ID: 1161610188

View in Genome Browser
Species Human (GRCh38)
Location 19:5238047-5238069
Sequence CTGGGTGAAGGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1944
Summary {0: 1, 1: 3, 2: 11, 3: 201, 4: 1728}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161610174_1161610188 28 Left 1161610174 19:5237996-5238018 CCATCATGACTGATTCTGGAAGA 0: 1
1: 0
2: 3
3: 12
4: 221
Right 1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG 0: 1
1: 3
2: 11
3: 201
4: 1728
1161610179_1161610188 2 Left 1161610179 19:5238022-5238044 CCTGGGGTGGCTACGCCGTGACT 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG 0: 1
1: 3
2: 11
3: 201
4: 1728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161610188 Original CRISPR CTGGGTGAAGGGAGGGAAGA GGG Intronic
900088284 1:908809-908831 AGGGGGGAAGGGAGGGATGAGGG + Intergenic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900535880 1:3177114-3177136 ATGGGTGAATGAATGGAAGATGG - Intronic
900580430 1:3405918-3405940 GTGGGTGATGGGAGGGACCAGGG + Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
901511418 1:9719849-9719871 CTGGGGGAGGGCAGGGAAGCTGG + Intronic
901758088 1:11453554-11453576 GTGGGTGATGGGAGGGGAGAGGG + Intergenic
902074808 1:13775856-13775878 GTGGGTGAAGGGATGGGGGAAGG - Intronic
902107056 1:14046707-14046729 CTGAGTGCAGGTAAGGAAGAGGG - Intergenic
902129139 1:14243533-14243555 CTGGGTGAAGGTAGGTGAGCAGG + Intergenic
902208995 1:14891305-14891327 CAGGGTAAAGGGTGGGAAGGGGG - Intronic
902479067 1:16702225-16702247 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
902536144 1:17120184-17120206 GTGGGTGGAGGGAGAGGAGAGGG + Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902648180 1:17818644-17818666 CTGAATGAAGTGAGGGAATAAGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902892551 1:19454942-19454964 CTTGGTAAAGGGAAGGAAGAGGG + Intronic
903273644 1:22207655-22207677 AGGAGTGGAGGGAGGGAAGACGG - Intergenic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903363213 1:22790140-22790162 ATGGGTGAAGGTAGGGAGGAAGG + Intronic
903750949 1:25620154-25620176 GTGGCTGGAGGGTGGGAAGAGGG + Intronic
904025956 1:27503979-27504001 CAGGGTGCAGGGATGGGAGATGG + Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904304083 1:29575797-29575819 CTGGAGGAGGGCAGGGAAGAGGG - Intergenic
904621073 1:31775672-31775694 TTGGGTGTTGAGAGGGAAGATGG - Intergenic
904773537 1:32893878-32893900 GCCGGTGAAGGGAGGGAGGAAGG - Exonic
904776586 1:32912164-32912186 CTGGATGAAGGGAGTGATGACGG - Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905197919 1:36295604-36295626 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905245540 1:36610653-36610675 CTGGGCAGAGGGAGGGAAAAAGG + Intergenic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905363895 1:37438431-37438453 ATGGGTAAAGGGAAGCAAGAGGG + Intergenic
905389585 1:37627812-37627834 AGGGGTGCAGGGAGGGATGAAGG - Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905510954 1:38519737-38519759 CAGGCTGAAGGGAGAGGAGAAGG + Intergenic
905525856 1:38639009-38639031 ATGGGAGAAGAGAGGTAAGAGGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905616571 1:39404919-39404941 CTGACAGAAGGGTGGGAAGAAGG - Intronic
905860981 1:41351249-41351271 ATGGGAGATGGGAGGGAACAGGG - Intergenic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
905930569 1:41784023-41784045 CAGGGAGTAGGTAGGGAAGAAGG + Intronic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
905969010 1:42126709-42126731 CAGGGTGAAGGGAGGAAACAGGG - Intergenic
906059172 1:42937117-42937139 GTGGGAGCAGGGAAGGAAGAGGG - Intronic
906132204 1:43467284-43467306 CTGGATCAAGTGATGGAAGAAGG - Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906316679 1:44791007-44791029 GGGGGTGGAGGGAGGCAAGAAGG - Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906449644 1:45934061-45934083 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
906569496 1:46824415-46824437 GTGGGTGGAGGGTGGGAGGAGGG + Intergenic
906659376 1:47571700-47571722 ATGGAGGGAGGGAGGGAAGAAGG - Intergenic
906739147 1:48164168-48164190 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
906753462 1:48287188-48287210 CTGGGTTAAGAGAGTGAAGGGGG + Intergenic
906915121 1:50000903-50000925 CAGGGGGAAGGGTGGGAGGAGGG + Intronic
907197315 1:52697522-52697544 CTGGGTGAAGGGTGTCAGGAGGG - Intronic
907406131 1:54254560-54254582 TTGGGTGAGGGGAGTGAAAAGGG - Intronic
907459538 1:54597226-54597248 ATGGGATAAGGGAGGGAAGCAGG - Intronic
907561432 1:55393067-55393089 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
907563574 1:55413429-55413451 CTGGCTGAGGGGAGAGAAAAAGG + Intergenic
907578611 1:55551485-55551507 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
907670568 1:56471371-56471393 AGGAGTGAAGGAAGGGAAGAAGG + Intergenic
907793812 1:57694343-57694365 CTGGGTGATGGGACAGAAAATGG + Intronic
907989799 1:59568668-59568690 CGTGGTGGAGGAAGGGAAGAGGG - Intronic
907999972 1:59670222-59670244 CTGGGTGAAGGAGAGGAAGAGGG - Intronic
908319782 1:62967874-62967896 CTAGGAGCAGGGAGGAAAGAGGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908362221 1:63380372-63380394 GTGGCTGAAGTGGGGGAAGAAGG + Intronic
908421305 1:63961083-63961105 AAGGATGAATGGAGGGAAGAAGG - Intronic
908426371 1:64011626-64011648 CTGGCTGAAGGGAAGGATAAAGG + Intronic
908513835 1:64872206-64872228 CTGGGTGGAGGCAGGGATGCTGG + Intronic
908517454 1:64907537-64907559 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
908782300 1:67701444-67701466 CTGAGTGAAGGAAGGGAAAGGGG + Exonic
908863002 1:68511242-68511264 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
909005060 1:70265923-70265945 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
909095523 1:71283027-71283049 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
909273833 1:73659034-73659056 AAGGGTGGAGGGTGGGAAGAGGG - Intergenic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909398538 1:75198241-75198263 CTGGGTGCAGGGATGGTAGTGGG + Intergenic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
909897641 1:81093294-81093316 TTGGGTGATGGGAGGAATGAAGG + Intergenic
910474828 1:87595635-87595657 AGGAGGGAAGGGAGGGAAGAGGG - Intergenic
911548589 1:99252089-99252111 GAGGGTGAAGGGTGGGAAGAGGG + Intergenic
911571531 1:99523351-99523373 CAGGGTGGAGGGTGGGAGGAAGG - Intergenic
911667853 1:100574381-100574403 GAGAGTGAAGGGTGGGAAGAGGG + Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
911871823 1:103108560-103108582 CTGGGAGCAGGGAGGGGAGTGGG - Intergenic
911881960 1:103251233-103251255 TTGGGTGGAGGGAGGGGGGAGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912742892 1:112217644-112217666 TGGGGTGAGGGGAGGGGAGAGGG + Intergenic
912887838 1:113494355-113494377 GAGGATGAAGGGTGGGAAGAGGG + Intronic
912977144 1:114341159-114341181 ATGGAGGAAGGGAGTGAAGATGG - Intergenic
913356143 1:117924274-117924296 GAGGGTGAAAGGTGGGAAGAGGG - Intronic
913428148 1:118757863-118757885 ATGGATGAAGGAAGGGAGGATGG + Intergenic
913471346 1:119190450-119190472 GTGGGGGAAGGGAGGGAGTAGGG - Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914454878 1:147826642-147826664 TTGGGGGAAGCGTGGGAAGAGGG - Intergenic
914833685 1:151189969-151189991 CTGGGAAAAGGGAGGGGAGGAGG - Intronic
914901784 1:151715044-151715066 ATGGGAGAAGAGAGGGATGATGG - Intronic
914976651 1:152370576-152370598 CGGGGTGGGGGGAGGGAGGAGGG + Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915268240 1:154733814-154733836 GGGGATGAAGGGAGGGAGGAAGG - Intronic
915389508 1:155528842-155528864 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
915558440 1:156673109-156673131 AAGGGTGAGGGGAGGGAAGTTGG + Exonic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
915901916 1:159853795-159853817 CTGGGTGAAGTGCAGGAAGGAGG - Intronic
916017853 1:160766064-160766086 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
916061238 1:161099812-161099834 ATGGCTGAAGGGGGGGAAGGTGG + Intronic
916079751 1:161225122-161225144 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
916082400 1:161242865-161242887 CTAGGTCAGGGGAGGGAAGTGGG - Intergenic
916214639 1:162384598-162384620 CAGGGAGAAGGGAGTGAGGATGG + Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917172792 1:172196049-172196071 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
917990155 1:180367525-180367547 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
918018273 1:180659446-180659468 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
918224622 1:182470368-182470390 ATGAGTGAGGGGAGGGAAGTAGG - Intronic
918312544 1:183295434-183295456 CTGCATGAAGGGAGGTAAAAAGG - Intronic
918866143 1:189903162-189903184 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
919123705 1:193371600-193371622 ATGGGTTAATGGATGGAAGAGGG + Intergenic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
919390016 1:196972075-196972097 GACGGTGAAGGGTGGGAAGAGGG - Intergenic
919489930 1:198194437-198194459 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
919592444 1:199521511-199521533 CTGGGAGAAGGGAGGTAGGTAGG - Intergenic
919748945 1:201024719-201024741 CTGGGTGAAGTGAGGGCAGCTGG - Intergenic
919841691 1:201614029-201614051 CTGGGTGGGGGTTGGGAAGATGG + Intergenic
919932764 1:202232163-202232185 CTGGTTAAAGTGAGTGAAGAGGG + Intronic
919933636 1:202237222-202237244 CTGGATGGAGGGAGAGGAGAGGG - Intronic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920441646 1:205984880-205984902 CTGGGAGGAGGCAGGGAGGAGGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
920687964 1:208124217-208124239 GAGGGTGGAGGGAGGGAAGGGGG + Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920816371 1:209336933-209336955 GTGGGTGGAGGGAGGGAAGGGGG + Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920843690 1:209576039-209576061 CTGGGTGAAGGGAGCAAATGGGG - Intergenic
920935025 1:210424585-210424607 CGGGGTGGAGGGTGGGAGGAGGG - Intronic
921501733 1:215912798-215912820 GAGGGTGAAGGGTGGGAAGATGG - Intronic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
921800246 1:219394773-219394795 AAGGGTGGAGGGTGGGAAGAGGG - Intergenic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923452866 1:234136175-234136197 AGGAGGGAAGGGAGGGAAGAAGG - Intronic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923681384 1:236121522-236121544 TTGGGTTAGGGGAGGAAAGAAGG - Intergenic
923747833 1:236719090-236719112 ATGGTGAAAGGGAGGGAAGAAGG - Intronic
923802939 1:237228120-237228142 GTGGGGAAAGGGTGGGAAGAGGG - Intronic
924612189 1:245582921-245582943 CGGGGTGCAGGGAGAGAGGAAGG - Intronic
924819737 1:247477332-247477354 GAGGGTGAAGGGTAGGAAGAGGG + Intergenic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1062832285 10:613930-613952 CTGGAGGAAGGCAGGGCAGATGG - Intronic
1062929552 10:1343871-1343893 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1063092409 10:2878952-2878974 GTGGGTGAAGGCAGGTGAGAAGG - Intergenic
1063121448 10:3107705-3107727 CTGGGTTATGGGAGGGCACAGGG - Intronic
1063343373 10:5289608-5289630 GTGGGTGGAGGGTGGGAGGAGGG + Intergenic
1063561807 10:7135191-7135213 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1063655192 10:7981258-7981280 GTGGGTGAATAGATGGAAGAGGG - Intronic
1063694773 10:8323493-8323515 TTGGGTGAAAGGAAGGAAGTAGG + Intergenic
1063762336 10:9094090-9094112 GCGGGTGGAGGGAGGGAAGAGGG + Intergenic
1063886693 10:10587129-10587151 TTTGGTGAAGGGAGAGAAAAAGG + Intergenic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064121424 10:12623080-12623102 ATGGAGGAAGGGAGGGAGGAAGG - Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1064986178 10:21212442-21212464 CAGAGTGATGGGAGGAAAGAAGG + Intergenic
1065543081 10:26789771-26789793 GAGGGTGAAAGGTGGGAAGAGGG - Intronic
1065827688 10:29586891-29586913 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1066252402 10:33647208-33647230 GAGGGTGAAGGGTGGGAGGACGG + Intergenic
1066584896 10:36922000-36922022 CAGGGAGAAAGAAGGGAAGATGG - Intergenic
1066707977 10:38202003-38202025 CAGAGTGAAGGCAGTGAAGAGGG + Intergenic
1066950243 10:42110747-42110769 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
1067158906 10:43806171-43806193 CTGGAGGAAGGGAGGGCAGCAGG - Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1067661182 10:48237357-48237379 CTTGGTGGAGGGCGTGAAGAGGG - Intronic
1067713862 10:48671943-48671965 CTGGGAGCAGCGCGGGAAGAGGG - Intergenic
1067786586 10:49254737-49254759 CTGGGTGGGAGGAAGGAAGAGGG + Intergenic
1067921676 10:50464815-50464837 AGGGGAGGAGGGAGGGAAGAAGG + Intronic
1068356508 10:55916734-55916756 CTGGGTCAGGGGAGAGAAGGAGG + Intergenic
1068555642 10:58455799-58455821 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1068573683 10:58659558-58659580 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1068735621 10:60410465-60410487 AAGGATGGAGGGAGGGAAGAAGG + Intronic
1068858175 10:61818840-61818862 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1068873934 10:61977000-61977022 TGGGGTGAGGGGAGGGGAGAGGG - Intronic
1069060975 10:63894190-63894212 ATGGGAGAAGGGAAGGAGGAAGG - Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069541311 10:69296181-69296203 TTGGGGAATGGGAGGGAAGAGGG - Intronic
1069751571 10:70748518-70748540 CAGGGTGAGGGTGGGGAAGAGGG - Intronic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069964381 10:72101985-72102007 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1069984691 10:72275085-72275107 CTGGCTGAAGCCAGGGAGGAAGG - Exonic
1070560551 10:77563573-77563595 CAGGATGGAGGGAGGGTAGAAGG - Intronic
1070607005 10:77905800-77905822 GTGGGTGAGGGGAGGGAAATGGG - Intronic
1071095791 10:81973063-81973085 AGGGGTGAAGGGTGGGAGGAGGG - Intronic
1071974381 10:90940215-90940237 CTGGGTCAGGGTAGGGAAGAGGG - Intergenic
1072211839 10:93253259-93253281 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1072378950 10:94847218-94847240 TGGGGTGGAGGGAGGGAGGAGGG - Intronic
1072712220 10:97723247-97723269 CTGAGTCAAGGCTGGGAAGAGGG + Intergenic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1072967676 10:99988393-99988415 CTGGGTACAGGAAAGGAAGAAGG + Intronic
1073054013 10:100687459-100687481 CTGGGTGAGGACAGGGAAGGAGG + Intergenic
1073243054 10:102070707-102070729 CTGGGTGAAGGCGAGGAAGCAGG + Intergenic
1073285519 10:102385267-102385289 CAGGAAGAAGGAAGGGAAGAGGG - Intergenic
1073337856 10:102723970-102723992 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1073500765 10:103934801-103934823 AAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1073640395 10:105246819-105246841 ATGGGTGAAGGGATTAAAGAAGG + Intronic
