ID: 1161607013

View in Genome Browser
Species Human (GRCh38)
Location 19:5220737-5220759
Sequence GTATTACTAGGGCCCCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161607013_1161607022 0 Left 1161607013 19:5220737-5220759 CCTTTCAGGGGCCCTAGTAATAC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161607022 19:5220760-5220782 CCAGTGGAGGGTCAGGCATATGG 0: 1
1: 0
2: 1
3: 22
4: 221
1161607013_1161607019 -7 Left 1161607013 19:5220737-5220759 CCTTTCAGGGGCCCTAGTAATAC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161607019 19:5220753-5220775 GTAATACCCAGTGGAGGGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 104
1161607013_1161607024 2 Left 1161607013 19:5220737-5220759 CCTTTCAGGGGCCCTAGTAATAC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161607024 19:5220762-5220784 AGTGGAGGGTCAGGCATATGGGG 0: 1
1: 0
2: 0
3: 17
4: 187
1161607013_1161607023 1 Left 1161607013 19:5220737-5220759 CCTTTCAGGGGCCCTAGTAATAC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161607023 19:5220761-5220783 CAGTGGAGGGTCAGGCATATGGG 0: 1
1: 0
2: 1
3: 24
4: 164
1161607013_1161607025 9 Left 1161607013 19:5220737-5220759 CCTTTCAGGGGCCCTAGTAATAC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161607025 19:5220769-5220791 GGTCAGGCATATGGGGTATCAGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161607013 Original CRISPR GTATTACTAGGGCCCCTGAA AGG (reversed) Intronic
902682147 1:18050986-18051008 CTATTACTAGAGCCACTGAGGGG - Intergenic
904438539 1:30515027-30515049 TTATTCCAAGAGCCCCTGAAAGG + Intergenic
905395826 1:37665746-37665768 TTAGGACTAGGGCCCCTGAAAGG - Intergenic
909385374 1:75049339-75049361 ATATTACTAGAGCCCAGGAAGGG + Intergenic
913107463 1:115627868-115627890 CTATGTCTAGGGCCCCTGAAAGG + Intergenic
918330084 1:183450798-183450820 GACTTTCTAGGGCTCCTGAAAGG - Intergenic
920178689 1:204119244-204119266 GTCTTTCTACAGCCCCTGAATGG - Intronic
922035779 1:221846436-221846458 GTTTTATTTGGGCCCCTAAAGGG - Intergenic
922064808 1:222126340-222126362 ATATTACCAGGGCCCCTGGGAGG - Intergenic
923069425 1:230549215-230549237 GTATTTATAGCTCCCCTGAAAGG - Intergenic
923935011 1:238749631-238749653 GTATTACAAGGGCCATTGCAGGG - Intergenic
1063907948 10:10799534-10799556 GCCTTATTAGGGCCCTTGAAGGG + Intergenic
1067332116 10:45332185-45332207 GCATTACAAGAGCTCCTGAAGGG - Intergenic
1072224289 10:93353605-93353627 GTATTACTAGGACCCAGCAATGG + Intronic
1084670641 11:70604751-70604773 GTCTCACAATGGCCCCTGAAGGG + Intronic
1087414405 11:97835073-97835095 GTATTGCTAGGAACCCTGATGGG - Intergenic
1088339868 11:108751877-108751899 GTGTTACTGGGGCCACTGGAAGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090108946 11:123884048-123884070 GTGTCTCCAGGGCCCCTGAAGGG - Intronic
1108494814 13:51014615-51014637 GTATTACTAGGTGCTTTGAAGGG - Intergenic
1115087837 14:29538704-29538726 ATATTACTGGAGCCCATGAAAGG - Intergenic
1115177376 14:30579134-30579156 GAATTACTAGTGCCTCTAAAAGG + Intronic
1115304446 14:31919355-31919377 GTGTTTCTAGGGCCTCTAAACGG + Intergenic
1115410317 14:33066816-33066838 GTAGGAATGGGGCCCCTGAAAGG - Intronic
1119570922 14:75671370-75671392 GAATTGCAAGGGACCCTGAATGG - Intronic
1121870398 14:97401808-97401830 GTATTTCTAGGAGCTCTGAAGGG + Intergenic
1127432892 15:58929008-58929030 ATTTTACTAGGTCCCCTGTAAGG - Intronic
1127543676 15:59968683-59968705 TTATTACCAGGGCTCCTGCAAGG - Intergenic
