ID: 1161609137

View in Genome Browser
Species Human (GRCh38)
Location 19:5231350-5231372
Sequence CTCACACAGAGGTGGGACCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 288}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161609137_1161609145 16 Left 1161609137 19:5231350-5231372 CCCTGGTCCCACCTCTGTGTGAG 0: 1
1: 0
2: 1
3: 38
4: 288
Right 1161609145 19:5231389-5231411 GTACTGGGTCCACTTCTCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1161609137_1161609144 1 Left 1161609137 19:5231350-5231372 CCCTGGTCCCACCTCTGTGTGAG 0: 1
1: 0
2: 1
3: 38
4: 288
Right 1161609144 19:5231374-5231396 GACAGTCGTGATGCGGTACTGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1161609137_1161609143 0 Left 1161609137 19:5231350-5231372 CCCTGGTCCCACCTCTGTGTGAG 0: 1
1: 0
2: 1
3: 38
4: 288
Right 1161609143 19:5231373-5231395 CGACAGTCGTGATGCGGTACTGG 0: 1
1: 0
2: 0
3: 2
4: 11
1161609137_1161609147 27 Left 1161609137 19:5231350-5231372 CCCTGGTCCCACCTCTGTGTGAG 0: 1
1: 0
2: 1
3: 38
4: 288
Right 1161609147 19:5231400-5231422 ACTTCTCCAAGGCCTCCAGCAGG 0: 1
1: 0
2: 4
3: 31
4: 245
1161609137_1161609142 -6 Left 1161609137 19:5231350-5231372 CCCTGGTCCCACCTCTGTGTGAG 0: 1
1: 0
2: 1
3: 38
4: 288
Right 1161609142 19:5231367-5231389 TGTGAGCGACAGTCGTGATGCGG 0: 1
1: 0
2: 0
3: 4
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161609137 Original CRISPR CTCACACAGAGGTGGGACCA GGG (reversed) Exonic
900502323 1:3012547-3012569 TTCACAGAGAGGCAGGACCATGG - Intergenic
902281319 1:15376776-15376798 CTCACAAAGTGGTGGGATGATGG - Intronic
902398331 1:16144279-16144301 GGCCTACAGAGGTGGGACCACGG - Intronic
902472357 1:16657607-16657629 CTCACACTGGGGTGGGGGCATGG - Intergenic
902486447 1:16749839-16749861 CTCACACTGGGGTGGGGGCATGG + Intronic
902747730 1:18484438-18484460 CTCCCTCAGAGGTGGAACAAGGG - Exonic
902907118 1:19566514-19566536 CTCCCACGTAGGTGGGACTATGG - Intergenic
903215205 1:21839810-21839832 CTCAGCCACAGGTGTGACCAAGG - Exonic
903759993 1:25691057-25691079 CTCCCACAGTGCTGGGACTACGG - Intronic
904063495 1:27729328-27729350 CTCCCATATAGCTGGGACCAGGG + Intronic
904522422 1:31105877-31105899 CCCACAAATAGCTGGGACCACGG - Intergenic
904776417 1:32910666-32910688 CTCCCAAGGAGCTGGGACCACGG - Intergenic
905395026 1:37661348-37661370 TTCTCCCAGAGGTTGGACCAGGG - Intergenic
905578926 1:39068615-39068637 CTCCCAAGGAGTTGGGACCATGG - Intergenic
905690042 1:39936413-39936435 CTCAGGCAGAGGTGGGAGGAAGG + Intergenic
905991133 1:42337674-42337696 CTCCCACATAGCTGGGACCAAGG - Intergenic
906201100 1:43960931-43960953 CTCACACAGCTGTGGCACCATGG - Exonic
906294217 1:44639304-44639326 CCAACACACAGGAGGGACCATGG - Intronic
906502155 1:46349260-46349282 CTCCCAGATAGCTGGGACCACGG + Intronic
907166008 1:52411943-52411965 CTCCCAAGGAGCTGGGACCACGG + Intronic
907677582 1:56532892-56532914 CAGCCACAGAGGTGGGCCCAGGG + Intronic
911226891 1:95316650-95316672 CTCAGATAGAGGTGGCAGCAGGG - Intergenic
912418848 1:109530058-109530080 GGCACAGAGAGGTGGGCCCAGGG + Intergenic
913061321 1:115211103-115211125 CCCACACAGATGTGGAAGCAGGG - Intergenic