1073777082 10:106798429-106798451 GTGGGTGGGGGGAGGGAGGAAGG - Intronic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1073977948 10:109121678-109121700 ATGGAGGAAGGGAGGGAGGAAGG - Intergenic
1074311641 10:112327771-112327793 CTGGGTGATGGGAGATAAAAAGG + Intergenic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074580540 10:114714909-114714931 ATGGGACAAGGGAGAGAAGAAGG - Intergenic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074739840 10:116475283-116475305 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1074868017 10:117556082-117556104 CTGGGAGAAAGCAGGGAAGCGGG - Intergenic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1074914747 10:117944565-117944587 CTGGGTGCAGGGGTGGATGAGGG + Intergenic
1075148053 10:119900026-119900048 TGAGGGGAAGGGAGGGAAGAGGG - Intronic
1075217371 10:120548220-120548242 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1075428440 10:122361046-122361068 CTGGGAAGAGGGAGGGAAAATGG + Intergenic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1075552501 10:123402426-123402448 GAGGGAGGAGGGAGGGAAGAGGG + Intergenic
1075595289 10:123724895-123724917 CTGGGTGCTGGGAGAGAAGGTGG + Intronic
1075624332 10:123950882-123950904 TGGGGGGAAGGAAGGGAAGAAGG + Intergenic
1075664440 10:124220700-124220722 CTGGGTGCAGGGCTGGCAGAGGG - Intergenic
1075814324 10:125253243-125253265 TTGGATGAAGGGAGGGAGGAAGG - Intergenic
1075840549 10:125498717-125498739 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1075962426 10:126580880-126580902 ATGGGTAGAGGGAGGGAGGATGG - Intronic
1076046903 10:127301455-127301477 TTTGGTGGAGGGAGGAAAGAAGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076108988 10:127846650-127846672 CTGGGAGAAGGGAGGTGGGATGG - Intergenic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077048715 11:557187-557209 CTGGGTACTGGGAGGCAAGAGGG - Intronic
1077101332 11:823864-823886 CTGGGGGACGGGAGGGGAGGAGG + Intronic
1077135423 11:995746-995768 CTAGGTGGAGGGAGGGGAGAGGG - Intronic
1077166002 11:1139213-1139235 CGGGGTGTAGGCAGGGGAGATGG + Intergenic
1077268590 11:1664676-1664698 AGGGATGGAGGGAGGGAAGAAGG + Intergenic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077315036 11:1915782-1915804 GTGGATGAAGGGAGGGAGGGAGG + Intergenic
1077533146 11:3106663-3106685 GTGAGTGACGGGAGGGAGGATGG - Intronic
1077610192 11:3639217-3639239 CTGGGTCTTGGGTGGGAAGAGGG - Intronic
1077644600 11:3912206-3912228 AGGGGAGAAGGGAGGGGAGAAGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1077793786 11:5469457-5469479 CTGGGTGAATTGAGGTGAGATGG + Intronic
1077800181 11:5529080-5529102 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1078078346 11:8182158-8182180 GTGGGTGAAGGGTGGGAGGAGGG - Intergenic
1078159012 11:8824342-8824364 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1078288062 11:9978162-9978184 TTGGGGGAAGGGAGGCAGGATGG - Intronic
1078316541 11:10298020-10298042 ATGGGAGCAGGAAGGGAAGAAGG + Intergenic
1078449234 11:11428057-11428079 CTGGGCTAACGGAAGGAAGAGGG - Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078754513 11:14196307-14196329 CTTGTGGATGGGAGGGAAGATGG + Intronic
1079140077 11:17802745-17802767 CTGATTGAAGGGAGGGAGGGAGG - Intronic
1079680278 11:23287765-23287787 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1079828411 11:25229787-25229809 TGGGGTGGAGGGAGGGAAGAGGG - Intergenic
1080034715 11:27699877-27699899 CTGCGTGATGGGAGCAAAGACGG - Intronic
1080500788 11:32869130-32869152 GAGGGTGGAGGGTGGGAAGAAGG + Intergenic
1080779111 11:35414524-35414546 CGGGGTGAGGGGCGGGCAGAGGG + Intronic
1081006072 11:37741955-37741977 CTGGGGGAGGGGAGGGAACCTGG + Intergenic
1081194089 11:40140038-40140060 CAGGGACAAGGGAGAGAAGAAGG + Intronic
1081282868 11:41231615-41231637 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
1081521586 11:43886953-43886975 GTGGGTGGAGGGTGGGAGGAGGG + Intronic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081718606 11:45269062-45269084 GTAGGAGAAGGAAGGGAAGAAGG + Intronic
1082565813 11:54676804-54676826 GTGGGGGAAGGGAGGGGAAAGGG - Intergenic
1082651574 11:55800332-55800354 CAGGGTGAAGGTTGGGAAGAGGG + Intergenic
1083052284 11:59788014-59788036 CTGGCTGAAGCGTGGGAAGCAGG - Intronic
1083221839 11:61257879-61257901 AAGGGTGGAGGGAGGGTAGAGGG + Intergenic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083455761 11:62777766-62777788 CTGGGTCAAGGGAAAGAACATGG - Intronic
1083623719 11:64061304-64061326 CAGCGTGAAGGAAGGGCAGACGG - Intronic
1083657681 11:64237529-64237551 CTGGGTGCAGCGTGGGCAGAGGG - Exonic
1083707490 11:64526308-64526330 GTGGATGAAGGGTGGGAGGAGGG - Intergenic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084555922 11:69875794-69875816 CGGGGTGAATGGAGGGGTGAGGG - Intergenic
1084578879 11:70009919-70009941 TTGGGGGAAGGGTGGGAGGAGGG - Intergenic
1084781886 11:71415141-71415163 ATGGGTGAATGGATGGATGATGG + Intergenic
1084785708 11:71440573-71440595 ATGGGTGATGGGAGGGTAGATGG + Intronic
1084859157 11:72006914-72006936 CAGGGTGAAGGGAGAGAACGTGG - Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1084955887 11:72691377-72691399 TGGGCAGAAGGGAGGGAAGATGG - Intronic
1085245850 11:75099665-75099687 GTGGGGGAAGGGAGGGAGGGAGG + Intergenic
1085245883 11:75099738-75099760 GTGGGGGAAGGGAGGGAGGGAGG + Intergenic
1085334311 11:75679256-75679278 CTGGGAGATGGGAGGCCAGAAGG + Intergenic
1085543046 11:77289848-77289870 GAGGGAGAAGGGAGGGAGGAGGG + Intronic
1085586016 11:77706815-77706837 GTGGGTGGAGGGTGGGAGGAGGG - Intronic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1085920994 11:80957109-80957131 ATGGGAGAAGGGTGGGATGATGG - Intergenic
1086017741 11:82187443-82187465 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1086288973 11:85283085-85283107 GAGGGTGGAGGGTGGGAAGAGGG + Intronic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086584888 11:88439287-88439309 ATGGGGGAAGAGAGGGATGAAGG + Intergenic
1086585407 11:88445674-88445696 GAGAGTGAAGGGTGGGAAGAGGG - Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1087091990 11:94283177-94283199 CTGGGTTAGGGGAGGGAATGTGG - Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1087237366 11:95734860-95734882 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087916245 11:103814952-103814974 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1088178349 11:107080448-107080470 GAGGGTAAAGGGTGGGAAGAGGG - Intergenic
1088270765 11:108032019-108032041 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1088523192 11:110722085-110722107 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1088571887 11:111230613-111230635 CCTGGTGAAAGGAGGCAAGAGGG + Intergenic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1089067286 11:115671391-115671413 ATGGGAGAAGGGCGGGAAGGAGG - Intergenic
1089330059 11:117682808-117682830 CTGGCTGGAGGGAGGAAGGAAGG + Intronic
1089356440 11:117857029-117857051 CTGGCTGGAGCCAGGGAAGAGGG + Intronic
1089420435 11:118329107-118329129 CAGGGTGGAGGGTGGGAGGAGGG + Intergenic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090089430 11:123681772-123681794 CAGGAAGGAGGGAGGGAAGAAGG + Intergenic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090219447 11:125005335-125005357 CTGGGTGAAGTATTGGAAGATGG + Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090595614 11:128318191-128318213 CAGGGAGAAGGGTGGGAAGGGGG - Intergenic
1090618978 11:128544482-128544504 CTGGGAGAAGGCAGGGGTGAGGG - Intronic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1090727688 11:129542497-129542519 GTGGGTGGAGGGTGGGAGGAGGG - Intergenic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1091216806 11:133907232-133907254 CTGGGTGAAAGGAAGGACCAGGG + Intergenic
1091222250 11:133936414-133936436 CTGGGAGAAGGCAGGCAGGAAGG - Intronic
1091290207 11:134435264-134435286 CTGGGTGATGGGAGAGAGCAGGG + Intergenic
1091410547 12:236502-236524 CTGGAGGGAGGAAGGGAAGAGGG - Intronic
1091551208 12:1536206-1536228 ATTGATGAAGGGAAGGAAGAGGG + Intronic
1091686965 12:2569462-2569484 TTGGTTGCTGGGAGGGAAGATGG - Intronic
1091700186 12:2653978-2654000 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1091701668 12:2667359-2667381 CTGGGGGAAGGGAGACCAGAGGG + Intronic
1091786524 12:3246360-3246382 CTGGGAAAAGGTGGGGAAGAGGG - Intronic
1091934794 12:4426573-4426595 CCGGGTGAAAGCAGGGAGGAGGG + Intergenic
1092483107 12:8878498-8878520 AAGGGAGAAGGGAGGAAAGAGGG + Intronic
1092910369 12:13140417-13140439 CTGGGTGTAGGATGGGATGAGGG - Intronic
1092968645 12:13670289-13670311 GTAGGTGGAGGCAGGGAAGAGGG + Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093167175 12:15817503-15817525 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1093253703 12:16839695-16839717 CTGGGTGGAGGGTGGGAGGAGGG + Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094167692 12:27459469-27459491 CAGGGTGCAGGATGGGAAGAAGG + Intergenic
1094255530 12:28421351-28421373 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
1094478149 12:30858295-30858317 GAGGGTGAAGGGCGGAAAGAGGG - Intergenic
1094526115 12:31232388-31232410 CTCGGAGGAGGGAGGCAAGAGGG - Intergenic
1095087689 12:38075462-38075484 TGGGGTGCAGGGAGGGAGGAGGG + Intergenic
1095088635 12:38084681-38084703 CTTGTGGAAGGCAGGGAAGAGGG - Intergenic
1095618661 12:44223191-44223213 CAGGGTGGAGGGTAGGAAGAGGG - Intronic
1095846366 12:46749677-46749699 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1095943711 12:47741629-47741651 GTGGGGGAAGGGAGGGAGGCCGG + Intronic
1096014902 12:48261898-48261920 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096014909 12:48261916-48261938 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096014916 12:48261934-48261956 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096014923 12:48261952-48261974 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096098985 12:48957432-48957454 CTAGGTGGAGGGAAGGAAGGAGG - Exonic
1096101248 12:48971628-48971650 CGGGAGGAAGGGAGGGAGGAAGG + Exonic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096155499 12:49339331-49339353 GTGAGTGGAGGGAGGGAAAAGGG - Intergenic
1096413707 12:51394687-51394709 GAGGGTGGAGGGTGGGAAGAGGG + Intronic
1096573588 12:52539157-52539179 CTGGGACAAGGGAGGGTAGAGGG - Intergenic
1096806268 12:54143034-54143056 GTGGGTGCAAGGAAGGAAGAAGG + Intergenic
1096864574 12:54554662-54554684 GTGGCTGGAGGGAGGGAAGCAGG + Intronic
1096894251 12:54804453-54804475 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1097167434 12:57093304-57093326 CTGGCTGGAGGGGGGGCAGAAGG + Intronic
1097261092 12:57720691-57720713 CTGGGGGAAGGCAGGGAATGAGG - Intronic
1097338140 12:58407650-58407672 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1097430580 12:59500176-59500198 CTGGGTGAAGAGAGAATAGAGGG - Intergenic
1097834240 12:64257423-64257445 CTGGAAGAAGGAAGGGATGAGGG + Intergenic
1097991099 12:65834639-65834661 CTTGTTGAAGGAAGGGAAGGAGG - Intronic
1098117903 12:67199945-67199967 CTTAGTTAAGGGTGGGAAGAGGG - Intergenic
1100447707 12:94676554-94676576 ATAGTTGAAGGGAGGGCAGAGGG + Intergenic
1100648388 12:96556902-96556924 GAGGGTGAAGGGTGGGATGAGGG + Intronic
1100778897 12:98002844-98002866 ATGGAAGGAGGGAGGGAAGAGGG + Intergenic
1100921335 12:99491530-99491552 GTGGGTGGAGGGTGGGAAGAGGG - Intronic
1101259573 12:103014419-103014441 GAGGGAGAAGGGAGGGAGGAAGG - Intergenic
1101637844 12:106560986-106561008 CTGGCTGATGGGAGGTAAGCAGG + Intronic
1102407992 12:112690723-112690745 TGGGGTTAAGGAAGGGAAGAGGG + Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102825125 12:115942585-115942607 CTGCCAGAAGGGAGGGGAGAGGG + Intergenic
1103006596 12:117425661-117425683 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1103030246 12:117606764-117606786 AGGGATGAAGGGAGGGAAGGAGG - Intronic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103356874 12:120328098-120328120 CTGGGATAAGGGAGACAAGAAGG + Intergenic
1103597788 12:122034784-122034806 CCGGGAGAAAGGAGGGAGGATGG - Intronic
1103859958 12:124004238-124004260 CTGGGTGGAGGGAGGGCATAAGG + Intronic
1103889385 12:124227378-124227400 CTGGGGGAAGGGAAGGAATGAGG + Intronic
1103900151 12:124299501-124299523 CAGGGGAAAGGGTGGGAAGAGGG - Intronic
1104160688 12:126177336-126177358 CAGGGAAAAGGGTGGGAAGAGGG + Intergenic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104544411 12:129698552-129698574 AGGGGAGAAGGGAGGGGAGAAGG + Intronic
1104544417 12:129698564-129698586 AGGGGAGAAGGGAGGGGAGAGGG + Intronic
1104598981 12:130139636-130139658 CTGGGTTAAGTGAGGCAGGAGGG - Intergenic
1104612430 12:130240700-130240722 CCGGGTGAAGGGAGGGAAGAGGG + Intergenic
1104668902 12:130667145-130667167 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
1104896313 12:132166671-132166693 ATGGGTGAATGGATGGATGATGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105234893 13:18541187-18541209 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1105614470 13:21999785-21999807 CTGGGTGCAGGAAGGCAAGAGGG + Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105896022 13:24718090-24718112 GGGGGTGGAGGGAGGGAGGAAGG + Intergenic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1106232359 13:27830398-27830420 CTGGGGTAAGGGTGGGAAGGGGG + Intergenic
1106300509 13:28460093-28460115 CTGGGTGATGGTTGGGCAGATGG - Intronic
1107223597 13:38018669-38018691 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
1107359338 13:39602671-39602693 CTGGACGAAGGGAGGGGATAAGG + Intronic
1107410721 13:40156035-40156057 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1107481503 13:40789536-40789558 CTGCGCGAAGGGAGGGGCGAAGG + Exonic
1107614145 13:42147102-42147124 GTGGCCGAAGGGAGGGGAGAAGG + Intronic
1107879166 13:44817917-44817939 CTGAGTGAAGTGAGTGGAGAGGG + Intergenic
1108147526 13:47495274-47495296 AAGGATGAAGGGAGGGAAGAAGG + Intergenic
1108554867 13:51583051-51583073 CTGGGTGTAGGAAGGAAGGAAGG + Intergenic
1108641051 13:52382609-52382631 ATGAATGAAGGCAGGGAAGATGG - Intronic
1108967077 13:56321868-56321890 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1109033030 13:57218164-57218186 ATGGGTGAAGGCAGTTAAGAAGG - Intergenic
1109237411 13:59842121-59842143 CTGGGTTTAGGCAGGGAATATGG - Intronic
1109317562 13:60768353-60768375 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109400922 13:61827853-61827875 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1109516914 13:63455709-63455731 CAGGGTGAAGGGAAGCAATAAGG + Intergenic
1109864632 13:68246711-68246733 GTGGGTGGAGGGTGGGAAGAGGG - Intergenic
1110254983 13:73423368-73423390 CTGGCTGTAGGGAAGGAATAAGG + Intergenic
