ID: 1161608766

View in Genome Browser
Species Human (GRCh38)
Location 19:5229479-5229501
Sequence CCCCCCGCCCACCTGGGCAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 274}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161608755_1161608766 -7 Left 1161608755 19:5229463-5229485 CCCGGCCCCGCCCCGGCCCCCCG 0: 1
1: 4
2: 86
3: 611
4: 3656
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608753_1161608766 -2 Left 1161608753 19:5229458-5229480 CCGTCCCCGGCCCCGCCCCGGCC 0: 3
1: 16
2: 101
3: 852
4: 3772
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608756_1161608766 -8 Left 1161608756 19:5229464-5229486 CCGGCCCCGCCCCGGCCCCCCGC 0: 1
1: 5
2: 132
3: 1009
4: 4662
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608743_1161608766 16 Left 1161608743 19:5229440-5229462 CCCGTCCCCGCCCGGAGCCCGTC 0: 1
1: 0
2: 2
3: 25
4: 284
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608752_1161608766 -1 Left 1161608752 19:5229457-5229479 CCCGTCCCCGGCCCCGCCCCGGC 0: 1
1: 14
2: 64
3: 579
4: 2584
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608749_1161608766 6 Left 1161608749 19:5229450-5229472 CCCGGAGCCCGTCCCCGGCCCCG 0: 1
1: 0
2: 6
3: 105
4: 755
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608748_1161608766 9 Left 1161608748 19:5229447-5229469 CCGCCCGGAGCCCGTCCCCGGCC 0: 1
1: 0
2: 3
3: 57
4: 598
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608745_1161608766 11 Left 1161608745 19:5229445-5229467 CCCCGCCCGGAGCCCGTCCCCGG 0: 1
1: 0
2: 4
3: 46
4: 396
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608747_1161608766 10 Left 1161608747 19:5229446-5229468 CCCGCCCGGAGCCCGTCCCCGGC 0: 1
1: 0
2: 5
3: 53
4: 610
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608744_1161608766 15 Left 1161608744 19:5229441-5229463 CCGTCCCCGCCCGGAGCCCGTCC 0: 1
1: 0
2: 1
3: 40
4: 429
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608754_1161608766 -6 Left 1161608754 19:5229462-5229484 CCCCGGCCCCGCCCCGGCCCCCC 0: 1
1: 17
2: 114
3: 953
4: 4075
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274
1161608750_1161608766 5 Left 1161608750 19:5229451-5229473 CCGGAGCCCGTCCCCGGCCCCGC 0: 1
1: 1
2: 9
3: 133
4: 1100
Right 1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG 0: 1
1: 0
2: 3
3: 19
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161608766 Original CRISPR CCCCCCGCCCACCTGGGCAT CGG Exonic
900177780 1:1298415-1298437 CCCCCCACCCACCTAGGCGCTGG - Exonic
900512786 1:3068388-3068410 CCGCCCGCCGGCCTGGGCAGTGG + Intergenic
900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG + Intronic
900606488 1:3525861-3525883 CCCCTCGCCAAGCTGGGCCTCGG + Intronic
900974989 1:6011351-6011373 CCTCCCGCACACCTGGCCCTGGG - Intronic
900975000 1:6011391-6011413 CCTCCCGCACACCTGGCCCTGGG - Intronic
901417753 1:9129161-9129183 TCCCCCGCCCATCTGGGCCCCGG + Exonic