913657079 1:120971580-120971602 CTCCCACAGATTTGGCACCAGGG + Intergenic
914008423 1:143754663-143754685 CTCCCACAGATTTGGCACCAGGG + Intergenic
914521642 1:148422834-148422856 CTCCCACAGATTTGGCACCAGGG + Intergenic
914647053 1:149663315-149663337 CTCCCACAGATTTGGCACCAGGG + Intergenic
915108859 1:153550295-153550317 CTCCCCCAGAGTTGGGAACAGGG + Intergenic
915322999 1:155066274-155066296 CAGACACAGAGGTGGAAACAGGG - Intronic
915701556 1:157801795-157801817 CTCACACAGAGGCCCCACCATGG + Intronic
918100055 1:181365288-181365310 CTCCCACGTAGGTGGGACTATGG + Intergenic
920438047 1:205960894-205960916 ACCACACAGAGGGGGGACAATGG + Intergenic
921598987 1:217087403-217087425 CTCAGTCAGAGATGGGAACATGG + Intronic
921956271 1:220986638-220986660 CTTACACAGAGGTGAAATCAAGG - Intergenic
923812007 1:237329231-237329253 TTCATACAGTGGTGTGACCATGG + Intronic
924825267 1:247531999-247532021 CCCACACAGCGGTAGGAGCATGG + Exonic
1063101096 10:2950848-2950870 CTCACCCTGACGTGGGTCCATGG + Intergenic
1064431691 10:15276805-15276827 CTCTCAAATAGTTGGGACCATGG + Intronic
1064647390 10:17473404-17473426 CTCACACAGATGTTGAACCTTGG - Intergenic
1067146008 10:43694495-43694517 CTGACAGGGAGGTGGGACCCTGG + Intergenic
1067844868 10:49711600-49711622 CTCACACATAGGCGTGCCCAAGG - Intergenic
1068103226 10:52581801-52581823 TTCACACAGAAGGGGGACCCTGG + Intergenic
1068111412 10:52684965-52684987 ACCGAACAGAGGTGGGACCAGGG - Intergenic
1069467655 10:68656244-68656266 TTTCCACAGAGGTGGGGCCAGGG - Intronic
1069598065 10:69685579-69685601 CTCACAAAGTGGTGGGATGACGG + Intronic
1069661402 10:70126014-70126036 CCCAGACAGAGGAGGGCCCAGGG + Intronic
1070612506 10:77943255-77943277 CTCTAACAGAGGTGGAAGCACGG - Intergenic
1070630854 10:78083501-78083523 CTGACAATGAGGTGGGACAATGG + Intergenic
1071482984 10:86078909-86078931 CTGACATAGAGCTGGGTCCAGGG - Intronic
1073626199 10:105100032-105100054 ACCATACAGACGTGGGACCAAGG - Intronic
1077045944 11:545186-545208 CTCACTCAGAGCTGGGGCCAGGG + Intronic
1078634762 11:13039102-13039124 CTCACACAGAGGTAGGAACATGG + Intergenic
1078876592 11:15404992-15405014 TTCATAGAGAGGTGGTACCAGGG - Intergenic
1079371331 11:19855506-19855528 CTCCCACATTGGTGGGAACATGG + Intronic
1080901279 11:36494249-36494271 CTCCCAAAGAGCTGGGACTACGG - Intronic
1083055262 11:59813092-59813114 CTCCCACAGTGCTGGGACTACGG + Intergenic
1083305077 11:61757884-61757906 CTGGCACAGAGCTGGGACCCAGG - Intronic
1083961068 11:66015373-66015395 CTCACTCCCAGGTGGGACCCAGG - Intergenic
1084510042 11:69597618-69597640 ATCACACAGAGGGGCAACCAAGG - Intergenic
1084600212 11:70141098-70141120 TGGACAGAGAGGTGGGACCAGGG - Intronic
1084948946 11:72654202-72654224 CCCACCCAGCGCTGGGACCAGGG + Intronic
1085341050 11:75731875-75731897 GACACACAGTGGTGGTACCATGG - Intronic
1088833864 11:113560794-113560816 CACACACAGAAGTGTGACCATGG - Intergenic
1089118285 11:116113682-116113704 CTCACACTAAGGTGGAGCCATGG - Intergenic
1089712834 11:120328582-120328604 CACACACAGAGGGGAGACCATGG - Intronic
1091888439 12:4033053-4033075 CTAACACAGGGGTGTGACCTTGG + Intergenic