1110260877 13:73483852-73483874 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1110523324 13:76506240-76506262 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1111007091 13:82262381-82262403 CAGGATGAAGGGAACGAAGATGG - Intergenic
1111077397 13:83255245-83255267 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1111084272 13:83353002-83353024 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1111786921 13:92799745-92799767 GTGTGTGAAGGGAGAGAAAAAGG - Intronic
1112065577 13:95789299-95789321 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1112412919 13:99179340-99179362 CTGGGCAAACGGAGGGAAGCAGG - Intergenic
1112608969 13:100937328-100937350 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1113002094 13:105652244-105652266 CTGGGGGAAGGGGGGGAATGAGG + Intergenic
1113186122 13:107687301-107687323 CTGGATGGAGGGAGGGAAGGAGG + Intronic
1113807729 13:113119352-113119374 TTGGCTGAAGGGAGGTAAGGAGG - Exonic
1113847014 13:113397994-113398016 CGGGGGGAAGGGAGGGAGAAGGG + Intergenic
1114237488 14:20835349-20835371 CGGGGTGTAGGAAGGGAAGTGGG + Intergenic
1114258470 14:21021594-21021616 ATGGGTGGAGGGAAGGAAAAGGG - Intronic
1114950476 14:27744940-27744962 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1115188737 14:30723545-30723567 CCTGGTGGAGGGTGGGAAGAGGG - Intronic
1115294039 14:31805752-31805774 GAGGGTGAAGGGTGGGAGGAAGG + Intronic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1115724174 14:36194708-36194730 GAGGGGGAAGGGAGGGGAGAGGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115858605 14:37658916-37658938 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116141847 14:41006037-41006059 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1116348393 14:43827192-43827214 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
1116378877 14:44239748-44239770 CAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1116582729 14:46662669-46662691 CAGAGAGAAGGCAGGGAAGAAGG + Intergenic
1116720838 14:48493556-48493578 TAGGGTGAAGGGTGGGAGGAAGG + Intergenic
1116743659 14:48790524-48790546 AAGGATGAAAGGAGGGAAGAAGG + Intergenic
1117343670 14:54812624-54812646 CAGGATGAAGGAAGGGAAGGAGG - Intergenic
1117667299 14:58070017-58070039 CTGGCTGAAGGCAAGGAGGATGG + Intronic
1117785107 14:59275284-59275306 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1118098014 14:62561158-62561180 TTGGGTGGAGGGAGGGGGGAGGG + Intergenic
1118187619 14:63551521-63551543 GGGGGAGGAGGGAGGGAAGAGGG - Intergenic
1118766087 14:68910082-68910104 CTCGGTGGAGGGAGGGATGCCGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119192872 14:72695696-72695718 AAGGGGGAAGGGAAGGAAGAGGG + Intronic
1119535826 14:75401718-75401740 GTGTGTCAAGGGAAGGAAGAGGG + Intergenic
1119680005 14:76585103-76585125 CTGGGAGAAGGGAAAGAAGGAGG + Intergenic
1119714261 14:76847537-76847559 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1119726108 14:76922689-76922711 CTGGGGGAAGGGAGATGAGAGGG - Intergenic
1119850186 14:77861358-77861380 GTGGGTGGAGGGAGGGGAGCGGG + Intronic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120521994 14:85534483-85534505 GAAGGTGAAGGGAGGGAAGGAGG - Intronic
1120566476 14:86064951-86064973 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1120635394 14:86944116-86944138 CTGGTGGAAGGAAGGGAAAAAGG - Intergenic
1120768619 14:88354926-88354948 ATGGGTGAAGGAAGGGTAGATGG - Intergenic
1120928113 14:89818466-89818488 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
1121011587 14:90523134-90523156 CTGGGAGCAGGGAGGGATGGAGG - Intergenic
1121392654 14:93589431-93589453 CTGGGGGATGGGGGGGAAGTTGG + Intronic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121604862 14:95233316-95233338 ATGGGTGGATGGAGGGATGATGG - Intronic
1121732117 14:96194271-96194293 CTGCATGCAGGGAGGGCAGAAGG + Intergenic
1121764921 14:96478186-96478208 GCGGGGGAAGGGAGGGAGGAAGG + Intronic
1121800323 14:96769123-96769145 AAGGGAGAGGGGAGGGAAGAAGG - Intergenic
1121895102 14:97639662-97639684 GTGAGGGAAGGGAGGCAAGAAGG - Intergenic
1122108586 14:99480236-99480258 CGGGGTGACGGGAGGAAGGAAGG + Intronic
1122127279 14:99586195-99586217 CTGGGTGTAGGGAGGGGCGGGGG - Intronic
1122287513 14:100660368-100660390 CTGGTTGAAGGGAGGCATGGGGG - Intergenic
1122886781 14:104713773-104713795 GTGAGTGGAGGGAGGGATGAGGG - Intronic
1122968856 14:105144315-105144337 CTGGGTGATGGAAGGGCAGTAGG - Intronic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123819965 15:24018847-24018869 TGGGGTGAAGGGAGGGGGGAGGG + Intergenic
1124626850 15:31312568-31312590 GTGGGTGGAGGGAGAGCAGAAGG + Intergenic
1124850643 15:33335528-33335550 GAGGGTGGAGGGTGGGAAGAAGG + Intronic
1125281231 15:38044351-38044373 GTAGGGGAGGGGAGGGAAGAAGG + Intergenic
1125340559 15:38671543-38671565 CTGGTTCAACGGAGGGAAGATGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125834987 15:42741215-42741237 CTGGGTGAGGACAGGGAAGTAGG + Exonic
1126066184 15:44827927-44827949 ATGGATGGAGGGAGGGAAGGAGG - Intergenic
1126093648 15:45072636-45072658 ATGGATGGAGGGAGGGAAGGAGG + Intronic
1126810469 15:52398000-52398022 CTGGGTGAAAGGAGGAGAAAAGG + Intronic
1127332617 15:57953869-57953891 ATGGAAGAAGGGATGGAAGAAGG + Exonic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1127982921 15:64047173-64047195 GGGGGTGAAGGGAGGAAGGAAGG + Intronic
1128498506 15:68211394-68211416 CTGGGAGAAGGGTGGTCAGAGGG - Intronic
1128527699 15:68423702-68423724 CTGGATGAATGGGGGCAAGAGGG + Intronic
1128528180 15:68426457-68426479 CTGGGTGGGGAGAGGGGAGAGGG + Intronic
1128637288 15:69311204-69311226 CAAGTAGAAGGGAGGGAAGACGG + Intronic
1128793522 15:70449539-70449561 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
1128793748 15:70450360-70450382 ATGGGTGGATGGAGGGATGAAGG + Intergenic
1129182431 15:73885656-73885678 TGGGGTGGAGGGAGGGATGAGGG - Intronic
1129245938 15:74278677-74278699 CTGGGTGAAGAGAGGGATAAAGG - Intronic
1129506044 15:76082388-76082410 GTGGTAGAAGGGAGGGAAGAAGG + Intronic
1129608316 15:77035485-77035507 CTGGGAACAGGGAGGAAAGAGGG - Intronic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129759374 15:78120662-78120684 CTGGGTGGGGGCAGGGCAGAGGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130138528 15:81202467-81202489 GTGGGTGTAGGGAGGGGGGAGGG - Intronic
1130179494 15:81610649-81610671 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1130770282 15:86917150-86917172 CTGGGAGAAGATAGAGAAGATGG + Intronic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131184415 15:90262853-90262875 CTGGGTCAGGGAAGGGATGAGGG + Intronic
1131185473 15:90270397-90270419 CTGGCAGAAGGGAGGAGAGAAGG - Intronic
1131422574 15:92319618-92319640 CTGGGAAAAGGGAGGGGACAGGG - Intergenic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1131841554 15:96442653-96442675 CTGGGTGTTAGGCGGGAAGAAGG - Intergenic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132484830 16:185402-185424 TTGGGAGGAGGGAGGGAGGAGGG + Intergenic
1132907381 16:2289665-2289687 GTGGGTGGAGGGAGGGACTATGG + Intronic
1133335693 16:5005387-5005409 CTGGGTTGGGGGAGGGGAGATGG + Intronic
1133637385 16:7681220-7681242 ATGGGTGAAGGATGGGTAGATGG + Intronic
1133663052 16:7937510-7937532 GGGGAGGAAGGGAGGGAAGAAGG - Intergenic
1133695759 16:8261036-8261058 GAGGGTGGAGGGTGGGAAGAAGG - Intergenic
1133725169 16:8530619-8530641 ATGGATGAAGGGAGGTAAGGGGG + Intergenic
1133765011 16:8831919-8831941 CCTGGAGAAGGGAGGGAAGGGGG - Intronic
1133826205 16:9280443-9280465 CTGGATGGTGGGTGGGAAGAGGG + Intergenic
1134027208 16:10963588-10963610 CTGGGTGGAGGGACTGAAGCAGG - Intronic
1134232649 16:12440585-12440607 GTGGGTGGAGGGTGGGAGGAGGG - Intronic
1134294854 16:12936455-12936477 ATGGGAGAAGGGATGGAGGAGGG + Intronic
1134488442 16:14677779-14677801 GTGGGTGGATGGATGGAAGATGG + Intronic
1134779392 16:16882014-16882036 TTCGGTGAGGGGAGGGAGGAGGG - Intergenic
1134855834 16:17518296-17518318 TTGGGGAAAGGGTGGGAAGAGGG - Intergenic
1135169248 16:20168730-20168752 CTGGGAGAAGGGAGGGTGAAGGG - Intergenic
1135221790 16:20620831-20620853 CTGGGGGAAGGAAGGGGATAGGG + Intronic
1135483948 16:22847125-22847147 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
1135501016 16:22995795-22995817 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1135510529 16:23079050-23079072 ATGGCTGAAGGGAGAGAAAATGG + Intronic
1135547812 16:23377575-23377597 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1135887271 16:26321686-26321708 CAGCCAGAAGGGAGGGAAGAAGG - Intergenic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1135943175 16:26840566-26840588 AAGGGGGAAGGGAGAGAAGATGG + Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136037856 16:27554056-27554078 ATGGAAGAAGGGAGGGAGGAAGG + Intronic
1136285578 16:29238501-29238523 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1136501018 16:30669675-30669697 CTGGTTAAAGGAAGGGGAGATGG - Exonic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1136504685 16:30695413-30695435 GTGGGAGAGAGGAGGGAAGATGG - Intergenic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1137443879 16:48520193-48520215 CTGAGTGCTGGGAGGCAAGAAGG - Intergenic
1137498418 16:48990395-48990417 GAAGGGGAAGGGAGGGAAGAAGG + Intergenic
1137513776 16:49124823-49124845 CTAGGTGAATTGAGGGAAGAGGG - Intergenic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1137846836 16:51698102-51698124 CCAAGTGAAGGGAGGGAGGAGGG + Intergenic
1137975638 16:53029335-53029357 AGGGCTGAAGGGAGGAAAGATGG + Intergenic
1137977084 16:53041122-53041144 CTGGATGAAAGGAAGGAAGGAGG + Intergenic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138514699 16:57529512-57529534 CTGGGTGAAGGGATTGGAGCAGG - Intronic
1138544438 16:57707297-57707319 TTGGGTGATGGGAGGGGAGATGG + Intronic
1138755173 16:59475707-59475729 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1138767319 16:59619916-59619938 CTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1138774411 16:59704291-59704313 GTGGGTGAAGGGCAAGAAGAGGG - Intergenic
1138948576 16:61882721-61882743 GAGGGTGAAGGGTGGGAAGAAGG + Intronic
1139136324 16:64208660-64208682 CAGGGAGAAGGGAGGCAAAAAGG + Intergenic
1139320416 16:66109719-66109741 AAGGGGGAAGGAAGGGAAGAGGG + Intergenic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139599056 16:67975777-67975799 CTGGGTGAAGGTTGGGATGGTGG + Exonic
1139729288 16:68928873-68928895 CACGATGAAGGGAGAGAAGAGGG - Intronic
1139755716 16:69141979-69142001 CGGGGTGAGGGGAGGGGGGAGGG - Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140200248 16:72889053-72889075 ATGGGTGGAGGGAGGGAGGGAGG + Intronic
1140213900 16:72992331-72992353 ATGGGGGAAGGCAGGGAAGCTGG - Intronic
1140352869 16:74279515-74279537 TTGGGGGAAGGGATGGAAGTGGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140557453 16:75938082-75938104 CTAGAGGAAGGGAGGGAAGAGGG - Intergenic
1140656474 16:77145479-77145501 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
1140700177 16:77574482-77574504 GTGGGTGGAGGCAGGGAGGATGG - Intergenic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1141025229 16:80540807-80540829 GTGGGTCCCGGGAGGGAAGAGGG - Intronic
1141358336 16:83370609-83370631 AAGGGTGGAGGGTGGGAAGAGGG - Intronic
1141421548 16:83921062-83921084 GTGGGTGGAAGGAAGGAAGATGG + Exonic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141486289 16:84342389-84342411 CTAGGTCAGGAGAGGGAAGAGGG + Intergenic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141517850 16:84558393-84558415 CTGGGAGGAGGGTGGGAGGAGGG - Intergenic
1141881713 16:86864575-86864597 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142090911 16:88208653-88208675 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1142215151 16:88826314-88826336 CTGGGTACAGGCAGGGAACAGGG + Intronic
1142215165 16:88826363-88826385 CTGGGTACAGGCAGGGAACAGGG + Intronic
1142562346 17:817898-817920 CTGGGTGAAGGCTGGGAAGGAGG + Intronic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142697098 17:1639775-1639797 CTGGGTGAAGTGGGGGAGGCAGG + Intronic
1142889852 17:2936248-2936270 CTGGGTGGGGGGAGGGGGGAGGG - Intronic
1142987525 17:3705413-3705435 CTGGGCAAAGGTAGGGAAGCTGG - Intergenic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143301459 17:5913692-5913714 ATGGGTGGATGGATGGAAGATGG - Intronic
1143334715 17:6163526-6163548 CTTGGTGAAGGGACAGGAGATGG + Intergenic
1143371123 17:6440122-6440144 GTGGCTGGAGGGAGGGAAGGAGG - Intergenic
1143475897 17:7203817-7203839 CTGGGTGAAGGAGGGGAAGAGGG + Intronic
1143485760 17:7252643-7252665 CTGGCTGAGGGGACGGAAGTGGG + Intronic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143520493 17:7441595-7441617 CTGGCTGCAGGGTGGGAAGGGGG + Intronic
1143565285 17:7717194-7717216 GCGGGGAAAGGGAGGGAAGACGG - Intergenic
1143668037 17:8375877-8375899 GTGGGTGAAGGGAGTAAACATGG - Intronic
1143769148 17:9156957-9156979 GTGGGTGGAGGGAGGGAGGGAGG - Intronic
1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG + Intergenic
1144232346 17:13220700-13220722 CAGGGTGAAGGCAAGGTAGATGG + Intergenic
1144275960 17:13668187-13668209 CTGGGAGCAGGGAGTGAAGCTGG - Intergenic
1144355413 17:14441296-14441318 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1144737041 17:17561034-17561056 CTGGAGGAAGGGAGGAGAGAGGG - Intronic
1144790262 17:17854293-17854315 CAGGCTGATGGGAGGGAAGTGGG + Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145415327 17:22709926-22709948 CAGGATGAGGGGATGGAAGATGG + Intergenic
1145726116 17:27126421-27126443 ATGGGTGAAGGAAGGAGAGAAGG + Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146200136 17:30850297-30850319 GTGGGAGAGGGGAGGGGAGAGGG - Intronic
1146422210 17:32698277-32698299 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1146532177 17:33617498-33617520 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1146820894 17:35982977-35982999 AGGGATGAAGGGAGGGAGGAAGG - Intergenic
1146820903 17:35983001-35983023 ATGGATGGAGGGAGGGAAGCAGG - Intergenic
1146834682 17:36100800-36100822 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1146849290 17:36207985-36208007 AAGGGTGAAGGGTGGGAGGAGGG - Intronic
1146872658 17:36386055-36386077 CTAGGAGAACGGGGGGAAGATGG - Intronic
1146910523 17:36645601-36645623 CTGGGTTAAGGGAGGATAAAGGG + Intergenic
1146923536 17:36729239-36729261 CTGGAGGAAGGGAGGGAGGGAGG - Intergenic
1146963088 17:37001390-37001412 ATGGGAGGAGGGAGGGAGGAAGG + Intronic
1146964266 17:37011423-37011445 CTGGGTGGAGGCAGCGGAGATGG + Intronic
1147196521 17:38770252-38770274 GTGGGTGAAGGCAGGGAACATGG + Intronic