901681317 1:10914454-10914476 CCCTCCTCCCACCTGTGCCTGGG - Intergenic
901872859 1:12148316-12148338 CAGCCAGGCCACCTGGGCATGGG - Intergenic
903474971 1:23613358-23613380 CCCCCGCCCCACCTGGGCCAGGG + Intronic
903812672 1:26043569-26043591 CCCAACACCCACCTTGGCATGGG + Intronic
904617148 1:31756072-31756094 GCCCCCGGGCACCAGGGCATTGG + Exonic
905272465 1:36795950-36795972 CCCCCAGCCCACCTCTGCCTGGG - Exonic
906216450 1:44043749-44043771 CCCTCTGCCCACCTGGGTGTGGG + Intergenic
906528351 1:46509398-46509420 TCCCCCGCCCTCCAGGGAATGGG - Intronic
906639622 1:47433844-47433866 CCCGCCTCCCACCTGGGCTAAGG + Intergenic
907278001 1:53327606-53327628 CCCCCCGCCCCCGCGGGCCTCGG - Intronic
911039972 1:93583632-93583654 CCACCCGCCCACCCGGGAAAAGG + Intronic
912393324 1:109320004-109320026 GCCCCTGCCAACCTTGGCATTGG + Intronic
914504959 1:148281026-148281048 CCCCTCGCTCACCTCGGCCTCGG + Intergenic
914507605 1:148303122-148303144 CCCCTCGCTCACCTCGGCCTCGG - Intergenic
914852760 1:151327222-151327244 CCCCCCACCCAACAGGGCAAAGG + Intronic
919803409 1:201366826-201366848 CTCCCCACTCACCTGGGCTTTGG + Exonic
919812492 1:201417859-201417881 GCCCCTGCCCAGCTGGGCCTTGG + Intronic
924087049 1:240463408-240463430 CCTCTCACCCACCTGGGCCTTGG - Intronic
1063472024 10:6295671-6295693 CCCCCAGGCCAGCTGGGCCTTGG + Intergenic
1071516492 10:86301123-86301145 CCCCCCACCCACCAGCCCATGGG + Intronic
1071526761 10:86363772-86363794 TCCCCGGCCCACCTAGGCAGCGG - Intronic
1072731551 10:97850139-97850161 CCCCCGGCCCACCTGAGCCCGGG + Intergenic
1072782100 10:98258120-98258142 GCCCTCGCCCACCTGGGCCCCGG + Exonic
1073452296 10:103617144-103617166 CCTCTCGCCCACCTGGGCCCTGG - Intronic
1076748566 10:132527987-132528009 CCCCCCGCCCCCCGGGGCCATGG + Intergenic
1076769017 10:132652985-132653007 CCCTCCGCCCACCTGCACATCGG - Intronic
1077020887 11:416764-416786 CCCCGCGCCCACCTGCGCCCTGG + Intronic
1077219543 11:1409621-1409643 CCCCCCACCCACCTCAGCAGTGG - Intronic
1077277176 11:1717959-1717981 CCCGCCGCCCCCCTGGGGCTTGG - Intergenic
1077287203 11:1772957-1772979 CCCCTCCCCCACCTGTGCCTGGG - Intergenic
1077374056 11:2197412-2197434 CAGCCCGGCCACCTGGACATGGG - Intergenic
1077418464 11:2436904-2436926 CCGCTCGCCCACCTGGGCACTGG + Intergenic
1077483823 11:2829923-2829945 CCCCCTCCCCACCAGGGTATTGG - Intronic
1077499108 11:2901312-2901334 CCCCCTGCCCACCAGGACTTTGG + Intronic
1077506906 11:2933798-2933820 GCCTCCGCCCACCTGAGCCTGGG + Intergenic
1078545858 11:12246446-12246468 CCCCCTGCCCAGCTGTGCAAAGG - Intronic
1079940242 11:26671595-26671617 CCCCCTTCCTACCTGGGAATAGG + Intronic
1080834481 11:35927763-35927785 CCCCCGGCCCTCCTTGGCAGGGG + Intergenic
1081598442 11:44475419-44475441 CTCCACGCCCACCTGGGCTCTGG - Intergenic
1083179415 11:60974590-60974612 CACCCGGGCCACCTGGGCAGAGG - Intronic
1083209687 11:61175382-61175404 TCCTCTTCCCACCTGGGCATAGG - Intergenic
1083419680 11:62545937-62545959 CTCCTCGCCCACCTCAGCATAGG + Intronic