1093795758 12:23308384-23308406 CTCCCAAAGAGCTGGGACCACGG - Intergenic
1096408479 12:51360635-51360657 CTCAGGCAGAGGTGGCATCAGGG - Intronic
1097112975 12:56675967-56675989 CTCACAAAGTGCTGGGATCATGG - Intronic
1097761579 12:63472017-63472039 CTCCCAAAGTGCTGGGACCACGG - Intergenic
1098849938 12:75584042-75584064 CTCCCACATAGCTCGGACCACGG - Intergenic
1101881683 12:108630081-108630103 GTCCCACAGAAGTGGGGCCAGGG + Intronic
1103170928 12:118819212-118819234 CTCCCAAGGAGCTGGGACCACGG - Intergenic
1103366619 12:120388971-120388993 CTCACACAGCGCTGAGCCCAGGG + Intergenic
1103548564 12:121719461-121719483 CTCCCAAGTAGGTGGGACCATGG - Intronic
1104022298 12:125001175-125001197 CTCCCAAATAGCTGGGACCAAGG + Intronic
1105040103 12:132955215-132955237 TTCACAGAGAGGTGTGAACAAGG + Intronic
1105603435 13:21907870-21907892 GTCTCACAGTGGTGGGACCGCGG - Intergenic
1107744399 13:43489490-43489512 TTGCCACAGAGGTAGGACCATGG + Intronic
1108887043 13:55199577-55199599 CTGTCAGAGAGGTGAGACCATGG - Intergenic
1109683432 13:65783593-65783615 CTCACACAGACCTGGCACCTGGG - Intergenic
1113463098 13:110495515-110495537 CCCACCCAGAGGTGGGGCCATGG + Intronic
1117269409 14:54126614-54126636 CTGCCACAAAGGTGGAACCAAGG + Intergenic
1117780286 14:59224865-59224887 CTCACACAGTGGAAGGAGCAAGG - Intronic
1119604919 14:76007308-76007330 ATCACGCAGTGGTGAGACCAGGG - Intronic
1120707249 14:87757483-87757505 CTCCCAAGTAGGTGGGACCATGG + Intergenic
1121469597 14:94141744-94141766 CTCACAGAGTGGTGGGATTACGG + Intergenic
1121840357 14:97129097-97129119 CTCTCACAGAGGTGCCACCAAGG + Intergenic
1121908854 14:97770922-97770944 CTCACACAGAGTGGGAACCATGG + Intergenic
1122891718 14:104735130-104735152 CTCACACACAGGTCGGGGCAGGG - Intronic
1122995700 14:105262629-105262651 CTCCCACAGAGCTGGGAGCCTGG + Intronic
1123101397 14:105804140-105804162 TGCACACAGTGGTGAGACCACGG + Intergenic
1125966038 15:43876325-43876347 CTGATGCAGAGCTGGGACCACGG + Intronic
1126503461 15:49375027-49375049 CACACAGAGAGGTGGGAGGATGG - Intronic
1127424067 15:58837844-58837866 CTCCCAAAGAGCTGGGACTATGG - Intronic
1127653459 15:61032565-61032587 CACACACCCAGGTTGGACCAAGG + Intronic
1127851160 15:62913078-62913100 CTCACACATATCTGGGACCAGGG - Intergenic
1128155338 15:65388498-65388520 CGCGCACAGAGGTGGGACCTGGG - Exonic
1129120564 15:73393959-73393981 GAGGCACAGAGGTGGGACCAGGG + Intergenic
1130298772 15:82665016-82665038 CTCACAAAGAGGTGGAATAAAGG - Intronic
1131456632 15:92587073-92587095 CTCCCACATAGGTGGTACCGGGG - Intergenic
1131461804 15:92622821-92622843 CTCTCACAGAGGAAGGAACAGGG - Intronic
1131465136 15:92648755-92648777 GTGGCACAGAGGAGGGACCATGG - Intronic
1132406257 15:101543228-101543250 CACACACAGCGGTGGGACCGGGG + Intergenic
1132914683 16:2337494-2337516 CTCCCAAATAGCTGGGACCATGG + Intronic
1133237061 16:4392313-4392335 GTCACCCTGAGGTGGGACCATGG + Intronic
1133394526 16:5435577-5435599 CTGAGACACAGGTGGGACCCAGG + Intergenic
1134197100 16:12167685-12167707 CTCTTAGAGATGTGGGACCAAGG + Intronic
1134257549 16:12624622-12624644 CTCTCGCATAGCTGGGACCACGG + Intergenic