1147304466 17:39553728-39553750 CTGGCTGGAGGAAGGAAAGAGGG + Intronic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147458514 17:40553693-40553715 CTGGGAGAGGGCAGGGAGGAGGG + Intergenic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147807117 17:43139682-43139704 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1147877669 17:43632847-43632869 CAGGATGAAGGGAGGGTGGACGG + Intergenic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148002182 17:44395912-44395934 CTGGGTGAAAGGCAAGAAGAGGG + Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148214698 17:45828083-45828105 GTGAGTGAAGGAAGGAAAGACGG - Intronic
1148496791 17:48057749-48057771 CTGCCTGAAGGAAAGGAAGAAGG - Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148552150 17:48556865-48556887 CTGGCAGAAGAGATGGAAGATGG + Intronic
1148585971 17:48780645-48780667 CTGGGCGGAGGGAGAGAAGGGGG - Intronic
1148808106 17:50274340-50274362 CTGGGAGGAGGAAGGGAGGAAGG - Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1149338500 17:55662627-55662649 ATGGGTGAAGGGAAGGAAGGAGG - Intergenic
1149422864 17:56527926-56527948 CTGGGGGGAGGGAGGGATGGAGG + Intergenic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1149847586 17:60016655-60016677 CTAGGAGAACGGGGGGAAGATGG - Intergenic
1149938677 17:60838412-60838434 GTGGGTGTGGGGAGTGAAGAGGG + Intronic
1150004699 17:61462541-61462563 GAGGGTGCAGGGAGGGGAGAGGG + Intronic
1150085944 17:62273272-62273294 CTAGGAGAACGGGGGGAAGATGG - Intronic
1150175330 17:63048798-63048820 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1150593720 17:66585258-66585280 CTGGTTGACAGAAGGGAAGATGG + Intronic
1150628578 17:66859668-66859690 TGGGGTGAAGGGAGGAAGGAGGG - Intronic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1150831672 17:68526766-68526788 GAGGGTGGAGGGTGGGAAGAGGG + Intronic
1151050972 17:70978465-70978487 GAGGGTGGAAGGAGGGAAGAAGG + Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151478118 17:74355114-74355136 CTGGGTGATGGGAGAGGAGTTGG + Intronic
1151833272 17:76568304-76568326 CTGGCAGGAGGGAGGGAAGGGGG + Intronic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152473753 17:80504248-80504270 ATGGGTGGATGGAGGGATGATGG + Intergenic
1152494388 17:80660829-80660851 CTGAGAGAAGGGTGGGGAGATGG - Intronic
1152788015 17:82261890-82261912 ATGGTTTGAGGGAGGGAAGAGGG - Intronic
1152909991 17:82997882-82997904 GTGGGTGGTGGGAGGGAAGTAGG + Intronic
1152923847 17:83079002-83079024 CCGGGAGGAGGGAGGGAAGCCGG + Intergenic
1153078421 18:1192598-1192620 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1153190578 18:2533389-2533411 TTGGCTCTAGGGAGGGAAGAAGG + Intergenic
1153329152 18:3855280-3855302 GAGGGTGGAGGGAGGGAGGAAGG + Intronic
1153836750 18:8970484-8970506 GAGGGGGAAGGGAGGGAGGAAGG + Intergenic
1153859326 18:9184957-9184979 CTGAGTGATGGGAGGAAAAAAGG + Intronic
1154170823 18:12048700-12048722 CTGGCTACAGGAAGGGAAGAAGG - Intergenic
1154477088 18:14771608-14771630 CAGGGTGAAGGGAAGCAACAGGG + Intronic
1155032783 18:21998760-21998782 CTGGGTGTAGGGATGGCAGGGGG + Intergenic
1155053721 18:22168548-22168570 CTGTTTGGAGGGAGCGAAGAGGG + Intergenic
1155156701 18:23163551-23163573 CTGAGAGAAAGGATGGAAGAGGG + Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155494944 18:26433576-26433598 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1155513892 18:26604737-26604759 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1155758336 18:29530762-29530784 ATGGGGAAAGGGAGGTAAGAAGG + Intergenic
1155847555 18:30728655-30728677 GAGGGTGAAGGGTGGAAAGAGGG - Intergenic
1156278088 18:35604069-35604091 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1156708968 18:39918702-39918724 CTGGCTTAAAGGAGGGAAAAAGG + Intergenic
1156733950 18:40229962-40229984 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1156771700 18:40735565-40735587 TGGGGTGAAGGGAGGGAAGAGGG - Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157002936 18:43549142-43549164 CTGGAAGAAGGGAGGAGAGAAGG + Intergenic
1157062691 18:44311412-44311434 TGGGGTGAAGGGAGGGGGGAGGG - Intergenic
1157099431 18:44716012-44716034 CCAGGAGAAGGGAGGGAAGGTGG - Intronic
1157137483 18:45070984-45071006 AGGAATGAAGGGAGGGAAGAAGG - Intergenic
1157144212 18:45144755-45144777 CTGGGAGAAGGTAGGGAATGGGG - Intergenic
1157166965 18:45366575-45366597 CTGGGTGATAGGAGAGGAGAAGG - Intronic
1157177584 18:45465557-45465579 ATGGATGAAGGGAGGGAGGGAGG - Intronic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1157497039 18:48163434-48163456 ATGGGTGATGGGATTGAAGATGG - Intronic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1157807915 18:50672147-50672169 CAGGGTGCAGGGAGTGGAGAAGG + Intronic
1157852166 18:51065311-51065333 AAGGGTAAAGGGAGGGGAGATGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158212226 18:55064672-55064694 CTGGGTGGTGGGAGGAAGGAAGG + Intergenic
1158368878 18:56773901-56773923 GTGGGTGAGGGGAGAGAAGAAGG - Intronic
1158391051 18:57045162-57045184 ATGGGTGGAGGGAAGGCAGATGG + Intergenic
1158528177 18:58234263-58234285 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1159231519 18:65613319-65613341 CAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1159487448 18:69082495-69082517 AGGGGGGAAGGAAGGGAAGAAGG + Intergenic
1159629658 18:70735000-70735022 CTGGGTGAAGGGAAGAAATAAGG + Intergenic
1159652235 18:70990572-70990594 GTGGGTGGGGGGAGGGGAGAGGG + Intergenic
1159995426 18:74960190-74960212 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995435 18:74960226-74960248 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995472 18:74960406-74960428 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995509 18:74960586-74960608 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995516 18:74960622-74960644 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995524 18:74960658-74960680 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995532 18:74960694-74960716 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995541 18:74960730-74960752 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995570 18:74960874-74960896 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995578 18:74960910-74960932 CTGGGTGAAGGGATAGGAGAAGG + Intronic
1159995595 18:74960982-74961004 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995604 18:74961018-74961040 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995613 18:74961054-74961076 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1159995622 18:74961090-74961112 CTGGGTGGAGGGATAGGAGAAGG + Intronic
1160297316 18:77650364-77650386 ATGGGTGGAGGGTGGGAGGAAGG - Intergenic
1160687110 19:442247-442269 GTGGGTGAACGGATGGATGATGG + Intronic
1160703121 19:517766-517788 CTGGGTGGAGGCGGGGATGAGGG + Intronic
1160894147 19:1394973-1394995 CTGGGCGGAGGGAGGGGAGGTGG - Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1160970653 19:1766419-1766441 CTGGATGAAGGGGAGGATGAAGG + Intronic
1161326344 19:3665995-3666017 CTGGGAGAATGCAGGGAACATGG - Intronic
1161398876 19:4058977-4058999 CTGGGAGCAGGGAGGGTAGGAGG + Intronic
1161447973 19:4328624-4328646 GTGGGAGGAGGGTGGGAAGAGGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161657498 19:5525098-5525120 ATGGGTGAATGGATGGATGATGG - Intergenic
1161678333 19:5665984-5666006 CAGGGTGAAGGGAGAGATGGCGG - Intronic
1161934564 19:7363728-7363750 ATGGGTGAAAGGAAGGAAGATGG + Intronic
1162095200 19:8306122-8306144 CAGGGTGTAGGGAGGAGAGAGGG - Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1162291774 19:9785833-9785855 CTGGGTGAAGGGCGAGATGGGGG - Intronic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1162292831 19:9792313-9792335 CTCAGTGAGGGGAGAGAAGAGGG - Intronic
1162292893 19:9792523-9792545 CTCGGTGAGGGGAGAGAAGAGGG - Intronic
1162292922 19:9792607-9792629 CTCGGTGAGGGAAGAGAAGAGGG - Intronic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162562789 19:11427102-11427124 GTGGGAGAAGGAAGGGAGGAAGG - Intronic
1162591833 19:11597260-11597282 CTGGGTGCAGGGAGGAAACTCGG + Intronic
1162741129 19:12774572-12774594 CTGGGTGATGGGCAGGAAGAGGG - Intronic
1162865321 19:13541630-13541652 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
1162906180 19:13825527-13825549 CTGGGTGAAGGGCGGGACAGAGG - Intronic
1163203747 19:15787406-15787428 CAGGAGGAAGGGAGGAAAGATGG + Intergenic
1163214794 19:15868476-15868498 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
1163383657 19:16985742-16985764 ATGGGTGGAGGGAGGGAGGAAGG + Intronic
1163838023 19:19587925-19587947 CTGGGTGAAGGGAGAGGAGGGGG + Intronic
1164472201 19:28545705-28545727 AGGGGAGAAGGGAGGGAGGAGGG - Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1164908032 19:31983611-31983633 CTATGTGATGGGAGGGAAAAAGG + Intergenic
1165101586 19:33441580-33441602 CTGAGTGAAGGGAAGGAACAGGG - Intronic
1165361290 19:35338451-35338473 CTGGTTCTAGGGAGAGAAGATGG + Intronic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165466592 19:35978527-35978549 CGTGGTGAAGTGAGGGAGGAGGG - Intergenic
1165489287 19:36114105-36114127 CTGGGCGAAGGGAGGAGGGAAGG - Intronic
1165731730 19:38150223-38150245 CTGGTTGAGGGCAGGGAGGATGG + Intronic
1165926311 19:39328229-39328251 CTGGGTCCCGGGAGGGAAGGAGG - Intergenic
1165936355 19:39391190-39391212 CTGGGTGAAGGGCGGAGCGAGGG + Exonic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1166730988 19:45058970-45058992 ATGGGTGCAGGGATGGATGAAGG - Intronic
1166747777 19:45149899-45149921 ATGGGGGAAGGGAGTGGAGAAGG + Exonic
1166772807 19:45294471-45294493 CAGGGTGAGGGGTGGGAAGTAGG + Intronic
1166790296 19:45395385-45395407 CTGGGTGAAGGGAGGACAAATGG - Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166886780 19:45966283-45966305 TTGGAGGAAGGGAAGGAAGAAGG - Intronic
1166965696 19:46528376-46528398 CTGGGTGATGGGGTGGAAGGTGG - Intronic
1167166522 19:47803131-47803153 CCTGGAGAATGGAGGGAAGAGGG + Intronic
1167175320 19:47860633-47860655 CCTGGAGAAGGGAGGGAAGAGGG - Intergenic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167311591 19:48740434-48740456 CTGGGTCCTGGGATGGAAGATGG + Intronic
1167334445 19:48875822-48875844 CTGGGTGAGGGCAGGGATGGGGG - Exonic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167429459 19:49446253-49446275 GTGGGTGTTGGGAGGGAAGAGGG - Intergenic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167749360 19:51370641-51370663 CAGGGTGAAGGGCAAGAAGAAGG - Intergenic
1167767959 19:51496834-51496856 CTGGGAGAAAGCAGGGGAGAAGG + Intronic
1167792152 19:51689415-51689437 CGGGGAGAAGGGAAGGAGGATGG + Intergenic
1167842552 19:52133866-52133888 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
1168164475 19:54537324-54537346 CAGGGTGTAGGGTGGTAAGACGG + Intronic
1168241133 19:55089415-55089437 TGGGGTGATGGGAGTGAAGATGG - Intergenic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168479890 19:56710988-56711010 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1168666605 19:58209539-58209561 GTGGGAGGAGAGAGGGAAGAAGG + Intronic
1168692632 19:58386188-58386210 CTGGGGGAAGGGACAGAAGTTGG + Intergenic
1202713108 1_KI270714v1_random:28132-28154 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
925093671 2:1176299-1176321 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
925171107 2:1750741-1750763 TGGGGAGAAGGGAGGGAAGGAGG - Intergenic
925253673 2:2464149-2464171 CTGGATGAAGGGTAGGAAGATGG + Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
925597581 2:5571151-5571173 CTGAGTGAACGGAGGGAAAGAGG - Intergenic
926667852 2:15544352-15544374 AATGGTGAAGGGAGGGAGGAAGG + Intronic
926728196 2:16014713-16014735 CTGGCTGCAGTGAGAGAAGATGG - Intergenic
926842774 2:17101010-17101032 ATGGGAGAAGGGAGGGACGCAGG + Intergenic
926927383 2:18001501-18001523 CTGGGTGATGGGAGTAAATAGGG + Intronic
926980448 2:18561761-18561783 ATGGGTGGAGGGTGGGAAGTGGG - Intronic
927612671 2:24557540-24557562 AAGGGGGAAGGGAGGGGAGAAGG - Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
927877811 2:26670501-26670523 GTGGGAGAAGGGAAGGAAGGAGG + Intergenic
927906378 2:26861405-26861427 CTGCCTGAAGGAAGGGATGAAGG - Intronic
927999153 2:27507771-27507793 CTGGATGGTGAGAGGGAAGATGG + Exonic
928199764 2:29240097-29240119 CAGGGAGGAGGGAGGGAAGAAGG + Intronic
928384213 2:30850851-30850873 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
928406949 2:31022181-31022203 GGGGAGGAAGGGAGGGAAGAAGG + Intronic
928774836 2:34748358-34748380 GAGGGTGAAGGGTGGGATGAGGG + Intergenic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929779570 2:44949191-44949213 CTAGGGGCAGGGACGGAAGAGGG - Intergenic
929918480 2:46155475-46155497 CTGAGTGCAGGGTGGGAAGTGGG - Intronic
930544863 2:52753810-52753832 CTGGGTGCAGGGACAGAGGATGG + Intergenic
930572725 2:53107422-53107444 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
930873633 2:56190825-56190847 CTGGGGTAGGGGAGGAAAGAAGG - Intronic
930919038 2:56728809-56728831 ATGGGTGAGGGGAGAGAAGGAGG - Intergenic
931174072 2:59835313-59835335 AAGGGGGAAGGGAAGGAAGAAGG - Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931493076 2:62771010-62771032 AAGGGTGAAGGGTGGGAGGAGGG + Intronic
931502173 2:62881240-62881262 GTGGGTGGAGGGTGGGAGGAGGG + Intronic
931546585 2:63394886-63394908 GAGGGTGAAGGGTGGGAGGATGG + Intronic
931683478 2:64771814-64771836 CTGGAAGAAGGGAAGGATGATGG - Intergenic
931755975 2:65374928-65374950 CTGGGAGAGGGGAGAGAAGCGGG + Intronic
931771934 2:65504914-65504936 CTGGTTGCAGTGAGGGAAAATGG - Intergenic
931928021 2:67096369-67096391 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
931963301 2:67505327-67505349 TGGGGTGAAGGGAGGGGGGAGGG - Intergenic
932056270 2:68447368-68447390 CTGGTTGAAGGGAAGCCAGACGG - Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932601905 2:73133423-73133445 GATGGTGGAGGGAGGGAAGAAGG + Intronic
932680291 2:73818609-73818631 ATGGGTGGGGGAAGGGAAGATGG + Intergenic
932793203 2:74673566-74673588 CTGGCTGAACGGTGGGGAGAGGG + Exonic
932924311 2:75954283-75954305 GTGGAGGAAGGGAGGAAAGAAGG - Intergenic
933099994 2:78243063-78243085 CTGGGTGGAGGCTGGGAAGAAGG - Intergenic
933127894 2:78634169-78634191 CGGGAGGAAGGGAGGGAAGAAGG + Intergenic
933257738 2:80099814-80099836 CGGGGTGGAGAGATGGAAGATGG + Intronic
933654003 2:84872533-84872555 CTAGAGGGAGGGAGGGAAGAAGG + Intronic
933708473 2:85308478-85308500 GGGGGGGAAGGGAGGGAAGGAGG - Intronic
934064616 2:88329484-88329506 ATGGGTACAGGGAGGGAAGCAGG - Intergenic
934076303 2:88431511-88431533 CTGGGAGAAGAGTGGGAAGGAGG - Intergenic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