1083573128 11:63770321-63770343 CCCCCCGCCCCCCTGAGCGCAGG - Intergenic
1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG + Intergenic
1084029910 11:66475400-66475422 CCCCCCTCCCAACGGGGCATGGG - Intronic
1084938850 11:72601567-72601589 CCCACCGCCCACCTCGGCCCAGG - Intronic
1086953639 11:92914901-92914923 GCCCTCGCCCACCTGGGAAGGGG - Intergenic
1088210704 11:107453305-107453327 CCCCCCAACCACCTGTCCATTGG - Intronic
1089519499 11:119054482-119054504 CCCCTGGCTCACCTGGGCAGTGG + Exonic
1089736852 11:120555639-120555661 CCACCTCACCACCTGGGCATTGG - Intronic
1090003159 11:122979249-122979271 CCTCCCGCCCACCTGCGTCTCGG + Exonic
1090206617 11:124887721-124887743 ACCCCCTCTCACCTGGGCTTTGG + Exonic
1091224979 11:133951690-133951712 CCCTCTCCCCACCTGGGCAGAGG + Intronic
1091795496 12:3295438-3295460 CCTCCTGCCCACCAGGGCCTGGG - Intergenic
1092659300 12:10722282-10722304 CGCCCTTCCCACATGGGCATGGG - Intronic
1100664037 12:96730996-96731018 CTCCCAGACCCCCTGGGCATGGG + Intronic
1100985537 12:100199334-100199356 CCTCCCCTCCACCTGGGCTTAGG - Intronic
1103201171 12:119089159-119089181 CCTCCCGACCACATGGGCAGAGG - Intronic
1103559973 12:121788522-121788544 CCCCATGCCCACTTGGGGATGGG + Intronic
1103919394 12:124391490-124391512 CCCCCCCCCCGCCAGGGCTTGGG - Intronic
1104289506 12:127455392-127455414 CCCCCCGCCCCGCAGGGCCTCGG + Intergenic
1104654948 12:130567579-130567601 CCCCCCACATAACTGGGCATCGG + Intronic
1104924429 12:132306462-132306484 CTGCCCGCCCACCTGGACCTCGG - Intronic
1106602552 13:31200213-31200235 CCCCGCGCCGACCGGGGCACGGG - Intronic
1108228582 13:48316251-48316273 CCCACCGCCCCCCTGGTCCTTGG - Intronic
1108355889 13:49628450-49628472 CCCCCCAGCCACCTGGGAAAAGG + Exonic
1113274924 13:108718284-108718306 CTGCCCACCCACCTGGACATTGG + Intronic
1113575164 13:111390215-111390237 CCCACCGTCCACCTGGGCCGAGG + Intergenic
1114032004 14:18586428-18586450 CCTGATGCCCACCTGGGCATGGG + Intergenic
1114076781 14:19165457-19165479 CCTGATGCCCACCTGGGCATGGG + Intergenic
1114085382 14:19234111-19234133 CCTGATGCCCACCTGGGCATGGG - Intergenic
1114417240 14:22552983-22553005 CCCCCTCCCACCCTGGGCATTGG - Intergenic
1114725992 14:24938266-24938288 TCCCCTGCCCACCTAGGCTTAGG + Intronic
1115177942 14:30586271-30586293 CCCACTGCCCAGCTGGGCAGTGG - Intronic
1115706768 14:36007351-36007373 CTCCCCGGCCACCTGAGCTTGGG - Intergenic
1119163263 14:72471004-72471026 ACCCCACCCCACCAGGGCATAGG + Intronic
1121006118 14:90491729-90491751 CCCCCCGCCTGCCTGTGCGTGGG + Intergenic
1121121315 14:91377462-91377484 CACCCCGGCCACCCGAGCATGGG + Intronic
1121618690 14:95331560-95331582 CTCCCCTCCCACCTGCGCCTGGG + Intergenic
1121629871 14:95414179-95414201 CCCCCCTCCAGCCTGGGCTTTGG + Intronic
1122328555 14:100897735-100897757 CCCCCCGCCAACCAGGGTAAAGG - Intergenic
1123017766 14:105383522-105383544 CACGCCGTCCACCTGGGCCTGGG + Intronic