1134351858 16:13444939-13444961 CTCCCAGAGAGCTGGGACCATGG + Intergenic
1135223458 16:20635270-20635292 CTCCCAAGGAGCTGGGACCACGG - Intronic
1135584627 16:23659600-23659622 CTGTCACAGAGGTATGACCATGG + Intronic
1136502303 16:30678122-30678144 CTCCCACAGTGCTGGGAGCACGG + Intergenic
1137250278 16:46736268-46736290 CTCTCACAGTGCTGGGATCAAGG + Intronic
1139946988 16:70648296-70648318 CTCCCACAGTGCTGGGATCACGG - Intronic
1140349632 16:74249645-74249667 CTTATACAGAGGTGGGAAGAGGG + Intergenic
1141349976 16:83285888-83285910 ATCACAGAGAAGTGGGACAAGGG + Intronic
1142140725 16:88471620-88471642 CACTCACAGAGGTGGGGTCAGGG + Intronic
1145010549 17:19365295-19365317 GTCACACTGAAGTGGGACCAAGG + Intronic
1146387843 17:32393397-32393419 CTCCCCCATAGCTGGGACCATGG - Intergenic
1146475272 17:33157669-33157691 CTCAGACCAAGGTGGGAGCAGGG - Intronic
1147222470 17:38944818-38944840 CGCACACAGTGGTGCGATCATGG - Intronic
1147690810 17:42313234-42313256 CTCACACACAGGTGGGGCCTGGG - Intergenic
1147889110 17:43704670-43704692 CCCACACAGAGGTGGGAGGTGGG - Intergenic
1148629529 17:49096370-49096392 CTCCCAAAGAGCTGGGACTATGG - Intergenic
1148822621 17:50368373-50368395 CTCACACAGAGCCGGGCCCTGGG + Intronic
1148889200 17:50795606-50795628 CTGACACGGAGGTGGCACAAAGG + Intergenic
1150294400 17:64000123-64000145 ATGACACATAGGTGGGTCCAGGG + Intronic
1151782215 17:76254710-76254732 CTCCCACAGTGCTGGGACTATGG + Intergenic
1152223034 17:79079645-79079667 CTGACACAGAGGTGAGTCCTTGG - Intronic
1152278640 17:79372476-79372498 ATCACACAGAGGCGGAGCCATGG - Intronic
1152407430 17:80105631-80105653 CACACATGGATGTGGGACCATGG - Intergenic
1152538899 17:80965040-80965062 CTCACACAGAGCTGTCAGCAGGG + Exonic
1153312712 18:3692872-3692894 CCAACACAGAGCTGGGACCTAGG + Intronic
1153774531 18:8441022-8441044 CTCACACAAAGTGGGGGCCAAGG + Intergenic
1153967012 18:10191268-10191290 CACACACAGAGGAAAGACCATGG + Intergenic
1155199106 18:23502316-23502338 CTCACAAGTAGCTGGGACCACGG - Intergenic
1156478630 18:37422230-37422252 CTCCCACTGAGATGGGAGCAGGG + Intronic
1157502937 18:48203634-48203656 TTCCCTCAGAAGTGGGACCATGG + Intronic
1158622921 18:59048202-59048224 CTCCCAAGGAGCTGGGACCACGG - Intergenic
1160481282 18:79241993-79242015 TGCACACACAGGTGGGCCCAAGG - Intronic
1160722954 19:605263-605285 CCCATACAGAGGGGGGACCCAGG + Intronic
1160971613 19:1770312-1770334 CTCCCAAGTAGGTGGGACCACGG - Intronic
1161083143 19:2321401-2321423 CTCACCCCCAGGAGGGACCATGG + Intronic
1161121360 19:2528657-2528679 CTCCCACAGAGGAGGGAACTCGG + Intronic
1161526788 19:4760910-4760932 CTAACTGAGAGCTGGGACCATGG - Intergenic
1161609137 19:5231350-5231372 CTCACACAGAGGTGGGACCAGGG - Exonic
1161698153 19:5781872-5781894 CCTACACAGAGCCGGGACCATGG + Intergenic
1163311272 19:16516320-16516342 CTCCCAGAGAGCTGGGACTACGG - Intronic
1163912191 19:20206037-20206059 CTCACTCATAGGTGGCCCCAGGG + Intergenic
1164305616 19:24002503-24002525 CTCCCACTGGGGTGGGAGCAGGG + Intergenic
1165700665 19:37934671-37934693 CTGACACAGGGGTGGAACCAGGG - Intronic
1165873344 19:38988764-38988786 CTCCCACGTAGCTGGGACCATGG - Intergenic