934331824 2:92075314-92075336 ATGAGAGAAGGGAGGGAGGAAGG + Intergenic
934675105 2:96244232-96244254 CAGGGTAAAGGGTGGGAAGGGGG + Intergenic
934692661 2:96373578-96373600 CTAGGAGAGGGGAGGGCAGAGGG + Exonic
935063286 2:99626527-99626549 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
935225269 2:101047249-101047271 CTGGGAGCAGGGAGGGTAGGGGG - Intronic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936228292 2:110678171-110678193 CTGGCTCAAGGGAGGGAGGTGGG - Intergenic
936275049 2:111088631-111088653 TAGGGTGCAGGGTGGGAAGAGGG + Intronic
936276681 2:111103972-111103994 GAGGGTAAAGGAAGGGAAGAGGG - Intronic
936652328 2:114442262-114442284 CTGGGTTAGGGGTGGGGAGAGGG + Intergenic
936690678 2:114884704-114884726 TTGGGGGAAGGGTGGGAGGAGGG - Intronic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936783937 2:116069427-116069449 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
937041243 2:118822319-118822341 CTGGGTGAGGTGCGTGAAGAGGG - Intergenic
937094437 2:119226221-119226243 CTGGGGCAAGGGAAGGAAGCAGG + Intronic
937239392 2:120450592-120450614 CAGGTGGGAGGGAGGGAAGATGG - Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
937768811 2:125694923-125694945 CTGGCTGCAGGGAGAGAAGAAGG + Intergenic
938229703 2:129647740-129647762 GTGGGAGAAGGCAGGGAAGCAGG + Intergenic
938285882 2:130116494-130116516 CAGGGTGAAGGGTGGGAGGAGGG - Intronic
938298239 2:130191937-130191959 GTGGGCGAAGGCATGGAAGAGGG - Exonic
938336522 2:130505058-130505080 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
938353297 2:130615604-130615626 GAGGGTGGAGGGTGGGAAGAGGG + Intronic
938429723 2:131222408-131222430 CAGGGTGAAGGGTGGGAGGAGGG + Intronic
938458528 2:131482720-131482742 GTGGGCGAAGGCATGGAAGAGGG + Exonic
938474543 2:131595594-131595616 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
938516120 2:132009493-132009515 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
938677065 2:133647546-133647568 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
939010134 2:136836894-136836916 CTGGGTAAAGATGGGGAAGATGG - Intronic
939103556 2:137924118-137924140 CTAAGTGAAGGCAGGGGAGAGGG + Intergenic
939292903 2:140218575-140218597 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
939299691 2:140319621-140319643 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
939754247 2:146090056-146090078 CAGGGTGAAGGAAGGGAGAAGGG - Intergenic
939875044 2:147568279-147568301 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
939875946 2:147577920-147577942 CTTGGTGGAGGGATGGAAGTAGG - Intergenic
939973573 2:148689597-148689619 GTGGGGGAAGGGAGGAAGGAGGG + Intronic
940589118 2:155697842-155697864 GAGGGTGAATGGTGGGAAGAGGG - Intergenic
940685484 2:156844937-156844959 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
940686164 2:156853678-156853700 GAGGGTGAAGGGTAGGAAGAGGG + Intergenic
940862064 2:158781061-158781083 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
941496743 2:166214455-166214477 CTGGAGGAAGCCAGGGAAGAAGG - Intronic
941497131 2:166219569-166219591 GAGGGTGAAGGGTGGGAGGAAGG + Intronic
941612329 2:167677067-167677089 CTGGGTGAGGGGTAGGAAAAAGG + Intergenic
941677118 2:168355720-168355742 CTGGGTGCAGGGTGAGAAGATGG - Intergenic
941810723 2:169753812-169753834 ATACGTGAAGGGAGGGAGGATGG - Intronic
941827903 2:169920316-169920338 TGGGGTGGAGGGAGGGGAGAGGG + Intronic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942033335 2:171986190-171986212 GTGTGAGAAGGGAGGGAAAAAGG + Intronic
942035063 2:172002744-172002766 ATGGGTGAAAGGGAGGAAGAGGG - Intronic
942043864 2:172087832-172087854 ATGGGGGAAGGGAGGAAGGAGGG + Intronic
942080419 2:172394897-172394919 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
942326055 2:174778076-174778098 CTTGGGGATGGCAGGGAAGAAGG - Intergenic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
942621776 2:177851891-177851913 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
942632358 2:177964530-177964552 GAGGGTGAAGGGTTGGAAGAGGG - Intronic
942846765 2:180436044-180436066 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
942917585 2:181330206-181330228 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
942949076 2:181702489-181702511 GTGGGAGAAGTGAGGGGAGAGGG - Intergenic
943255040 2:185583782-185583804 GTGGGGGAAGAGTGGGAAGAGGG + Intergenic
943384741 2:187187154-187187176 TGGGGTGGAGGGAGGGAGGAGGG + Intergenic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943555040 2:189392653-189392675 CAGGGAGGAGGTAGGGAAGATGG + Intergenic
943656303 2:190512635-190512657 ATGGTTAAAGGGAAGGAAGAAGG + Intronic
943725270 2:191245851-191245873 GGGGGTGGCGGGAGGGAAGAAGG + Intronic
943884404 2:193196610-193196632 AAGGGTGGAGGGTGGGAAGAGGG + Intergenic
943972821 2:194432581-194432603 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944269533 2:197765836-197765858 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
944293069 2:198030149-198030171 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
944486829 2:200215686-200215708 AGTGGGGAAGGGAGGGAAGAGGG - Intergenic
944931984 2:204529275-204529297 CAGGGTGAAGGGAGCCAACAAGG - Intergenic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945177411 2:207056576-207056598 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
945197555 2:207251448-207251470 GAGGGAGAAGGGTGGGAAGATGG - Intergenic
945541897 2:211098269-211098291 GTGGGTGGAGGGAGGGAGGGAGG - Intergenic
945604417 2:211910574-211910596 CAGGGTGGAGGGTGGGAAGATGG + Intronic
945623756 2:212173749-212173771 CTGGATGAAAGGAGGTCAGAGGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946187210 2:217987874-217987896 GTGGGTGAATGGATGGATGAGGG + Intronic
946205343 2:218102746-218102768 TGGGGTGGGGGGAGGGAAGAGGG - Intergenic
946218843 2:218208777-218208799 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
946404912 2:219487103-219487125 GTGGGTGAAGGGTGGGGATAGGG - Intronic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
946680547 2:222210540-222210562 CTAGGAGCAGGGAGGGGAGAGGG - Intronic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
947077898 2:226364345-226364367 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
947179421 2:227399014-227399036 GAGGGAGGAGGGAGGGAAGAAGG + Intergenic
947258796 2:228197361-228197383 CTGGGTGGAGGGAGAAAAAAAGG + Intergenic
947352894 2:229264820-229264842 GTGGGTGAAGGGTGAGAAGAAGG - Intronic
947796472 2:232896772-232896794 GTGGGTGAAGGTAGGGGTGAGGG + Intronic
947812842 2:233015155-233015177 ATGGGTGAAGGGATGGATGGTGG - Intronic
947909151 2:233790371-233790393 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
947957746 2:234208739-234208761 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
948077839 2:235180189-235180211 GTGGGTGGAGGGTGGGAGGAGGG - Intergenic
948109165 2:235440575-235440597 CTGGGAGGAGGGATGGAGGAAGG - Intergenic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948456777 2:238108185-238108207 CTGCGCGAAGGGAGGGAGGATGG - Intronic
948536115 2:238648787-238648809 CTGGGTGCAGGAATGGGAGATGG - Intergenic
1168844450 20:934377-934399 CAGGGTCCAGGGAGAGAAGAGGG - Intergenic
1168954072 20:1821992-1822014 CTGGCTCAAGGGAGGGAAATGGG - Intergenic
1169047891 20:2550399-2550421 TTCGGTGAGGGGAGGAAAGAAGG - Intronic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169214502 20:3785518-3785540 CACGGTGCCGGGAGGGAAGAAGG + Exonic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169481630 20:5987611-5987633 CTGGGTGAAGGGCGAGTAGGTGG - Intronic
1169826111 20:9770544-9770566 CTGGGTGAGTGTAGGCAAGATGG + Intronic
1169831344 20:9828864-9828886 ATGGGGGAAGGAAAGGAAGAAGG - Intronic
1170109985 20:12794762-12794784 GTGGGTGAAGGGTAGGAAGTAGG - Intergenic
1170168625 20:13386583-13386605 CTGGATGGAAGGAGGGAAGAAGG - Intergenic
1170195500 20:13685046-13685068 ATGGGGGAAGGGTGAGAAGATGG - Intergenic
1170850045 20:19996491-19996513 CTGTGTGAAGGGATGGATGGAGG + Intronic
1170993069 20:21323022-21323044 GTGGGTGAAGGGAGAGGAGAGGG + Intronic
1171134680 20:22685641-22685663 CTGGAAGAAGGACGGGAAGAGGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172482132 20:35277493-35277515 CTGGGTGTAGGCTGGGAAGCAGG + Intergenic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172656645 20:36542031-36542053 CAGGGTGTAGGGATGGGAGATGG - Intronic
1172659904 20:36560600-36560622 CTGGGTTGAGGGATGGGAGAAGG - Intergenic
1172687772 20:36769986-36770008 TGGGGTGCAGGGAGGGAAGAGGG + Intronic
1172687787 20:36770021-36770043 TGGGGTGCAGGGAGGGAGGAGGG + Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172784361 20:37456942-37456964 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1172940705 20:38652338-38652360 GTGGGATGAGGGAGGGAAGAGGG - Intergenic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173294023 20:41739799-41739821 CTGGGTGGAGAGAGGCAAGGAGG - Intergenic
1173317117 20:41955022-41955044 CAGGCTGAAGGGGAGGAAGAAGG - Intergenic
1173524385 20:43720874-43720896 GTGAGTGCTGGGAGGGAAGATGG + Intergenic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173586654 20:44187517-44187539 ATCGGGGAAGGGAGGGGAGAGGG + Exonic
1173607400 20:44341323-44341345 CTGAGTGAAGGAAGGGCAGAGGG - Intronic
1173687065 20:44931163-44931185 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
1173706868 20:45116357-45116379 AGGGGTGGAGGGAGGGAGGAAGG - Intergenic
1173741669 20:45406433-45406455 CTGGGCGGAGGGAGGAAGGATGG + Intronic
1173827865 20:46058726-46058748 CTGGGACAAGTGAGGGAGGAGGG + Intronic
1173894614 20:46541557-46541579 CTGGGTGTGGGGACGCAAGAAGG + Exonic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1173950064 20:46985226-46985248 TTGGAGGAAGGGAGGAAAGAAGG - Intronic
1174009946 20:47441754-47441776 GGAGGGGAAGGGAGGGAAGATGG - Intergenic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174141406 20:48416782-48416804 GTGGGAGAAGGGACGGTAGAAGG - Intergenic
1174478686 20:50815592-50815614 CGGGGAGAGGGGAGAGAAGACGG - Intronic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1174627610 20:51928231-51928253 GAGGGAGAAAGGAGGGAAGAAGG + Intergenic
1174920695 20:54698708-54698730 CTGAATGAAGGGAGGTAAGGTGG + Intergenic
1174937057 20:54882308-54882330 TTGGGTGCGGGGAGGGAGGAGGG - Intergenic
1175159292 20:56995913-56995935 CTGGGTGAAGCCAGAGAAGCAGG + Intergenic
1175196177 20:57244783-57244805 CCTGGGGAAGGGAGGGAGGACGG - Intronic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175292512 20:57886004-57886026 CGGGGGGAAGGGTGGGAGGAGGG - Intergenic
1175332654 20:58175914-58175936 CTGGGTGACGGGATGGACAAGGG + Intergenic
1175385537 20:58592630-58592652 CGGGGTGAGATGAGGGAAGATGG + Intergenic
1175564070 20:59958868-59958890 CTAGGCTAAGGGAGGGGAGAGGG + Intronic
1175565546 20:59973539-59973561 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1175587681 20:60157834-60157856 AAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1175825229 20:61933342-61933364 GCTGGTGATGGGAGGGAAGAAGG - Intronic
1175983987 20:62755192-62755214 ATGGATGGAGGGAGGGATGAAGG - Intronic
1175984022 20:62755320-62755342 ATGGATGGAGGGAGGGAGGAAGG - Intronic
1175984136 20:62755659-62755681 ATGGATGGAGGGAGGGAGGATGG - Intronic
1175984169 20:62755752-62755774 ATGGCTGGAGGGAGGGAGGATGG - Intronic
1175984182 20:62755791-62755813 ATGGCTGAAGGGAGGGATGGAGG - Intronic
1175984188 20:62755810-62755832 ATGGATGGAGGGAGGGAGGATGG - Intronic
1175984203 20:62755849-62755871 ATGGGTGGAGGGAGGGAGGATGG - Intronic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176141370 20:63546536-63546558 CTGGGTGAAGGCAGGTGAGCAGG - Intronic
1176192607 20:63819539-63819561 TTGGGAGAAGGGAGGGTAGGAGG - Intronic
1176286855 21:5022974-5022996 CTGGAAGGAGGGAGGGAAGGCGG + Intronic
1176292364 21:5052862-5052884 ATGGATGAATGGAGGGAAGGAGG - Intergenic
1176778885 21:13169465-13169487 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177164670 21:17586879-17586901 TGGGGTGAGGGGAGGGAGGAGGG - Intronic
1177272192 21:18864105-18864127 GAGGGTGTAGGGTGGGAAGAGGG - Intergenic
1177400265 21:20594558-20594580 TGGGGTGGAGGGAGGGGAGAGGG - Intergenic
1177507366 21:22036192-22036214 GAGGGTGAAGGGTAGGAAGAGGG - Intergenic
1177512841 21:22112677-22112699 GAAGGTGAAGGGTGGGAAGAGGG - Intergenic
1177764870 21:25446027-25446049 CAGGGTAGAGGGTGGGAAGAAGG + Intergenic
1177806138 21:25876850-25876872 GTGGGAGAAGGGAGAGAAAAGGG + Intergenic
1177957232 21:27613931-27613953 GAGGGTGGAAGGAGGGAAGAGGG - Intergenic
1178191520 21:30287519-30287541 AGGGATGGAGGGAGGGAAGAAGG + Intergenic
1178434480 21:32545909-32545931 CTAGGGAAAGGGAAGGAAGAAGG - Intergenic
1178570358 21:33730214-33730236 CAGGGTAAAGGGATAGAAGAGGG - Intronic
1178815509 21:35925587-35925609 CTGGGTGAGGGGAGTGGTGAGGG - Intronic
1178892776 21:36533840-36533862 GGGGGTGAAGGGTGGGAGGAGGG + Intronic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179409781 21:41153798-41153820 CTGGGCCAAGGCAGGGAGGAAGG + Intergenic
1179864893 21:44210788-44210810 ATGGATGAATGGAGGGAAGGAGG + Intergenic
1179870326 21:44240501-44240523 CTGGAAGGAGGGAGGGAAGGCGG - Intronic
1180752007 22:18131011-18131033 GTGGGAGAGGGGATGGAAGAAGG + Exonic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181032945 22:20157040-20157062 CTGGGTGGAGGGAGAGACCAGGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181527871 22:23500465-23500487 CTGGGTGGGGAGAGGGAAGTGGG + Intergenic
1181532982 22:23527649-23527671 CTGGGTGGAGGGAGGGAGTGAGG + Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181752100 22:24996037-24996059 CTGGGAGAAGTGAGGGCAGGTGG + Intronic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1182039081 22:27222380-27222402 ATGGGTGAATGGATGGATGATGG + Intergenic
1182093162 22:27609599-27609621 CTGGGGGAAGGGACGGGAGCGGG - Intergenic
1182364235 22:29767083-29767105 CTGGGCGGAGGGCGGGGAGAAGG + Intergenic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182787988 22:32923835-32923857 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1182886428 22:33777728-33777750 GCAGGTGAAGGGAGGGAGGAAGG + Intronic
1182988674 22:34745301-34745323 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
1183049584 22:35250076-35250098 CTGGGTGAAAGGAGGTAAGGAGG - Intergenic
1183106491 22:35618796-35618818 ATGGATGAATGGAGGGATGATGG - Intronic
1183165464 22:36144233-36144255 CTGGGAGTAGGGTGAGAAGAGGG - Intronic
1183303966 22:37072144-37072166 ATGGGTGAATGGATGGATGATGG + Intronic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183509611 22:38227179-38227201 GTGGAGGAAGGGAGGGAGGAAGG + Intronic