1138720171 16:59070885-59070907 GTATGACTGGAGTCCCTGAAGGG + Intergenic
1144377275 17:14657062-14657084 CTATTACTAGGGGCACAGAAGGG + Intergenic
1144465212 17:15491560-15491582 GTCTTACTCCAGCCCCTGAAGGG - Intronic
1146478354 17:33181377-33181399 TTATTACTAGGGTTGCTGAAAGG - Intronic
1154299410 18:13180112-13180134 CTATCACTAGGGCCACTAAATGG - Intergenic
1155878742 18:31118148-31118170 GTATTAAGAATGCCCCTGAAGGG - Intergenic
1161607013 19:5220737-5220759 GTATTACTAGGGCCCCTGAAAGG - Intronic
1164450578 19:28359692-28359714 ATATCACAAGGGCTCCTGAAAGG + Intergenic
926643804 2:15266362-15266384 AGATTACTGGGGCCCCTTAAGGG - Intronic
927404725 2:22754238-22754260 GTTTCCCTAGGGCCCCTCAAGGG - Intergenic
934897281 2:98129871-98129893 ATATTTATAGGGCCCATGAAGGG + Intronic
934920956 2:98345232-98345254 TTATTACTTGGGCTTCTGAAAGG - Intronic
940714418 2:157203665-157203687 TTATTCTTAGGGCCCCTCAAAGG - Intergenic
943383140 2:187174562-187174584 GTATTACAAGGGCTACTGCAGGG + Intergenic
943441267 2:187931327-187931349 GTATTACAAGGGCTGCTGCAGGG + Intergenic
945024992 2:205611984-205612006 GCATTGCTGGGGCCCCAGAATGG + Intronic
948571672 2:238921726-238921748 GTATTAGAGGGGCCCCTGGAAGG + Intergenic
1171797869 20:29580346-29580368 GTGGTACTAGAGCCCCTGAGAGG + Intergenic
1181313046 22:21955852-21955874 GCCTTGCTAGGGCCCCAGAATGG + Intergenic
1181346153 22:22221924-22221946 GCCTTGCTAGGGCCCCAGAATGG + Intergenic
963974939 3:151469802-151469824 GTGTTACAAGGGCTCCTGCATGG - Intergenic
970606727 4:17688347-17688369 GTGTTACTGGGGACACTGAAAGG + Intronic
982746429 4:159107934-159107956 ATATTACTAGAGCCCCAAAATGG - Intronic
989623181 5:43404484-43404506 GTCTTACAAGAGCTCCTGAAGGG + Intronic
990404081 5:55470189-55470211 GAATTACTGGGACCCCTTAATGG - Intronic
992752912 5:79877523-79877545 GTATGTCCAGGGCCCCTGACTGG + Intergenic
993087789 5:83384933-83384955 GAATTTCAAGGGACCCTGAATGG + Intergenic
997329662 5:133051006-133051028 GTATTTGTAGGGCCCCCCAATGG - Intergenic
1001870806 5:175154031-175154053 GTTCTACTAGGACCCCTGGAAGG + Intergenic
1001896147 5:175383167-175383189 GTATAACTAGGGATCCTGGATGG + Intergenic
1002954838 6:1852009-1852031 GAATCACAAGGGTCCCTGAAGGG + Intronic
1020960947 7:14800800-14800822 GTATTACCATGGCCCGTCAATGG + Intronic
1022110401 7:27226608-27226630 GTTTTACTGGGGCCCCTGTGCGG - Intergenic
1033620931 7:143061565-143061587 AGATTACCAGGGCCCCTGGATGG - Intergenic
1045338667 8:101232353-101232375 GGATTACTTGAGGCCCTGAAAGG + Intergenic
1047541726 8:125774088-125774110 GTAGAACTAAGGCTCCTGAATGG + Intergenic
1052545192 9:29867642-29867664 GTATTACTAGGACCCAGGTAGGG - Intergenic
1053067366 9:35078148-35078170 TTGTTACTAGAGACCCTGAATGG - Exonic
1058043239 9:100328370-100328392 TTTTCACTAGGTCCCCTGAAAGG + Intronic
1058512936 9:105739335-105739357 AAATTACTAGGGATCCTGAATGG - Intronic
1189937973 X:46089095-46089117 GTCTTACAAGAGCTCCTGAAGGG + Intergenic
1191183789 X:57588980-57589002 GTATTACTTGGGCACATTAAAGG + Intergenic
1194196021 X:90893765-90893787 GCCTTACTAGGGACCCTGACAGG - Intergenic
1195350013 X:103986724-103986746 GTATGGCCAGGGCCCCAGAAGGG - Intergenic
1195357431 X:104052115-104052137 GTATGGCCAGGGCCCCAGAAGGG + Intergenic
1196931473 X:120685774-120685796 ATATAACTAGGACCCCTGAAGGG + Intergenic
1198385041 X:136120783-136120805 GAATTACGAGGGGCCCTGAATGG - Intergenic
1201908008 Y:19104920-19104942 GAGAAACTAGGGCCCCTGAAAGG - Intergenic