1165985210 19:39762713-39762735 CTAACACAGATGTGGAAACATGG + Intergenic
1167015576 19:46838850-46838872 CACGCACAGAGATGGGAACAAGG + Intronic
1167513629 19:49910159-49910181 CTCAGGCTGAGGTGGGTCCAAGG - Intronic
1167704577 19:51071963-51071985 TTCACACAGGAGTGGGACCAAGG - Intergenic
1167756640 19:51417031-51417053 CTCACACTGGGGAGGGACCCTGG - Intronic
1168312888 19:55470123-55470145 CACACACAGAGGGGCCACCATGG + Intergenic
1168526081 19:57089858-57089880 CACACACAGAGGGGAGACCTTGG + Intergenic
1202704751 1_KI270713v1_random:14401-14423 CTCACACTGGGGTGGGGGCATGG - Intergenic
925403025 2:3589247-3589269 CTCCCAGAGTGCTGGGACCACGG + Intergenic
925670359 2:6304138-6304160 CACACACAGAGGGAAGACCATGG - Intergenic
926695621 2:15768392-15768414 CTCTCACAGTGATGGAACCAGGG + Intergenic
927922544 2:26984507-26984529 CTCAGACAGCAGTGGCACCAGGG + Intronic
928200315 2:29243625-29243647 TTTACACAGAGGTGGGCCCTGGG - Intronic
930825457 2:55693029-55693051 CACGCACAGAGATGGGAACAAGG - Intronic
932117617 2:69067652-69067674 AGCACACAGAGGTGGCACCATGG - Intronic
935125765 2:100221492-100221514 CTCACAAGGAACTGGGACCATGG - Intergenic
937596466 2:123681119-123681141 CACACACAGAGATGGCAGCATGG + Intergenic
938008348 2:127807814-127807836 CTCACAAAGAGCTGGCAGCAGGG + Intronic
939555524 2:143668394-143668416 CTCACACAGAGCTTGCACCAGGG - Intronic
940267028 2:151849561-151849583 CTCACAAAGAGCTGGGTGCATGG - Intronic
941015135 2:160347141-160347163 TTAATGCAGAGGTGGGACCATGG + Intronic
941261279 2:163301154-163301176 CACACACAGAGGAAAGACCAGGG + Intergenic
942177627 2:173349691-173349713 CTCCCACATAGCTGGGACTATGG - Intergenic
942348494 2:175028375-175028397 CTTACACAGGGGCAGGACCACGG - Intergenic
944110936 2:196130634-196130656 CACACACAGTGCTGGGACCCAGG - Intergenic
944783739 2:203046663-203046685 CTCACACAGAGGAAGGGGCAGGG + Intronic
946806351 2:223474800-223474822 CTCAGACAGAGGTGGGTATAGGG + Intergenic
947617661 2:231568768-231568790 GACAGACAGAGGTGGGACCCTGG - Intergenic
947992395 2:234497435-234497457 CGCCCACAGAGCTGGGACCCCGG - Intergenic
948464444 2:238145539-238145561 GTGAGCCAGAGGTGGGACCAGGG - Intronic
948877302 2:240836593-240836615 ATCACTCAGAGGTAGGACCAGGG + Intergenic
1168926721 20:1587758-1587780 CACACACAGAGGGAAGACCATGG + Intronic
1168998912 20:2152544-2152566 CACACCCAGAGCTGTGACCAAGG - Intronic
1169985246 20:11436281-11436303 TGCACACAGTGGAGGGACCATGG + Intergenic
1170206751 20:13807002-13807024 CTCCCAAATAGCTGGGACCAAGG + Intronic
1171245635 20:23607808-23607830 CACACCCAGATGTGAGACCACGG + Intergenic
1172415107 20:34759140-34759162 CTCCCAAATAGCTGGGACCATGG + Intronic
1172552298 20:35810614-35810636 GTCACACAGTGGTAGGACTAGGG + Intronic
1173013926 20:39208218-39208240 CACAAACAGTGGTGGGGCCAAGG - Intergenic
1174456032 20:50649482-50649504 CACACTCAGAGGTGGGACAATGG + Intronic
1175715099 20:61250226-61250248 CTCACCCAGAGCTGGGACCCTGG - Intergenic
1175911671 20:62408008-62408030 GTGACACAGAGGTGGGTGCAAGG - Intergenic
1176049356 20:63108451-63108473 GACACACAGAGGAGGCACCATGG + Intergenic