1183610579 22:38901314-38901336 CTGAGTGAAGGGATTTAAGAAGG - Intergenic
1183785856 22:40028735-40028757 CTGCCTGTAGGGAGGGAAGGGGG - Intronic
1183968785 22:41460239-41460261 CTGGGTGAAGGGAGAGGAGGGGG + Exonic
1184016536 22:41790033-41790055 CTGGTTGAAGGGAATGAAGGAGG - Intronic
1184103360 22:42353366-42353388 TTGGGGGAAGGGTGAGAAGAGGG + Intergenic
1184255120 22:43282080-43282102 CAGGGTGAAGGGAGTTGAGAAGG + Intronic
1184607381 22:45581883-45581905 CAGGGTGCAGGGAGGGTCGAGGG + Intronic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184769282 22:46588338-46588360 CTGCCTGGAGGGATGGAAGACGG - Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1184902181 22:47453316-47453338 CAGGAAGAAGGGAGGGATGAGGG - Intergenic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1185051199 22:48555177-48555199 CCGAGTGAAGGGAGGGAGGATGG + Intronic
1185151615 22:49167146-49167168 AGGGGTGGAGGGAGGGAAGAAGG - Intergenic
1185255013 22:49827260-49827282 CGGGGAGACGGGCGGGAAGACGG - Intronic
1185285769 22:49999455-49999477 CTGGCTGTAGGGCAGGAAGACGG + Exonic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949457096 3:4250274-4250296 AAGGGGGAAGGAAGGGAAGAGGG + Intronic
949621055 3:5811926-5811948 TTGGGTGATGGGAGAGAAGTTGG + Intergenic
949627490 3:5883506-5883528 TAGGGTGATTGGAGGGAAGAGGG + Intergenic
949634449 3:5967585-5967607 AGGGAGGAAGGGAGGGAAGAAGG - Intergenic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950109292 3:10408254-10408276 CAGGGAGAAGGGAGCCAAGAAGG + Intronic
950143325 3:10630307-10630329 GTGGGTGGAAGGTGGGAAGAGGG - Intronic
950225019 3:11226357-11226379 GTGGGTGAAAGAAGGGAAAAGGG + Intronic
950237709 3:11338100-11338122 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950456759 3:13097332-13097354 CTGGAAGCAGGGAGGGAAAAAGG - Intergenic
950500681 3:13361677-13361699 CTGTTTGAAGGGAGAGTAGATGG - Intronic
950762756 3:15248025-15248047 TGGGGTGAGGGGAGGGGAGAGGG + Intronic
950853503 3:16084644-16084666 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
950947693 3:16966914-16966936 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
951070315 3:18320631-18320653 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
951418736 3:22458024-22458046 AAGGAAGAAGGGAGGGAAGAAGG + Intergenic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
951720544 3:25693205-25693227 GTGGGAGGAGGGAGGGAAGCAGG - Intergenic
952020078 3:29008173-29008195 TTGGGTGAAGGGAGGCGACAAGG + Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952307669 3:32160308-32160330 ATGGGTGAATGGATGGATGATGG + Intronic
952307703 3:32160427-32160449 ATGGGTGAATGGATGGATGATGG + Intronic
952307733 3:32160533-32160555 ATGGGTGAATGGATGGATGATGG + Intronic
952388473 3:32860131-32860153 AGGGGAGAGGGGAGGGAAGAGGG - Intronic
952449062 3:33413763-33413785 GTGGGTGCAGGTAAGGAAGATGG - Intronic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
952576233 3:34777316-34777338 CTAGGTGACGGGAAGGACGATGG - Intergenic
952721573 3:36539346-36539368 GGGGGTGAAGGGTGGGAGGATGG - Intronic
952962648 3:38602383-38602405 CAGGGTGAAGGGAGGAAACTGGG - Intronic
953039194 3:39239735-39239757 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953134742 3:40172761-40172783 GTGGGGGAAGGAAGGGGAGAGGG - Intronic
953224051 3:41000082-41000104 CTGGGTAAAGGGAGCAAAGAGGG - Intergenic
953312001 3:41889535-41889557 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
953508395 3:43509218-43509240 TGGGGTGGAGGGAGGGGAGAGGG + Intronic
953564650 3:44021432-44021454 TTGGGTATAGGGAGGGAAGGAGG - Intergenic
953745214 3:45568782-45568804 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
953770086 3:45772881-45772903 CAGGTTGAAGGGAGGGTGGAAGG - Intronic
954245154 3:49325644-49325666 GTGGCTGATGGGAGGGAAGAGGG - Intronic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954462988 3:50638264-50638286 CCCGGTGCAGGGAGGGAGGATGG + Intronic
954519607 3:51212946-51212968 CTGGGCCAAGGGAGGAAATACGG - Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955036240 3:55270621-55270643 GGGGTTGAGGGGAGGGAAGAGGG + Intergenic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
955425373 3:58783995-58784017 GTGGTGGAAGGGAGGGAAGGAGG - Intronic
955650678 3:61190931-61190953 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
956191241 3:66610341-66610363 CTGGTTGGTGGGAGTGAAGAGGG + Intergenic
956305606 3:67821086-67821108 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
956513672 3:70022273-70022295 CCGGGTGGGGGGAGGGAGGAGGG + Intergenic
956513906 3:70024979-70025001 CTTGGTGAAAGGGGAGAAGATGG + Intergenic
956727967 3:72172091-72172113 CTGGGAGACGGGAGTCAAGATGG + Intergenic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956859843 3:73311875-73311897 AAGGGTGGAGGGTGGGAAGAGGG - Intergenic
956913874 3:73850456-73850478 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957583349 3:82105026-82105048 GTGGGTGGGGGGAGGGGAGAGGG - Intergenic
957642593 3:82875856-82875878 ATGGAAGATGGGAGGGAAGAGGG - Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958932884 3:100226203-100226225 GTGGGAGGAGGGAGGAAAGATGG + Intergenic
958971140 3:100611323-100611345 CGGGGGGAAGGAAGGGAGGAAGG - Intronic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959270301 3:104199463-104199485 GAGGGTGAAGGCTGGGAAGAGGG - Intergenic
959318339 3:104838129-104838151 GAGGGTGAAGGGTGGGAGGAAGG + Intergenic
959407969 3:105984777-105984799 TTGGGTGGAGGGAGGGTAAAAGG - Intergenic
959672918 3:108999337-108999359 ATGGGGGCAGGGAGGGAATATGG + Intronic
959788984 3:110333900-110333922 CAGAGTGGAGGGTGGGAAGAGGG + Intergenic
960065020 3:113362270-113362292 CTGGGTGAAGGGACAGGAGGGGG + Intronic
960345980 3:116533638-116533660 TGGGGAGAAGGGAGGGGAGAGGG + Intronic
960437348 3:117644017-117644039 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
960451203 3:117810436-117810458 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
960836837 3:121915479-121915501 TTAGGTGATGGGAGGAAAGAGGG + Intronic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961175075 3:124828497-124828519 CTGGGGTAAGGGAGGCAGGAGGG + Intronic
961431465 3:126886910-126886932 AGGGGTGAAGGGAGGGTGGAAGG - Intronic
961584141 3:127908432-127908454 ATGGGAGAAGGGAGGGGAGGGGG - Intergenic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961945647 3:130684241-130684263 CTGGGTGATTGCAGGTAAGATGG - Exonic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962281142 3:134052778-134052800 CTGTGTGAAGCGGTGGAAGAAGG + Intergenic
962299846 3:134229651-134229673 CTGGGGGAAGGGAGAGATGTTGG + Intronic
962588219 3:136862851-136862873 GTGGGTGGGGGGAGGGGAGAGGG - Intronic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963136767 3:141912799-141912821 CTTGGTAATGGGAGGGAAGAGGG - Intronic
963237324 3:142968470-142968492 CTGGGAGAGGGGATGGAAGCAGG - Intronic
963284240 3:143417539-143417561 ATGGATGGAGGGAGGGAAAAAGG + Intronic
963516080 3:146309866-146309888 CTGGGTGCAGGGAGAGGAAATGG - Intergenic
963550836 3:146720850-146720872 ATGGGTGAAGGATGGGAAAAGGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963636721 3:147807181-147807203 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
964028116 3:152102968-152102990 TTGGAGGAAGGGAGGGAGGAAGG - Intergenic
964056786 3:152470939-152470961 AGGGATGAAAGGAGGGAAGAAGG - Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964511348 3:157455567-157455589 GAGGGTGAAGGGTGGGAAAAGGG - Intronic
964587572 3:158324373-158324395 TGGGGTGAGGGGAGGGCAGAGGG - Intronic
965171121 3:165265691-165265713 AGGGGTGAAGGGAGGGGGGAGGG - Intergenic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
965828137 3:172751117-172751139 GTGGGTGAAGGGAGGGAGTTGGG + Intronic
965874548 3:173300416-173300438 ATGGGTGGATGGAGGTAAGAGGG + Intergenic
966113711 3:176434769-176434791 CTGGGTGTTGGGAGTTAAGATGG - Intergenic
966263692 3:178011906-178011928 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
966501400 3:180645362-180645384 CTGGGTTCTGGGTGGGAAGAGGG - Intronic
966618215 3:181935044-181935066 CTGGATGAAGAGAGAGAAGGGGG + Intergenic
966736016 3:183187860-183187882 CTGGGTAGGGGAAGGGAAGAAGG - Intronic
966736265 3:183189516-183189538 CTGGCTGGGGGAAGGGAAGAAGG - Intronic
966746150 3:183279516-183279538 CAGGGTGAAGGAAGGGAAAAAGG - Intronic
966889389 3:184395606-184395628 CTGAGGGAAGGTGGGGAAGAGGG + Intronic
966932615 3:184685640-184685662 TTGGGTCAAGGGAGAGAAAATGG + Intergenic
967130807 3:186469195-186469217 CTTGCAGCAGGGAGGGAAGATGG - Intergenic
967459081 3:189724472-189724494 CCGGGGAAAGGGTGGGAAGAGGG - Intronic
967640289 3:191854725-191854747 CTTAGAGAAGGGAGTGAAGAAGG - Intergenic
967947897 3:194818587-194818609 GTGGGTGAGGAGAGGGGAGAGGG - Intergenic
967962820 3:194939399-194939421 CTGGGTGCAGGGGAGGTAGAGGG + Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968657557 4:1785260-1785282 CTGGGAGCAGGGAGGGGAGCTGG + Intergenic
968756247 4:2417873-2417895 CCTGGTGCAGGGAGGGGAGACGG + Intronic
968870422 4:3239235-3239257 CTGGGTGAGGGGAGCGAGGGTGG + Intronic
968937125 4:3617298-3617320 GTGAGAGATGGGAGGGAAGAAGG - Intergenic
968987016 4:3880950-3880972 CGGGGAGACGGGAAGGAAGAGGG + Intergenic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969198021 4:5578651-5578673 GTGGATGGAGGGAGGGAAAAGGG + Intronic
969471466 4:7391818-7391840 CTGGGTGAGGGGCTGGAAGGAGG - Intronic
969493342 4:7512363-7512385 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
969495309 4:7523026-7523048 GAGGGAGGAGGGAGGGAAGAGGG - Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969612300 4:8234220-8234242 ATGGGTGAATGGATGGATGATGG - Intronic
970047031 4:11866071-11866093 GAGGGCGAAGGGAGGGAGGAGGG + Intergenic
970522382 4:16898778-16898800 ATGGAGGAAGGGAGGGAAGAAGG + Exonic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
970797796 4:19935060-19935082 CTGGGGGAAGGAAGGGAATGAGG + Intergenic
972029770 4:34439984-34440006 GAGGGTGAAGGGTGGGACGAGGG - Intergenic
972127727 4:35790161-35790183 AAGGGAGAAGGGAGGGAAGGGGG + Intergenic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
972258161 4:37381289-37381311 CTGGGTGGAGTGAGTGAAGGTGG + Intronic
972276269 4:37560676-37560698 CTAGATGCAGGGAGGGAAGCTGG - Intronic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
972843513 4:42959424-42959446 GTGGGGGATGGAAGGGAAGAAGG + Intronic
973180213 4:47257548-47257570 GTGGGTGTAGGGAGGGAGGGTGG + Intronic
974020548 4:56688320-56688342 GAAGGGGAAGGGAGGGAAGAAGG + Intergenic
974247611 4:59340740-59340762 AAGGGAGAAGGGAGGGAGGAAGG + Intergenic
974349380 4:60724671-60724693 CTGGGGGAAAGCAGGGAATAAGG - Intergenic
974377543 4:61097730-61097752 TTGGGTGGAGGGAGGGGGGAGGG - Intergenic
974454207 4:62105262-62105284 CAGGGTGAAGGGTGGGAGGAGGG - Intergenic
975093448 4:70429598-70429620 GAGGGTGAAGGGTGGGAGGAAGG + Intergenic
975745162 4:77468143-77468165 CAGGGTGATGGGACTGAAGAAGG + Intergenic
975837627 4:78441328-78441350 TTGAGAGAAGGGAGGGGAGAGGG + Intronic
976040891 4:80884008-80884030 GAGGGTGAAGGGTGGGAAAAGGG - Intronic
976045070 4:80936635-80936657 GAGGGTGGAGGGTGGGAAGAGGG + Intronic
976133735 4:81912446-81912468 ATGGGTGTAGGGAGGTATGAGGG - Intronic
976432623 4:84980831-84980853 ATGGGTGGGGGGAGGGGAGAGGG - Intergenic
976669240 4:87633635-87633657 ATGTGTGAAGGGAGGAAAAAGGG - Intergenic
976687450 4:87830578-87830600 GAGGGTGAAGGGTGGGAAGAAGG + Intronic
977027445 4:91836802-91836824 TTTGGGGAAGGGAGGGAGGATGG + Intergenic
977324085 4:95553103-95553125 CTGGGCTAAGGCAGGGAAGGAGG - Intergenic
977517318 4:98036654-98036676 GAGGGTGGAGGGTGGGAAGAGGG + Intronic
977671099 4:99696614-99696636 GTGGGTGCAGGGAGGGGTGAAGG - Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
977978703 4:103297389-103297411 CTGGATGGAGGGTGGGAGGAGGG - Intergenic
978072688 4:104491800-104491822 CATGGTGCAGGGGGGGAAGAAGG + Exonic
978224340 4:106316204-106316226 CAGGCTGAGGGGAGGGTAGAGGG - Intronic
978379420 4:108111444-108111466 CTGCCTGAAGGGAGGAAAGGAGG + Intronic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
978886262 4:113769774-113769796 GTGGGGGAAGTGGGGGAAGAAGG - Intergenic
979301114 4:119088463-119088485 GAGGGTGATGGGAGGGAGGAGGG - Intergenic
979945426 4:126825481-126825503 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
980154296 4:129085855-129085877 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
980216608 4:129859769-129859791 TGGGGTGAGGGGAGGGGAGAGGG + Intergenic
980288516 4:130813176-130813198 CGGGGTTGAGGGAGGGAGGAGGG - Intergenic
980291340 4:130850237-130850259 CTGGGTGAAGGGATTTAAGAAGG - Intergenic
980479461 4:133368883-133368905 CAGGGAGAAGTGGGGGAAGAGGG + Intergenic
980987557 4:139710535-139710557 CGGGGTGGAGGGAGGGCACAGGG - Intronic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981676636 4:147350366-147350388 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
982086002 4:151836753-151836775 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
982334577 4:154219921-154219943 GTGGGAGGAGGGAGGGAAGGAGG - Intergenic
982585383 4:157230594-157230616 ATGGATGGAGGGAAGGAAGAAGG - Intronic
983330993 4:166329084-166329106 GCAGGGGAAGGGAGGGAAGAAGG + Intergenic
983336100 4:166394549-166394571 GAGGGGGAAGGGAGAGAAGAGGG + Intergenic
983500940 4:168499241-168499263 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
983833358 4:172359353-172359375 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
984143949 4:176038399-176038421 GAAGGTGGAGGGAGGGAAGAGGG - Intergenic
984151495 4:176138557-176138579 TTTGGTGATGGGAGGGAAGATGG - Intronic
984508698 4:180653356-180653378 GTGGGTGGAGGGTGGGAAGAGGG + Intergenic
984885468 4:184445727-184445749 GTGGAGGAAGGAAGGGAAGAAGG - Intronic
984918415 4:184743475-184743497 TTGGGTGAGGGGAGGGCAGAGGG + Intergenic
985092399 4:186377810-186377832 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
985100990 4:186458486-186458508 GTGGGGGGAGGGAGGGACGAGGG - Intronic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
985644058 5:1076816-1076838 CAGGGAGAAGGGCAGGAAGATGG + Intronic
985956708 5:3271114-3271136 GTGCTTGAAGGGAGGGAAGGGGG - Intergenic
985958055 5:3279026-3279048 AGGGAGGAAGGGAGGGAAGAGGG - Intergenic
985993802 5:3585033-3585055 ATGGGAGAAAGGAAGGAAGAAGG + Intergenic
986056472 5:4142201-4142223 GTGGGTGACTGGAGGTAAGAGGG + Intergenic
986344022 5:6817792-6817814 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
986618301 5:9643053-9643075 CTGGGGTATGGGAGGGAAGGAGG - Intronic
986621215 5:9677255-9677277 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