1123493450 15:20800292-20800314 CCCCCCGCCCCGCTGCGCGTTGG + Intergenic
1123549958 15:21369394-21369416 CCCCCCGCCCCGCTGCGCGTTGG + Intergenic
1125295367 15:38197205-38197227 CCCCTTGTCCCCCTGGGCATAGG + Intergenic
1125410429 15:39400395-39400417 CCCCCTGCCCACCTGCTCCTTGG - Intergenic
1127674637 15:61228292-61228314 CCCCCCGCCAGCCTGGGCGCCGG + Intronic
1128448317 15:67784559-67784581 CCACCCTGCCACCTGGGGATGGG - Intronic
1128727538 15:69999095-69999117 CCTGCGGCCCACCTGGCCATGGG + Intergenic
1129413095 15:75360553-75360575 CCTCCCCCTGACCTGGGCATGGG + Exonic
1130908829 15:88257283-88257305 CCCCCCACCCACCCAGGCTTGGG - Intergenic
1131352338 15:91712730-91712752 CTCCCACCCCACCTGAGCATCGG - Intergenic
1202958288 15_KI270727v1_random:96612-96634 CCCCCCGCCCCGCTGCGCGTTGG + Intergenic
1132561290 16:595418-595440 CCTCACGTCCACCTGGGCCTGGG + Intronic
1132714486 16:1283983-1284005 CCCCCCTACACCCTGGGCATGGG - Intergenic
1132728280 16:1348227-1348249 ACCCCCGCCCACCTGGGGCCGGG - Exonic
1135733508 16:24913320-24913342 CCCCCAGCCCTCCTGGGAAGGGG + Intergenic
1135869000 16:26131621-26131643 CCCCCTGCTAACCTGGGCTTTGG - Intronic
1136240289 16:28939076-28939098 CCCCCTGCCCACCAGGCCCTAGG - Intronic
1136416519 16:30107517-30107539 CCCCCCTCTCCCCTGAGCATTGG - Intronic
1136460632 16:30407971-30407993 CCCCCCGCCCACCGTGGCCCTGG - Intronic
1137768591 16:50996657-50996679 CCTGCAGCCCACCTGGGCACTGG - Intergenic
1139482271 16:67237054-67237076 CCCGCCGCCCACCAGCGCCTGGG + Exonic
1139483007 16:67241120-67241142 CCCCCCGCCCACCCCCGCCTGGG + Intronic
1139805930 16:69565769-69565791 CCCCCCTCCCACCCTGGCAGCGG + Intronic
1141636776 16:85318095-85318117 CCTCCTGCCCACTTGGGCACAGG - Intergenic
1141701391 16:85643803-85643825 CCCACAGCCCACCTGGCCATTGG + Intronic
1141707545 16:85675997-85676019 CCTCCCTCCCACCTGCGTATGGG - Exonic
1142039256 16:87882071-87882093 CCCCAAGCCCACCTGGAAATGGG + Exonic
1142052533 16:87968137-87968159 CACCCAGCCAACCTTGGCATTGG - Intronic
1142237551 16:88929383-88929405 CCCCCTGCCCACCAGGACAGTGG + Intronic
1143888395 17:10084017-10084039 GCCCCTGCCTACCTAGGCATTGG + Intronic
1144858616 17:18285418-18285440 CTCCCTGGGCACCTGGGCATGGG - Exonic
1146256341 17:31393092-31393114 CTCCACCCGCACCTGGGCATGGG + Intronic
1146948741 17:36891440-36891462 CTCCATGCCCACCTGTGCATGGG - Intergenic
1147793601 17:43027710-43027732 CCCCTCCCCCACCTGGGAACTGG - Intronic
1152356963 17:79812169-79812191 CCCCTCCCCCACCTGGGCGGAGG - Intergenic
1152377537 17:79926555-79926577 CCCCCTCCCCATCTGGGCCTGGG + Intergenic
1152913666 17:83020612-83020634 CCACCAGCCCACCTGCCCATCGG + Intronic
1153977654 18:10283560-10283582 CCCACTGCCCACCCTGGCATGGG - Intergenic
1156469699 18:37369430-37369452 TCCCTCACCCACCTGGGCAAAGG - Intronic
1160505707 18:79425774-79425796 TCCCCCGCCCACCTGGTGAATGG - Intronic
1160718724 19:588534-588556 CCCGCCGGCCACCTCCGCATAGG - Intergenic
1160822871 19:1066581-1066603 CCCCACGTCCACCTGGTCCTGGG - Intronic
