGGCTGCGG - Exonic
1193149408 X:78109162-78109184 CCTGTTTGTCAGGTGGGCTGGGG + Intronic
1193165656 X:78277309-78277331 GTTCTTTGGCTGGGCAGCTGAGG - Intronic
1193443246 X:81568132-81568154 GCATGTTGTCTGGGGGTCTGGGG + Intergenic
1194077421 X:89414175-89414197 GCACTTTTTTTGGGGGGCGGGGG - Intergenic
1196387912 X:115178215-115178237 GGTCTGTGGCTGTGGGGCTGAGG + Intronic
1197151241 X:123222168-123222190 TCTCTGTGCCTGGGAGGCTGAGG - Intronic
1197386959 X:125813807-125813829 GCTCTCTGTCTGGTAGGGTGAGG - Intergenic
1198009670 X:132538600-132538622 GGTCTTTTTCTGGGGGGTTCCGG + Intergenic
1198481734 X:137047439-137047461 GCTGTTTCTGTGGGTGGCTGTGG + Intergenic
1201516534 Y:14824309-14824331 TATCTTTGGCTCGGGGGCTGGGG + Exonic