986831821 5:11588883-11588905 CGTGGTGCAGGGAGGGAGGAGGG - Intronic
986945359 5:13012067-13012089 TAGGGTGGAGGGTGGGAAGAGGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987351467 5:17025896-17025918 TTGGGGGAGGGGAGGGGAGAGGG + Intergenic
987446881 5:18031191-18031213 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
987550947 5:19380648-19380670 TAGGGTGAAGGGTGGGAGGAGGG + Intergenic
987553127 5:19409806-19409828 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
987955842 5:24738965-24738987 CAGGGTGAGGGCTGGGAAGAGGG - Intergenic
988418697 5:30978683-30978705 TAAGGTGAAGGGAGGGAAGAAGG + Intergenic
989069622 5:37497166-37497188 AGGGGGGAAGGGAGGGAAGGAGG - Intronic
989085693 5:37673749-37673771 ATGGGTGAAGGGAGAGAATCGGG - Intronic
989284392 5:39682656-39682678 TGGGGTGAGGGGAGGGAGGAGGG - Intergenic
989289123 5:39741136-39741158 CAGGGAGAAGGCAGGAAAGAGGG - Intergenic
989339456 5:40356767-40356789 TTGGGTGATGAGGGGGAAGAAGG - Intergenic
989339925 5:40362779-40362801 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
989427405 5:41312647-41312669 AGGGAGGAAGGGAGGGAAGAAGG - Exonic
989504518 5:42211719-42211741 GAGGGTGAAGGGTAGGAAGAAGG - Intergenic
989509544 5:42268957-42268979 GAGGGTGAAGGGTGGGAGGAAGG + Intergenic
989560466 5:42844450-42844472 TTGGGTGGAGGGAGGGGGGAAGG - Intronic
989773048 5:45167959-45167981 GTAGGTGAAGGGAGGGAGGCAGG - Intergenic
990348716 5:54894422-54894444 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
990446189 5:55896589-55896611 GTGGGGGAAGGGAGGGGAGGGGG - Intronic
990539216 5:56755675-56755697 GAGGGTGAAGGATGGGAAGAGGG + Intergenic
990957656 5:61359605-61359627 CTGGGTGAGGGAAAGGATGATGG + Intronic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991038667 5:62153937-62153959 GTGGGTGGAGAGTGGGAAGAGGG - Intergenic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
992032352 5:72734437-72734459 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
992068209 5:73126375-73126397 CTTGGAGAAGGAAGGGGAGATGG + Intronic
992397063 5:76378120-76378142 CTGCGTGGTGGCAGGGAAGAGGG + Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993413381 5:87598098-87598120 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
993481188 5:88426324-88426346 TGGGGAGAAGGGAGGGAGGAAGG + Intergenic
994032587 5:95161434-95161456 CTGGGGGAAGGGGGTCAAGAGGG + Intronic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994412841 5:99431258-99431280 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
994481000 5:100334462-100334484 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
995193041 5:109339931-109339953 CTGGGAGAAGGGAGAGAGCAAGG + Intronic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
996053650 5:118960923-118960945 GAGGGTGGAGGGTGGGAAGAGGG + Intronic
996136390 5:119847572-119847594 TGGGGTGAGGGGAGGGGAGAGGG - Intergenic
996236276 5:121134560-121134582 ATGTGTGAAGGTAGTGAAGAGGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996862560 5:128083325-128083347 CTGGGTGGAGAGAGGGGAGGTGG + Intergenic
997178774 5:131805981-131806003 CTGCTTGAAGGCAGAGAAGAGGG + Intergenic
997365705 5:133323962-133323984 CTGTGTGAAGGGAGTGCAGTGGG - Intronic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997583096 5:135029322-135029344 CTGGGGGAGGGGACGGGAGAAGG + Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG + Intergenic
997976724 5:138445445-138445467 CTGGGTGCAGGGAGAAAAGGAGG - Intronic
997983275 5:138483730-138483752 GGGGGTGAGGGTAGGGAAGAGGG - Intergenic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998594577 5:143515559-143515581 ATGGGGAAAGGAAGGGAAGAAGG - Intergenic
998642612 5:144028554-144028576 CTGGGTGAAGAAAGAGAAGGAGG - Intergenic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
999983728 5:156983158-156983180 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1000071712 5:157745917-157745939 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1000579844 5:163022673-163022695 AGGGATGGAGGGAGGGAAGAAGG + Intergenic
1000585088 5:163087398-163087420 TGGGGTGGGGGGAGGGAAGAGGG + Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000734257 5:164879401-164879423 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1000753844 5:165132238-165132260 CTAGGAGATGGGAGGGAAAAAGG - Intergenic
1000774789 5:165406309-165406331 GAGGGTGGAGGGAGGGAAGGGGG - Intergenic
1000867388 5:166531801-166531823 TTGAGAGAAGGAAGGGAAGAAGG - Intergenic
1000984930 5:167855956-167855978 AGGAGGGAAGGGAGGGAAGAAGG + Intronic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001161998 5:169327577-169327599 CAGGGGGAAGGGTGGGAGGAGGG + Intergenic
1001231672 5:169994086-169994108 GTGGGTGTAGGGAGGGCAGGTGG + Intronic
1001412939 5:171523747-171523769 CTCGGAGAAGGGAAGGAAGGAGG - Intergenic
1001536715 5:172503234-172503256 CTGGGAGAAGAAAGAGAAGATGG - Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001751445 5:174134588-174134610 ATGGGTGAATGGATGGATGATGG - Intronic
1001849038 5:174947103-174947125 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1001855551 5:175007549-175007571 AAGGGAAAAGGGAGGGAAGAAGG - Intergenic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1002067640 5:176660128-176660150 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067648 5:176660155-176660177 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067656 5:176660182-176660204 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002140373 5:177133988-177134010 CGAGGAGAAGGGAGGGAGGAGGG + Intronic
1002168891 5:177364343-177364365 CCGGGTGATGGGAAGAAAGATGG + Intronic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1002663559 5:180806904-180806926 CTGGGTGAAGCTGGGGAAGGTGG + Intronic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1002896726 6:1383989-1384011 TTGGGGGAAGGGAGGGCAGCGGG + Intergenic
1002904695 6:1438860-1438882 GCAGGAGAAGGGAGGGAAGAGGG - Intergenic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003074072 6:2968305-2968327 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003281500 6:4696115-4696137 GTGGCTGAGGGGAGGGGAGATGG + Intergenic
1003385869 6:5667051-5667073 GAGGGTGGAGGGTGGGAAGAGGG + Intronic
1004007067 6:11646747-11646769 CTGGGTGAAAATGGGGAAGAGGG + Intergenic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004396292 6:15248673-15248695 GGGGGCGGAGGGAGGGAAGAAGG - Intronic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1004653077 6:17630742-17630764 AGGGGAGAAGGGAGGGGAGAGGG + Intronic
1004738603 6:18433553-18433575 CTGAGTGGAGGGAGAAAAGACGG + Intronic
1005407129 6:25501290-25501312 CTTGGGGAGGGGAAGGAAGATGG - Intronic
1005436094 6:25813717-25813739 CTGGGTAGAGGGTGGGAAGAGGG - Intronic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1005877913 6:30028127-30028149 TCGGGGAAAGGGAGGGAAGAAGG + Intergenic
1006045051 6:31288057-31288079 CTGGGGTAAGGCAGGGAAGTGGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006077380 6:31542440-31542462 CTAGCTGAGGGGAGGGAGGAGGG + Exonic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006416410 6:33906819-33906841 CTGGGAGAAGGGTGGGACCAGGG + Intergenic
1006510801 6:34520083-34520105 GTGAGTGATGGGAGGGAGGATGG + Intronic
1006517313 6:34552191-34552213 CTGGAGGAGGGTAGGGAAGAGGG - Intronic
1006525018 6:34596922-34596944 ATGGGTGAAGGGAGGATAAATGG - Intronic
1006638661 6:35477406-35477428 CAGGTGGAAGGTAGGGAAGAGGG - Intronic
1006641463 6:35491743-35491765 CTGGGTGGAGGCAGGGATGGGGG + Intronic
1006670170 6:35725490-35725512 CTGGGTGATGGGAGAGAGAAAGG + Intronic
1006727620 6:36211231-36211253 CAGGGAGAAGGGAGGACAGAAGG - Intronic
1006780859 6:36631511-36631533 CTGGCTCCAGGGAGGGAAGATGG - Intergenic
1006920751 6:37625666-37625688 CAGAAAGAAGGGAGGGAAGAGGG - Intergenic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1007183498 6:39947937-39947959 ATGGGTGTAGGGAGGGAGGGAGG + Intergenic
1007343521 6:41209256-41209278 CAGGGAGAAGGGAGGGAAAGAGG - Intergenic
1007533627 6:42564654-42564676 CTGGGGGAAAGGAGGTATGATGG - Intronic
1007915129 6:45554317-45554339 GTGCCTGAAGGGAGGGAAGGAGG + Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008362335 6:50635541-50635563 AGGGGAGAAGGGAGGGGAGAAGG + Intergenic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008419711 6:51284017-51284039 GAGGGAGAAGGGAGGGATGAAGG + Intergenic
1008457743 6:51730925-51730947 GAGGTTGAAGGGAGGGAAGAGGG + Intronic
1008531180 6:52461212-52461234 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1008642466 6:53478664-53478686 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1008664845 6:53706003-53706025 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1008713179 6:54254768-54254790 GGGGGGGAAGGGAGGGAGGAAGG - Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1009554066 6:65139433-65139455 GAGGGTGAAGGGAAGGAAGAGGG + Intronic
1009804703 6:68588537-68588559 GTGGGTGGAGGGTGGGAGGAAGG - Intergenic
1009945597 6:70338768-70338790 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1010164508 6:72899796-72899818 TGGGGTGAAGGGTGGGAAGGGGG - Intronic
1010350638 6:74870219-74870241 CTGGGGGAAAGGAGGAAATAAGG - Intergenic
1010709091 6:79152022-79152044 TTGGGAGAAGGGAAGGAAGCAGG + Intergenic
1010743125 6:79530356-79530378 AAGGGTGAAGGGTGGGATGAGGG + Intronic
1010819872 6:80401062-80401084 AAGGGTGAAGGGTGGGAAGAGGG + Intergenic
1010941939 6:81929655-81929677 TAGGGTGGAGGGTGGGAAGAAGG - Intergenic
1010949429 6:82017495-82017517 CTGGGAGAAGGGAGGGCTCAGGG + Intergenic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1011632321 6:89339516-89339538 AGGGGGGAAGGGAGGGAAGTGGG + Intronic
1011841189 6:91501065-91501087 AGGGATGGAGGGAGGGAAGAAGG - Intergenic
1012299931 6:97573639-97573661 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1012322476 6:97867523-97867545 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1012325227 6:97908316-97908338 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1012355958 6:98314926-98314948 GTGGGTGAAGACAGGAAAGAAGG + Intergenic
1012485650 6:99719874-99719896 GTGGGTGGAGGGTGGGAGGAGGG - Intergenic
1012515048 6:100049512-100049534 ATGGATGGATGGAGGGAAGAGGG + Intergenic
1012540134 6:100353071-100353093 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1012591454 6:100986004-100986026 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1012619522 6:101323793-101323815 CAGGGTGGAGGGTGGAAAGAAGG + Intergenic
1012727324 6:102831016-102831038 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013612972 6:111812261-111812283 CTGGGAGGAGGCAGGGCAGATGG + Intronic
1013954317 6:115822897-115822919 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1013964990 6:115944868-115944890 GAGGGTGAAGGTAGGGAGGAAGG - Intronic
1013971605 6:116026525-116026547 AGGGGGGAAGGGAGGAAAGAAGG + Intronic
1014217029 6:118762261-118762283 CTGGATGGAGGGAGGGGACAAGG - Intergenic
1014263055 6:119241865-119241887 CTGGGGGAAGGGAAAGATGAAGG + Intronic
1014510853 6:122320397-122320419 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1014622688 6:123688582-123688604 GTGGGTGAAGGGTGGGAAGAGGG + Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015153086 6:130060831-130060853 CTGGCTCAAGGGAGGGAGCAAGG - Intronic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1015449662 6:133350628-133350650 GTGGGTGAAGTTAGGGAAGTTGG + Intronic
1015843655 6:137496905-137496927 CGGGGGGAGGGGAGGGAAGGAGG + Intergenic
1016235908 6:141865898-141865920 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1016452158 6:144194497-144194519 CTTGGTGAGGGGAGGGGACATGG + Intergenic
1016501639 6:144726989-144727011 AGGGGTGTGGGGAGGGAAGAGGG - Intronic
1016532557 6:145074975-145074997 ATTGGGGAAGGGAGGGAGGAAGG + Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017085161 6:150706899-150706921 TTTGGTGAGGGGAGGGAAGAAGG - Intronic
1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG + Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017601038 6:156081491-156081513 GTGGGTGATGGGAAGGACGAGGG + Intergenic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017744590 6:157435353-157435375 GTAGGAGAAGGGAGGGAAGGAGG + Intronic
1017802526 6:157910623-157910645 CTGGGGGAGGGGAGGGAATGTGG - Intronic
1018174947 6:161170363-161170385 CTTGGAGAAGGGAGGGAGGTTGG - Intronic
1018242736 6:161794439-161794461 GGGGGTCCAGGGAGGGAAGAGGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019324643 7:432152-432174 CTGGGTTCAGGGCTGGAAGATGG + Intergenic
1019419796 7:945723-945745 CTGGGAGGAGGGAGGGAAAGAGG - Intronic
1019483495 7:1277054-1277076 GAGGGAGAAGGAAGGGAAGAGGG - Intergenic
1019510480 7:1415193-1415215 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019510510 7:1415289-1415311 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019567252 7:1690425-1690447 ATGGGTGAATGGATGGATGAAGG + Intronic
1019567328 7:1690785-1690807 ATGGGTGAATGGATGGATGAAGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019717067 7:2543974-2543996 ATGGGGGAAGAGAGGGAAAAGGG + Intronic
1019805079 7:3117685-3117707 GGGGGAGAAGAGAGGGAAGAAGG + Intergenic
1020227020 7:6288444-6288466 AGGGGAGGAGGGAGGGAAGAAGG - Intergenic
1020436430 7:8167476-8167498 GTAGGTGGAGGGTGGGAAGAGGG + Intronic
1020569772 7:9844744-9844766 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1020766799 7:12332039-12332061 TTTGGGGAAGGTAGGGAAGAGGG + Intronic
1020877264 7:13713516-13713538 AAGGGGGAAGGGAGGGAAGGAGG + Intergenic
1021128615 7:16883366-16883388 GTGGGAGAAGGGAGGGATGGAGG - Intergenic
1021357892 7:19676173-19676195 GTGGGTGAAGGGTGGAAGGAGGG + Intergenic
1021407483 7:20289105-20289127 AAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1021579046 7:22133077-22133099 CTGCCTGAAGGGAGTGAGGAGGG - Intronic
1021747930 7:23762227-23762249 CGGGGTGGAGGGAGGGGGGAGGG - Intronic
1021824369 7:24533405-24533427 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1021906278 7:25336988-25337010 ATGGGAGAAGAAAGGGAAGAGGG + Intergenic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022327658 7:29346538-29346560 CTGGGAGAGGGGATGGCAGAGGG + Intronic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022509463 7:30925938-30925960 GTGAGTGGAGGGAGGGAGGAAGG - Intergenic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023239408 7:38127791-38127813 CTGGATGGAGGGAAGGAAGGAGG - Intergenic
1023741879 7:43288309-43288331 CCGGGAGCAGGGAGGGAGGAAGG + Intronic
1023897406 7:44445406-44445428 CTAGGGGAAGGGAGTGAACAGGG - Intronic