1160881898 19:1324825-1324847 CCCCCCGCACACGCGGGCACAGG - Intergenic
1161301047 19:3543483-3543505 CCCCCCCCCGCCCTGGGCAGCGG + Intronic
1161342556 19:3751177-3751199 CCACCCGCACACCTCGCCATAGG + Exonic
1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG + Exonic
1161713728 19:5864029-5864051 CCACCCTCCCACCTGGGCCTGGG + Intergenic
1161849481 19:6731170-6731192 CTCCCGTCCCACCTGGGCCTCGG + Intronic
1162301505 19:9847583-9847605 CCCCCGGGCCCCCTGGGCAGAGG - Intronic
1162352230 19:10157834-10157856 CCTCCAGCCCACCTGTGCAGCGG - Intronic
1162445105 19:10718131-10718153 CTCCCCGCCCGCCCGGGCCTCGG - Exonic
1162480278 19:10923502-10923524 CTCCACGCCCTCCTGGCCATGGG - Exonic
1162567393 19:11451789-11451811 CCCCCCCCCCACCGAGGCCTAGG - Exonic
1162750561 19:12826763-12826785 CCCCACGCTCACCTGTCCATAGG + Exonic
1162908542 19:13837193-13837215 CCCCCCGCCCCCCAGAGCACAGG + Intergenic
1163691580 19:18741533-18741555 CCCCACACCTACCTGGGCATAGG - Intronic
1164640806 19:29824179-29824201 CCCCCTGCCCAGCTGGCTATGGG - Exonic
1165061388 19:33206849-33206871 CACCCCCCCCACCTGGCCATGGG - Intronic
1165062503 19:33211710-33211732 CCCCACCCCCACCTGGACACAGG + Intronic
1165341320 19:35214260-35214282 CCCCATGCCCTCCTTGGCATAGG + Intergenic
1165448400 19:35869063-35869085 ACCCCCTCCCGCCTGGACATAGG + Intronic
1165774974 19:38399059-38399081 CCCCCCGCCCACCATGGAAGGGG - Intergenic
1166125990 19:40715695-40715717 CTCCCCGCCCACCTGCGGAATGG + Intronic
1166359621 19:42247746-42247768 CCCCCCACCCGCCTGCCCATGGG + Exonic
1166856884 19:45786648-45786670 CCCACCGCCCACTTGGCCAGCGG + Exonic
1167052054 19:47085306-47085328 GCCCCTGCCCACCTCGGCCTCGG + Exonic
1167426299 19:49431442-49431464 CCCCCCGCCCCCGTAGGCTTCGG - Exonic
1168138049 19:54364770-54364792 CCCACCGCCCTCCTGGGCCTAGG - Exonic
925008809 2:467180-467202 CCTCCCTCCCACCTGGGCCCTGG + Intergenic
926688560 2:15717292-15717314 CCCCACCCCCGGCTGGGCATAGG + Intronic
926862236 2:17321521-17321543 CCCACTGTCCACCTGGGGATGGG - Intergenic
927965345 2:27264504-27264526 CCGCCCGCACACCTTGGCACGGG - Intronic
928149135 2:28810683-28810705 CCCCCCGCCCGCCCGAGCCTCGG - Intronic
928595703 2:32856987-32857009 CCCCCTGCCACCCTGGGGATAGG - Intergenic
929127690 2:38536118-38536140 CTCCCCGCCACCCTGGGCTTTGG + Intergenic
930001834 2:46866859-46866881 CCCCCCGGCCAGCTGGACTTTGG - Intergenic
930857890 2:56038861-56038883 CCCCCCGCCCACCTCTGAGTAGG + Intergenic
933810698 2:86031227-86031249 CCCCCTGCCCAGCTGTGCAGGGG + Intronic
933849990 2:86358337-86358359 CCCCCCACCCCCCTGAGCACTGG + Intergenic
934105549 2:88691747-88691769 CCCCCGGCCCTCCCGGGCAGCGG - Exonic
934559199 2:95303589-95303611 TCCCCCGCTCTCCTGGGCCTGGG + Intronic
937221332 2:120344643-120344665 CCGGCCGCCCAGCTGGGCAAGGG + Intergenic
937419594 2:121742509-121742531 CCCCCTGCCCACCAGAGCCTGGG - Intronic
938350698 2:130596938-130596960 CCACCAGCCCACCCGGGCCTGGG + Intronic