1176080021 20:63267817-63267839 CTCACACAGAGGCAGCTCCAGGG - Intronic
1176231963 20:64037349-64037371 CTCACAGAGACGTGGGAACTGGG - Intronic
1176958102 21:15129279-15129301 CTCAGAGAGAGATGTGACCACGG - Intergenic
1177633032 21:23751250-23751272 CTCCCAAAGAGGTGGGATAACGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179132964 21:38655329-38655351 TGCACACAGAGGTGGGTCCAGGG + Intronic
1180045784 21:45304476-45304498 CTCACGGAGAGGTGTGGCCAGGG - Intergenic
1180645162 22:17332780-17332802 CTCTCACAGAGATTGGAGCATGG - Intergenic
1180711557 22:17842642-17842664 CGCTCACAGAGGTGGCACCCAGG + Intronic
1180866001 22:19120278-19120300 CTCACACTGAGGTCGGAGTAGGG - Intronic
1181833154 22:25579267-25579289 CTCCCACATAGCTGGGACTAAGG + Intronic
1181952226 22:26562878-26562900 CTCCCAAAGTGCTGGGACCAGGG + Intronic
1182547793 22:31085675-31085697 CTTACACAGCGGTGGGGCCTGGG + Intronic
1182726070 22:32446803-32446825 CTCACACAGAGGTTGAAGAATGG - Intronic
1183094423 22:35543558-35543580 TTCCCCCAGAGGTGGCACCATGG - Intronic
1184561749 22:45268036-45268058 CGCACACAGAGGAAGGACCTGGG + Intergenic
1184638968 22:45858856-45858878 CTCACACAGAGCTGTGACATGGG - Intergenic
1184721174 22:46314398-46314420 CTCAAACAGGTGTGGGAGCATGG - Intronic
1184822803 22:46923394-46923416 GCCACACAGAGGTGATACCATGG - Intronic
949505845 3:4726687-4726709 CAGACACAGATATGGGACCACGG - Intronic
950118898 3:10468690-10468712 CTCAGACGGTGCTGGGACCAGGG + Intronic
951093855 3:18605612-18605634 CACACACAGTGGTGTGACCTTGG - Intergenic
952405363 3:33000060-33000082 CTCCCACATAGCTGGGACTACGG + Intronic
953916448 3:46923772-46923794 GCCACACAGAGGTGGGAGCAAGG - Intronic
954294372 3:49665990-49666012 CTCCCACAGAGGCAGGGCCAAGG - Intronic
956364217 3:68482442-68482464 CTGACACAGAGGAAAGACCAGGG + Intronic
960297704 3:115963874-115963896 CTCCCAAATAGCTGGGACCACGG + Intronic
961092723 3:124128886-124128908 CTAACACAGAGGAGGGGACAGGG - Intronic
961377699 3:126477195-126477217 ATCAGACAGAGGTGGGAATACGG - Intergenic
961894785 3:130158120-130158142 CTCAAACGGAGGTGCCACCAGGG - Intergenic
962702204 3:138010516-138010538 CTCACCCAGAGGTGGGAGTGGGG - Intronic
963191845 3:142481611-142481633 CTCCCACATAGCTGGGACCATGG + Intronic
963551105 3:146724230-146724252 CTCACACAGAGCCGGGCACATGG + Intergenic
967094649 3:186167148-186167170 CTTACACAGATGTGGGACTGAGG + Intronic
967191994 3:186992439-186992461 CTCACACAGAAGTGTGAGAATGG + Intronic
968035354 3:195543535-195543557 CTCACAAGGTGGTGGGACGAGGG - Intergenic
968151623 3:196341405-196341427 CTCACACAGAGCTTGGAACATGG + Intergenic
968802189 4:2750547-2750569 CTCCCAAATAGCTGGGACCATGG + Intronic
968934191 4:3601456-3601478 TGCACACAGAGGAGGGTCCACGG - Intergenic
968956397 4:3721906-3721928 TTGACTCAGAGGTGGGACCCTGG - Intergenic
969304441 4:6317788-6317810 CGGACACAGATGTGAGACCAGGG - Intergenic
971276183 4:25199308-25199330 CTAACACAGAGGAAGGAGCATGG - Intronic
974117128 4:57592609-57592631 CACACAAAGAGCTGGGGCCATGG - Intergenic
974463879 4:62227950-62227972 CTCCCACTTAGGTGGGACTAAGG + Intergenic
