ID: 1161610155

View in Genome Browser
Species Human (GRCh38)
Location 19:5237899-5237921
Sequence AGCGGCTCAGATGCCCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161610142_1161610155 -5 Left 1161610142 19:5237881-5237903 CCCCACCCCCCCGATCCCAGCGG No data
Right 1161610155 19:5237899-5237921 AGCGGCTCAGATGCCCCGGCTGG No data
1161610146_1161610155 -10 Left 1161610146 19:5237886-5237908 CCCCCCCGATCCCAGCGGCTCAG No data
Right 1161610155 19:5237899-5237921 AGCGGCTCAGATGCCCCGGCTGG No data
1161610145_1161610155 -7 Left 1161610145 19:5237883-5237905 CCACCCCCCCGATCCCAGCGGCT No data
Right 1161610155 19:5237899-5237921 AGCGGCTCAGATGCCCCGGCTGG No data
1161610141_1161610155 3 Left 1161610141 19:5237873-5237895 CCGAGGCGCCCCACCCCCCCGAT No data
Right 1161610155 19:5237899-5237921 AGCGGCTCAGATGCCCCGGCTGG No data
1161610139_1161610155 29 Left 1161610139 19:5237847-5237869 CCGGCGGGGGCAGGGGGGTTGTG No data
Right 1161610155 19:5237899-5237921 AGCGGCTCAGATGCCCCGGCTGG No data
1161610144_1161610155 -6 Left 1161610144 19:5237882-5237904 CCCACCCCCCCGATCCCAGCGGC No data
Right 1161610155 19:5237899-5237921 AGCGGCTCAGATGCCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161610155 Original CRISPR AGCGGCTCAGATGCCCCGGC TGG Intronic