938383193 2:130848074-130848096 CTCCCTGCCCACCTGGGCAGAGG - Intronic
947534108 2:230930056-230930078 CCCGCCTCCCACCTGGGCCTTGG + Intronic
947740016 2:232480706-232480728 CACCCAGCCCACCTGGGCAAAGG + Exonic
1169074636 20:2753004-2753026 CCCCACGCCCACCTGGCCTCTGG - Intronic
1169827556 20:9786215-9786237 CCTCCCTTCCAGCTGGGCATGGG - Intronic
1171011941 20:21513732-21513754 TCCCCCGCCCGCCGGGGCAGGGG - Exonic
1172011406 20:31848213-31848235 ACCGCCCCCCAGCTGGGCATGGG - Intronic
1173403932 20:42748696-42748718 CCCCCCGCTCCCCAGGGCTTTGG - Intronic
1173575883 20:44112791-44112813 CCCCCTGGCCACCTGGTCAGTGG + Exonic
1175381389 20:58566701-58566723 GCCCCCATGCACCTGGGCATGGG + Intergenic
1175503354 20:59465639-59465661 GCCCCCACCCACCTGTGCTTTGG + Intergenic
1175976084 20:62711126-62711148 CCCCCAGCCCACCTGGGTGGTGG - Intronic
1178351200 21:31873889-31873911 CCCCTCGCGCACCTTGGCAAAGG - Exonic
1180292589 22:10859082-10859104 CCTGATGCCCACCTGGGCATGGG + Intergenic
1180495394 22:15888504-15888526 CCTGATGCCCACCTGGGCATGGG + Intergenic
1180674884 22:17580409-17580431 CCCCCCACCCTGCTGGGTATAGG - Intronic
1180910584 22:19447366-19447388 CTCCCGGCGCACCTGGGCCTCGG + Exonic
1181290797 22:21791469-21791491 CCACCCCCCGACCTGGGCACAGG - Intronic
1181391726 22:22588061-22588083 CCCCACCCTCACCTGGGCCTGGG - Intergenic
1181415881 22:22758586-22758608 CCCCACCCTCACCTGGGCCTGGG - Intronic
1181428008 22:22856436-22856458 CCCCACCCTCACCTGGGCCTGGG - Intronic
1183333005 22:37231388-37231410 CCCCCCACCCACCTGCCCAGTGG - Exonic
1183366204 22:37408359-37408381 CCTCCCTCCCACCTGGTCATGGG + Intronic
1183420911 22:37710701-37710723 CCCACCACCCACCTGTGCCTAGG - Intronic
1183735395 22:39642210-39642232 CCACCCACCCTCCTGGGCAGAGG - Intronic
1184290894 22:43497666-43497688 CCACCCTCCCAGCTGGGGATGGG + Intronic
1184415790 22:44351066-44351088 CCCCCAGCCCACCTGCCCAGGGG + Intergenic
1184533561 22:45071650-45071672 CCCCCAGCCCACCAGGACAAGGG - Intergenic
1185083644 22:48723988-48724010 ACCCCTGCCCATCTGGTCATTGG + Intronic
949425095 3:3907901-3907923 CTCCCTGCCAACCTGGCCATGGG + Intronic
950177196 3:10883035-10883057 CCCCCCGCCCCCTTGGGCTGTGG - Intronic
950188218 3:10958451-10958473 CCCTCAGCCCACTTGGGCAGTGG - Intergenic
950921817 3:16702579-16702601 CCCCAAACCCACCTGGCCATGGG + Intergenic
952901873 3:38116330-38116352 CACCCCCTCCACCTGGGTATGGG + Intronic
953549888 3:43894029-43894051 CCCCCCGCCCCCCTGGACTCCGG - Intergenic
954902538 3:54032113-54032135 GCCCCAGCCCCCCTGGGCCTAGG - Intergenic
955191909 3:56769522-56769544 CCCCCAGCCCATATGGGCACAGG + Intronic
957290222 3:78269306-78269328 CCCCTCTCCCACCTTGGCCTGGG + Intergenic
957646756 3:82939915-82939937 CCGCCCGCCCAGGTGGGCAGTGG + Intergenic
961451940 3:127006195-127006217 CCCTCCGCCCGCCTGGGCCTGGG + Intronic
961530307 3:127536449-127536471 CCCCCACCCCACCTGGACCTTGG - Intergenic