979521063 4:121666981-121667003 CTCACAGAGAGCTGGGAAGAAGG + Intergenic
980308626 4:131099257-131099279 CTCACACAGAGCTGGCACAAGGG - Intergenic
981383624 4:144101396-144101418 CTCCCACATAGCTGGGACTACGG + Intergenic
981536201 4:145802487-145802509 CTGGCACAAAGGTGGGAGCAGGG + Intronic
981812487 4:148791440-148791462 GTCACAGAGAGCTGGGACCAGGG + Intergenic
983050055 4:163035490-163035512 CTCACACAGAAGTCTGAACAAGG + Intergenic
985533582 5:448420-448442 TTGACACAGAGCGGGGACCAAGG - Intronic
987873636 5:23651119-23651141 TTCACACATAGATGGGAGCATGG - Intergenic
989315859 5:40077938-40077960 CTCAAAAAGTGGTTGGACCAGGG - Intergenic
989987197 5:50714712-50714734 GTCACACAGAGAAGGAACCAGGG + Intronic
990348840 5:54895577-54895599 CTCACTCAGTTGTGGGACGAAGG - Intergenic
992187378 5:74257327-74257349 CTGACCCAGAGCTGGGACCCCGG - Intergenic
992790596 5:80209965-80209987 CTCCCAAATAGCTGGGACCACGG + Intronic
996411241 5:123161757-123161779 CTCACACAGAGTTAGAGCCAGGG - Intronic
997702433 5:135912145-135912167 CTGCCTCAGAGGTGGGAACAAGG - Intergenic
997718189 5:136057639-136057661 CTCACAGAAAGATGAGACCAAGG + Intronic
998418881 5:141965636-141965658 ATCACACAGTGGTGGAGCCAGGG - Intronic
998521621 5:142806213-142806235 CTCCCAAGGAGCTGGGACCACGG + Intronic
1001254449 5:170172628-170172650 TTCACACAGAGTAGGGACAAGGG + Intergenic
1002101561 5:176860487-176860509 CTGACCCAGACGTGGGACCCAGG - Intronic
1002535238 5:179872269-179872291 CTTCCACAGAGCTGGCACCAGGG - Intronic
1003471988 6:6445047-6445069 CTCCCAGAGAGGTGGCAGCATGG + Intergenic
1004325337 6:14669513-14669535 CTCACTCAGAGGTGGCTGCAGGG - Intergenic
1006440922 6:34053271-34053293 CCCACAGAGAGCTGGGAGCAGGG - Intronic
1007576104 6:42926036-42926058 CTCTCACAGAGGTTGGGCCAGGG - Intergenic
1007942399 6:45794272-45794294 CTAAAACAGAGGTGGGAAAAGGG + Intergenic
1008410626 6:51174498-51174520 CTCACACAGTGTTGGGAATAGGG - Intergenic
1010624199 6:78116207-78116229 CTCACACATAAGTGGAAGCAAGG - Intergenic
1012726521 6:102819094-102819116 CTTTCACAGAAGTGAGACCAGGG + Intergenic
1015756377 6:136610564-136610586 ATCACAGAGAGGTTGGGCCAAGG + Intronic
1019625268 7:2012714-2012736 CTCACCCATAGGTGGGGACACGG + Intronic
1019796788 7:3055679-3055701 CTAACACAGCGTTGAGACCAAGG - Intergenic
1019949758 7:4361893-4361915 CACACACAGTGATGGAACCATGG + Intergenic
1020419079 7:7980037-7980059 CTCCCAAATAGCTGGGACCATGG + Intronic
1021604361 7:22395288-22395310 CTCACATGGAGGAGGGCCCAGGG - Intergenic
1022803195 7:33795194-33795216 CACACACAGAGGGGAGTCCATGG - Intergenic
1023108350 7:36785343-36785365 CTCAGTGAGAGGTGGGGCCATGG + Intergenic
1024645799 7:51369344-51369366 TTCAGACAGAAGTGGTACCACGG - Intergenic
1025036657 7:55597461-55597483 TTCAGACAGAAGTGGTACCACGG - Intergenic
1025938803 7:66058770-66058792 CTCCCAAAGTGCTGGGACCACGG + Intergenic
1027234408 7:76289554-76289576 CCCACACAGAAGTGGGAGCAGGG - Intergenic
1029369191 7:100137095-100137117 CTCACAAATAGCTGGGACTAAGG + Intergenic
1029863778 7:103603479-103603501 CTCTCTCATAGGTGTGACCAGGG - Exonic
1031313324 7:120227181-120227203 CACACACAGAGGGAAGACCATGG - Intergenic
1032398781 7:131609443-131609465 CTCCCAAATAGCTGGGACCACGG + Intergenic
1034288541 7:149908121-149908143 CTGACACAGAGATGAGACCATGG + Intergenic
1034662532 7:152784746-152784768 CTGACACAGAGATGAGACCATGG - Intronic
1034939756 7:155222846-155222868 CTCACACAGAGATGGTATTAGGG + Intergenic
1035465635 7:159074471-159074493 CCCACACAGTGGAGGGACAAGGG - Intronic
1035467387 7:159088692-159088714 ATCACACAGCGGTGGCAGCACGG + Intronic
1036515152 8:9437029-9437051 GTCACACAGAAGTGGGAGAAGGG - Intergenic
1037618799 8:20544904-20544926 CTCTCAAATAGCTGGGACCACGG - Intergenic
1037956927 8:23067651-23067673 TCCACTCAGAGGTGAGACCAAGG + Intronic
1038272532 8:26087235-26087257 CACACACAGAGGGAGGACCATGG - Intergenic
1038422970 8:27445288-27445310 CTCCCACATAGCTGGGACTACGG - Intronic
1038441139 8:27571637-27571659 CTCCCACAGAGGTGCAACCCAGG + Intergenic
1041730341 8:61056096-61056118 CTTACAGGGAGGTGTGACCATGG - Intergenic
1042926213 8:73971276-73971298 CTCCCACGTAGCTGGGACCAAGG - Intronic
1047220395 8:122914037-122914059 CTCAGACAGAGATGAGACAATGG - Intronic
1047232433 8:123008934-123008956 CTCACATGGATGGGGGACCAGGG - Intergenic
1048203869 8:132400282-132400304 CTGACACAGAGCTGGGTTCATGG + Intronic
1048385928 8:133912547-133912569 CTGGCACAGAGGTTGGCCCATGG - Intergenic
1049263041 8:141649935-141649957 AGCACACAGGGGTGGGGCCAGGG - Intergenic
1049655592 8:143795571-143795593 CTGCCCCAGAGGTGGGACCCCGG - Intronic
1049819987 8:144627633-144627655 CTCCCAAAGTGCTGGGACCAAGG - Intergenic
1050302404 9:4273238-4273260 CTCACACAGATGTGTAATCAAGG + Intronic
1050484066 9:6115244-6115266 CTCACAGAGAGCTGGCACCTGGG + Intergenic
1051914399 9:22190954-22190976 CACACACTGAGGTGGGAGGAGGG + Intergenic
1053474809 9:38375125-38375147 CTCACAAAGAGATGGGAACTTGG + Intergenic
1054455960 9:65430523-65430545 TGCACACAGAGGAGGGTCCATGG + Intergenic
1056378493 9:86036436-86036458 CACACACAGAGGTGCCACAAGGG - Exonic
1056703847 9:88934790-88934812 CTCCAACAAAGGTGGGACCATGG + Intergenic
1056897404 9:90563854-90563876 GTTACACAGAGGTGGGAGCAGGG - Intergenic
1057178266 9:93014974-93014996 CTCACAAAGGGGTGGGACAAGGG - Intronic
1059637946 9:116188784-116188806 GTCACAGAGAGCTGAGACCATGG - Intronic
1060438872 9:123619540-123619562 CTCACAGAGAGCTGGGACTACGG + Intronic
1060641967 9:125246458-125246480 CTCCCAAAGTGGTGGGACTATGG - Intergenic
1060965672 9:127711158-127711180 CTCACAAAGGGGTGTGCCCAGGG + Intronic
1202791200 9_KI270719v1_random:91216-91238 CTCACACTGAGCTCGAACCAGGG - Intergenic
1186155078 X:6717024-6717046 CTCCCAAAGTGCTGGGACCATGG + Intergenic
1186410312 X:9340727-9340749 CACACACAGAGGGACGACCATGG + Intergenic
1187529842 X:20086275-20086297 ATCCCACACAGGTGGGTCCAGGG + Intronic
1191081872 X:56521126-56521148 ATCTCACAGAGGTGAGACAAAGG - Intergenic
1193842044 X:86418532-86418554 CCAACATAGAGCTGGGACCATGG - Intronic
1198154253 X:133942991-133943013 ATCAGACACAGGTGGGACTAAGG - Intronic
1200082321 X:153584007-153584029 CTCAAGCAGGGATGGGACCATGG - Intergenic
1201630481 Y:16066397-16066419 GTCACACAGAGTTGGTGCCATGG + Intergenic