961552434 3:127676960-127676982 CCCCCAGGCCGCCTGGACATTGG + Exonic
962105718 3:132386624-132386646 CCCACTGCCCAGCTGGGCAGTGG - Intergenic
962274664 3:134002960-134002982 CCATCTGCCCACCTGGGCATGGG + Intronic
968628108 4:1637178-1637200 CCCACCCCCCACCCGAGCATGGG - Intronic
969496604 4:7529911-7529933 CCCCCCGCCATCCTGGGGAGGGG + Intronic
969698248 4:8748098-8748120 CCCACCCCCCGCCTGGGCAGAGG - Intergenic
971907725 4:32748639-32748661 ACACACGCCCACCTGGGCTTTGG + Intergenic
973640034 4:52893559-52893581 TCCCCTGCCCACATGGTCATAGG + Intronic
1202770366 4_GL000008v2_random:199640-199662 GACCCAGCCCACCTGGACATGGG + Intergenic
985685072 5:1277642-1277664 CCCACCGCCCACCTGTGCCCGGG - Intronic
985842742 5:2320875-2320897 CACCCCACCCTCCTGGCCATGGG - Intergenic
1000082203 5:157858883-157858905 CCCCTCCCCCACGTGGGCCTCGG + Intronic
1000441750 5:161271831-161271853 CCCCCAGCCCATCTAGACATGGG - Intergenic
1001673661 5:173494625-173494647 CCTCCCTGCCACCTGGGAATTGG - Intergenic
1002355705 5:178627225-178627247 CCCCCCGCCCACCCGGTCCCGGG + Intronic
1002364586 5:178700132-178700154 GCCCCCGTCGCCCTGGGCATGGG + Intergenic
1002365042 5:178703229-178703251 CCCTCCGCACACCTGTGCACAGG - Intergenic
1002428201 5:179188016-179188038 CCCCTCCCCCACCTTGGCAGAGG - Intronic
1002430020 5:179198129-179198151 CCCCCCGCCCCCGAGGGCATTGG - Intronic
1002530507 5:179841728-179841750 CCCACAGCCCACCTGGGCATTGG - Intronic
1002599546 5:180346465-180346487 CCCCCACCCCACCAGGGCCTCGG + Intronic
1006319840 6:33313915-33313937 CCCCACTCCCACCCTGGCATCGG + Intronic
1011519826 6:88193390-88193412 CACCCTGCCCACCTGGGCTGGGG + Intergenic
1012694097 6:102355816-102355838 CACCCCTCCCAGCTGGGTATAGG - Intergenic
1013543022 6:111130666-111130688 CCCTCCCACCACCTGGGCCTTGG + Intronic
1016690709 6:146934550-146934572 CCCCCCACACAGCTGGTCATGGG - Intergenic
1019342719 7:516164-516186 CCCCCCGCCCAGCTGTGCTGTGG + Intronic
1019933262 7:4237499-4237521 CCACCCGCCCGGCTGGACATTGG + Intronic
1019982151 7:4629538-4629560 TTCCACCCCCACCTGGGCATGGG + Intergenic
1020352163 7:7232776-7232798 CACCACGCCCAGCCGGGCATGGG + Intronic
1022551992 7:31249752-31249774 CCCGCATCCCACCTGGGGATAGG - Intergenic
1024247268 7:47479876-47479898 CCCCCTGCCCACCTGAGCCTCGG - Intronic
1024247295 7:47479972-47479994 CCCCCTGCCCATCTGAGCCTTGG - Intronic
1026050245 7:66940611-66940633 CCCTCCTCCCTCCTGGGCTTTGG - Intronic
1026817206 7:73522164-73522186 CCCCCCGCCGACCTCCGCTTCGG + Exonic
1029420084 7:100467770-100467792 CCCCCGCCCCACCGGGGCCTGGG - Intronic
1032279119 7:130486751-130486773 CCACCCGCCCTCCTGGGCGTGGG + Intronic
1034243247 7:149625092-149625114 CCCCTCGCCCAGCTGGGCCCCGG + Intergenic
1035129625 7:156640323-156640345 CCGCCCGCCCACCTGGGCCTGGG - Exonic
1035344610 7:158189960-158189982 CCCTCCGCACACCTGTGCCTCGG - Intronic
1035624781 8:1062647-1062669 CCTCCCTCCCTCCTGGCCATAGG + Intergenic
1035826900 8:2654252-2654274 TCCCCTGCCCACCTGTCCATGGG - Intergenic
1038296066 8:26291741-26291763 CACCCCCCTCACCTGGGGATGGG - Intronic
1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG + Intergenic
1043969675 8:86515002-86515024 CCCCCCGCTCAACTGGGCATTGG - Intronic
1047615421 8:126558539-126558561 CGCCCCGCCCACTCGGGCCTCGG + Intergenic
1047760016 8:127947546-127947568 CTCCCCTCCCAGGTGGGCATAGG + Intergenic
1048007373 8:130430524-130430546 GACCCTGACCACCTGGGCATGGG + Intronic
1049251478 8:141591429-141591451 TCCTCCTCCCACCTGGGCAGAGG + Intergenic
1049347215 8:142145440-142145462 CTGCCTGCCCACCTGTGCATTGG - Intergenic
1049654857 8:143792964-143792986 GCCCCCACACACCTGGGCAGGGG + Exonic
1050333598 9:4569851-4569873 CCCCAGGCCCTGCTGGGCATTGG + Intronic
1051195859 9:14562262-14562284 CACCGGGCCCACCTGGGCAGGGG - Intergenic
1055714733 9:79104591-79104613 GACCCAGCCCTCCTGGGCATTGG + Intergenic
1056546761 9:87620140-87620162 TCCACCGCCCACCTGGGGAGAGG - Intronic
1057355036 9:94325522-94325544 GCCCCCAACCACCTGGGCAGAGG + Exonic
1057652715 9:96932112-96932134 GCCCCCAACCACCTGGGCAGAGG - Exonic
1058070771 9:100598742-100598764 TCCCCCGCCTACCTGGGGACTGG - Intergenic
1059443246 9:114322856-114322878 CCCCGCACCCACCTTGGCCTTGG + Intergenic
1059444438 9:114329627-114329649 CCCCGCACCCACCTTGGCCTTGG + Intergenic
1060688833 9:125638058-125638080 CCCCACGCCCAGCTGGTAATGGG + Intronic
1061008668 9:127942704-127942726 CCCCCCCACCACCAGGGCAAGGG + Exonic
1061149812 9:128822294-128822316 CCCCCTGCCCACGTGTGCCTGGG + Exonic
1061939641 9:133877048-133877070 CTCCCCACCCACCTGGGGAAAGG + Intronic
1062423816 9:136497005-136497027 CCCGACACCCACCTGGGCATCGG - Exonic
1062614704 9:137391095-137391117 CCCCCCTCCCAGCAGGGCCTCGG + Intronic
1062659077 9:137619039-137619061 CCCGCTGCTCACCTCGGCATCGG - Exonic
1185548768 X:967011-967033 GGGCCTGCCCACCTGGGCATCGG + Intergenic
1186654971 X:11602581-11602603 TGCTCTGCCCACCTGGGCATGGG + Intronic
1187154764 X:16712471-16712493 CCCACCGCCCACACGGGCCTCGG + Intronic
1187257362 X:17655322-17655344 CCCGCCGCCACTCTGGGCATGGG + Intronic
1188159634 X:26784013-26784035 CCGACTGCCCAACTGGGCATTGG - Intergenic
1190240652 X:48655378-48655400 CCCACCGCTCTACTGGGCATTGG + Intergenic
1190708483 X:53049135-53049157 CCCCCCTCCCAGCTTGGCAGTGG + Exonic
1199764382 X:150930322-150930344 CCCCCCGCCCACCTCTTCAAAGG + Intergenic
1200093691 X:153647535-153647557 CCCCTGGCCCACCTGGCCCTGGG + Intronic
1200138702 X:153886770-153886792 CCTGCCGCCCACCTGGGCTCTGG - Intronic
1200182432 X:154158942-154158964 CATCCCGCCCACCGGGGCTTTGG + Exonic
1200188086 X:154196056-154196078 CATCCCGCCCACCGGGGCTTTGG + Intergenic
1200193736 X:154233196-154233218 CATCCCGCCCACCGGGGCTTTGG + Exonic
1200199491 X:154271000-154271022 CATCCCGCCCACCGGGGCTTTGG + Exonic
1201763021 Y:17559152-17559174 CCCCCCACTCACTTGGCCATGGG + Intergenic
1201838531 Y:18346837-18346859 CCCCCCACTCACTTGGCCATGGG - Intergenic