1023921890 7:44636252-44636274 CTGGGGGAAGGGATGTCAGATGG + Intronic
1023932388 7:44713712-44713734 CTGGATGAAGGGTGGGGAGGGGG - Intergenic
1025275451 7:57578675-57578697 TTGGATGAAGGGGGGAAAGAGGG - Intergenic
1026020235 7:66700119-66700141 TTGGGTGAAGGGAGGGACGGAGG + Intronic
1026132234 7:67630137-67630159 GTGGGTGAAGGGAAGGGAAAGGG + Intergenic
1026144501 7:67734808-67734830 CTGGGGGAAGGCAGTGTAGAAGG - Intergenic
1026178217 7:68016351-68016373 ATGGATGGAGGGAGGGAAGAGGG - Intergenic
1026361067 7:69600591-69600613 TTGGGAGAAAGGAGGGAGGAGGG + Intronic
1026523474 7:71135359-71135381 CTAGGTGAAGGGAGGTTAGGAGG + Intronic
1026539819 7:71269817-71269839 CTGGGGGAGGTGATGGAAGACGG + Intronic
1026675694 7:72426170-72426192 CTGGATGAAGGGCCAGAAGAAGG + Intronic
1026828586 7:73598224-73598246 GTAGGTGAATGGATGGAAGACGG - Intronic
1026928439 7:74209893-74209915 TGGGGGGAAGGGAGGGGAGACGG - Exonic
1027512445 7:79099618-79099640 AAGGGTGAAGGGAGAGAGGAGGG - Intronic
1027731339 7:81877236-81877258 CTGGGAGAATTGGGGGAAGAGGG + Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1027769996 7:82394314-82394336 CTAGATGAAGGGAGGGAAGAAGG + Intronic
1028104775 7:86864170-86864192 CGGGGGGAAGGGTGGGAAGGAGG - Intronic
1028343541 7:89752445-89752467 GAAGGTGGAGGGAGGGAAGAGGG + Intergenic
1028354136 7:89886165-89886187 GTGGGTGGAGGGTGGGAGGAGGG - Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028618832 7:92801629-92801651 AAGAGAGAAGGGAGGGAAGAAGG - Intronic
1029145223 7:98440956-98440978 GTGGGTGGAGGGTGGGAGGAGGG + Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029412820 7:100426791-100426813 GGGGGAGGAGGGAGGGAAGAGGG - Intronic
1029654744 7:101916871-101916893 AGGGTTGAAGGGAAGGAAGAAGG - Intronic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1029901394 7:104044065-104044087 GAGGGTGGAGGGAAGGAAGAGGG + Intergenic
1030094406 7:105885259-105885281 CTGGGTGGTGGGAGAGAAGCAGG + Intronic
1030280492 7:107769576-107769598 GAGGGTGAAGGGTGGGAGGAAGG + Intronic
1030282993 7:107796489-107796511 GTGGGTGGAGAGATGGAAGAGGG - Intronic
1030328510 7:108247835-108247857 CTGGAGAAAGGGAGGAAAGAGGG + Intronic
1030732443 7:113006022-113006044 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1030913719 7:115285543-115285565 CAGAGTGAAGGAAGGGAAGATGG + Intergenic
1031330298 7:120455810-120455832 CAGGGTTAAGGGTGGGAGGAAGG + Intronic
1031448103 7:121879824-121879846 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1031672735 7:124569796-124569818 TGTGTTGAAGGGAGGGAAGAAGG - Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1031894432 7:127332080-127332102 GAGGGTGGAGGGTGGGAAGAAGG + Intergenic
1031975442 7:128090661-128090683 CTGGGAGAAGGGAGAGCAGTGGG - Intronic
1032022902 7:128419906-128419928 CTGGGTGAAGTCAGTGGAGAAGG + Intergenic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032201366 7:129825328-129825350 CGGGGGGCAGGGTGGGAAGAGGG - Intergenic
1032201414 7:129825444-129825466 CTGGGTAAAGGGAGGGCACCCGG - Intergenic
1032361204 7:131256798-131256820 AAGGGTGGAGGGAGGGAGGAGGG + Intronic
1032403360 7:131638753-131638775 CTGGGAAGAGGAAGGGAAGATGG + Intergenic
1032465938 7:132145096-132145118 GTGAGTGAAGGGAGGGCAGGGGG - Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1032685063 7:134224543-134224565 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1032775046 7:135104058-135104080 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1032778279 7:135138735-135138757 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033400613 7:141020310-141020332 GGGGGTGGAGGGAGGGAGGAAGG + Intergenic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033786478 7:144737270-144737292 GGGGGAGAAGGGAGGGAGGAAGG + Intronic
1033807111 7:144966977-144966999 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1033915112 7:146314748-146314770 CTGGGTCAAGCTGGGGAAGAAGG + Intronic
1034204948 7:149307255-149307277 GAGGGTGGAGGGAGGGAAGAGGG + Intergenic
1034389637 7:150775251-150775273 GAGGGAGAAGGGTGGGAAGAGGG + Intergenic
1034394083 7:150807022-150807044 CTGGGAGAAGGGGAGGAAGCAGG - Intergenic
1034889756 7:154829462-154829484 GAGGGAGGAGGGAGGGAAGAAGG + Intronic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035158082 7:156930336-156930358 CTGGGAGAAGGGGAGGAAGACGG - Intergenic
1035181011 7:157089577-157089599 CTGGGAGGAGTGGGGGAAGAGGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035278946 7:157765435-157765457 ATGGGTGAAGGGTGGACAGATGG - Intronic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035520815 8:273922-273944 CTGGGTGAGGGGTGAGAAGTGGG + Intergenic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036154166 8:6326242-6326264 CAGGAGGAAGGAAGGGAAGAAGG + Intergenic
1036176779 8:6546766-6546788 TTGGGGGAAGGGGAGGAAGAGGG - Intronic
1036435914 8:8733071-8733093 GGTGGTGAAGGGTGGGAAGAGGG + Intergenic
1036579640 8:10061999-10062021 GTGGGGGAAGGGAGGAAAGGAGG + Intronic
1036656588 8:10681159-10681181 CTTGGCGCAGGGAGGGAAGGTGG + Intronic
1036718066 8:11144993-11145015 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
1037234112 8:16696250-16696272 CTTAGTGGAGGGAGTGAAGAAGG - Intergenic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037715312 8:21392497-21392519 CTGGCTGATGGGAGGGGAGGTGG - Intergenic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1038007239 8:23442718-23442740 CTGAGTGAATGGAGGGATAAAGG - Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038094249 8:24290029-24290051 GCTGGAGAAGGGAGGGAAGAGGG - Intergenic
1038271680 8:26080865-26080887 TTGGGTGGTGGCAGGGAAGATGG - Intergenic
1038440812 8:27569760-27569782 TTGGTTGAAGGGATGGATGAAGG + Intergenic
1038440913 8:27570192-27570214 ATGGATGAAGGGATGGATGAAGG + Intergenic
1038519119 8:28214418-28214440 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1038750422 8:30289999-30290021 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1039028231 8:33281442-33281464 GTGGGAGAAGGGAGGGAATTCGG + Intergenic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039479211 8:37859265-37859287 CTGGGAGAAGGGTGGGAGGGAGG + Exonic
1039747990 8:40449210-40449232 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1040017909 8:42715035-42715057 CCTGGTGAAGGGATGGAAGATGG - Intronic
1040619152 8:49070242-49070264 GAGGGTGAAGGGCGGGAGGAGGG + Intronic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1040671958 8:49702750-49702772 GTGGGTGAAGGGTGGGAGGAGGG + Intergenic
1040672256 8:49705799-49705821 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1040883576 8:52234959-52234981 CAGGGGAAAGGGTGGGAAGAGGG + Intronic
1040901294 8:52419625-52419647 CTGGGTGCAGGGAGAAAAGAAGG - Intronic
1040926851 8:52693778-52693800 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1041172389 8:55157665-55157687 GAGGGTGCAGGGTGGGAAGAGGG - Intronic
1041191687 8:55361592-55361614 CAAGGAGAAGGGAAGGAAGAGGG - Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041399719 8:57429122-57429144 GAGGGTGAAGGGTGGGAAAAGGG - Intergenic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1041540547 8:58980253-58980275 GTGGGAGAGGGGAGAGAAGATGG - Intronic
1041577839 8:59420398-59420420 GAGGGTGAAGGGTGGGAAGAAGG + Intergenic
1041655358 8:60344416-60344438 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1041866565 8:62581728-62581750 ATGGATGGAGGGAGGGAGGAAGG - Intronic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042433839 8:68741080-68741102 GAGGGTGAAGGGAGGGAGGGGGG + Intronic
1042586848 8:70349008-70349030 GTGGGGGATGGGAGGGAAAAGGG + Intronic
1043001923 8:74770024-74770046 CTGGTAGATGGGAGGGAAGGAGG + Intronic
1043693397 8:83186501-83186523 GGGGGTGGAGGGTGGGAAGAAGG + Intergenic
1043881168 8:85544708-85544730 GTGGGGGAAGGGATGGAAGTGGG + Intergenic
1043979473 8:86621632-86621654 CAGGGAGAAGGGTGGGAAGGGGG - Intronic
1044001551 8:86888139-86888161 ATGAGTGAAGGAAGGTAAGAGGG - Intronic
1044119955 8:88382484-88382506 AGGGAGGAAGGGAGGGAAGAGGG - Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044629784 8:94267088-94267110 CTGGGCCAATGGAGGGAAGGAGG - Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045066176 8:98447087-98447109 CAGGGTGGAGGGTGGCAAGAGGG + Intronic
1045330922 8:101155081-101155103 GGGGGAGAAGGGAGGGAGGATGG - Intergenic
1045366891 8:101484822-101484844 CTGGAAGAAGGAAGGGAGGAAGG - Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1045584762 8:103521135-103521157 TGGGGTGAAGGGAGGGGGGAGGG + Intronic
1045718315 8:105074893-105074915 CGGGAGGGAGGGAGGGAAGAAGG - Intronic
1045870105 8:106916882-106916904 ATGGAAGAAGGGAGGGAAGAAGG - Intergenic
1046057961 8:109100842-109100864 GTAGGTGAAGGGAAGGAAGATGG + Intronic
1046072029 8:109267267-109267289 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1046320186 8:112564314-112564336 AGGGGAGAAGGAAGGGAAGAAGG - Intronic
1046320189 8:112564326-112564348 AGGGGAGAAGGGAGGGGAGAAGG - Intronic
1046605349 8:116365535-116365557 AAGGAGGAAGGGAGGGAAGAAGG + Intergenic
1046681809 8:117178889-117178911 GTGGGGGAAGAGAGAGAAGAAGG + Intergenic
1046736470 8:117781469-117781491 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1046738598 8:117804684-117804706 GTGAGTGAAGCAAGGGAAGAGGG + Intronic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1046812288 8:118546085-118546107 CTGTGTGAAGGCAGGAATGATGG - Intronic
1046865364 8:119143449-119143471 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1046979605 8:120322537-120322559 GTGGGTGAAGGATGGGAGGAGGG - Intronic
1046994083 8:120496254-120496276 GTGAGTGATGGGAAGGAAGAGGG + Intronic
1047082250 8:121476011-121476033 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1047574485 8:126137768-126137790 CTGGGGGAAGAGAGTGAAGGGGG + Intergenic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1047734010 8:127750155-127750177 GAGGGAGAAGGGAGGGAGGAAGG - Intergenic
1047873069 8:129106446-129106468 CTGACTGAAGTGAGGGAACAAGG - Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048161084 8:132022718-132022740 TTGATTAAAGGGAGGGAAGAAGG + Intergenic
1048299738 8:133242650-133242672 CTGGCTGAAAGAAGGGATGATGG + Intronic
1048339053 8:133524989-133525011 CGTGGTGAATGGAGGGAGGAGGG + Intronic
1048374510 8:133811147-133811169 CCGGGGAAAGGGCGGGAAGAGGG + Intergenic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1048855745 8:138685293-138685315 CAGGGTGCAGCGGGGGAAGAAGG - Exonic
1048935931 8:139357067-139357089 CTAGTTGAAAGGAGGTAAGAGGG + Intergenic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049298661 8:141857183-141857205 CTGGATGATGGGTGAGAAGATGG + Intergenic
1049359808 8:142207109-142207131 ATGGGTGAATGGGGGAAAGATGG + Intergenic
1049475936 8:142797012-142797034 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
1049478842 8:142810475-142810497 AGGGGTGAAGGGAGGGAATAGGG - Intergenic
1049610741 8:143553634-143553656 CTGGGAGGAGGGAGGGAGGCCGG - Exonic
1049706948 8:144047418-144047440 CTGGGTGAGGGGCGGGGAGGGGG + Intergenic
1049908586 9:243659-243681 CAGGGGAAAGGTAGGGAAGAAGG - Intronic
1049912696 9:284941-284963 GTGGGTGAAGGGTGGTAAGAGGG + Intronic
1050753349 9:8967894-8967916 TGGGGTGGAGGGAGGGAGGAGGG - Intronic
1050756893 9:9015815-9015837 CTTGCTGAAGTCAGGGAAGATGG - Intronic
1050933716 9:11366426-11366448 CTGGGAGAAGGGAGGAAGAAGGG + Intergenic
1051002957 9:12307401-12307423 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1052119775 9:24698289-24698311 GAGAGTGAAGGGTGGGAAGAGGG + Intergenic
1052450279 9:28620826-28620848 GAGGGTGGAGGGTGGGAAGAGGG + Intronic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1052813699 9:33083550-33083572 TGGGGTGAGGGGAGGGGAGAGGG + Intergenic
1053107718 9:35426478-35426500 CTTGGTGAAGTGAGGCAAGCTGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054943832 9:70773107-70773129 ATGAGAGAAGGGAGAGAAGATGG + Intronic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055523449 9:77106033-77106055 CTGGAAGAAGTGAAGGAAGAGGG + Intergenic
1055619065 9:78104829-78104851 GAAGATGAAGGGAGGGAAGAAGG - Intergenic
1055696980 9:78895607-78895629 CCGCCTGAAGGGAGGGAAAAGGG + Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056032449 9:82567222-82567244 AGGGATGAAGGGAGGGAGGAGGG + Intergenic
1056150192 9:83778543-83778565 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1056499883 9:87198357-87198379 GGGGGAGAAGGGAGAGAAGAGGG - Intergenic
1056514101 9:87333706-87333728 CTGGGTGAAGGAGGGGAGCATGG - Intergenic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056591377 9:87968445-87968467 CTGAGTGCAGGGAGGGGACAGGG + Intronic
1056863396 9:90207859-90207881 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1056939843 9:90945816-90945838 TTGGGTGGAGGGATGGAAGGAGG - Intergenic
1057133951 9:92673483-92673505 ATAGAGGAAGGGAGGGAAGAAGG + Intergenic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1057230471 9:93318657-93318679 CATGGAGAAGGGAGGGAAGTGGG - Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057293973 9:93824804-93824826 CTGGGGGAAGGGAGGGCACTCGG - Intergenic
1057380685 9:94564660-94564682 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1057432844 9:95010718-95010740 AGGGATGAAGGGAGGGAAAACGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057846757 9:98531843-98531865 ATGGGTGAAGGGTGGGGAGTGGG - Intronic
1058073556 9:100626970-100626992 CTGGGTACAGGGTAGGAAGAGGG - Intergenic
1058108058 9:100997456-100997478 AAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059251747 9:112892210-112892232 CTAGGTGAGGGGGAGGAAGAAGG - Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059354243 9:113687113-113687135 GGTGGGGAAGGGAGGGAAGAGGG + Intergenic
1059363428 9:113766276-113766298 AAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1059700987 9:116775476-116775498 GGGGAAGAAGGGAGGGAAGAAGG + Intronic
1059803493 9:117774020-117774042 AGGGGAGAAGGGAGGGAGGAAGG - Intergenic
1059803498 9:117774032-117774054 AGGGGAGAAGGGAGGGGAGAAGG - Intergenic
1059896416 9:118871127-118871149 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1059994085 9:119892547-119892569 TGGGGGGAAGGGAGGAAAGAAGG + Intergenic
1060198362 9:121637567-121637589 TTGGAGGAAGGGAGGGGAGAGGG + Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1061065846 9:128276856-128276878 CTGGGAGAAGATATGGAAGAGGG - Intronic
1061244707 9:129395492-129395514 ATGGGTGAATGAATGGAAGATGG + Intergenic
1061244737 9:129395653-129395675 ATGGGAGAAAGGATGGAAGATGG + Intergenic
1061244927 9:129396664-129396686 ATGGGTGGAAGGATGGAAGATGG + Intergenic
1061256519 9:129456734-129456756 GTGGGTGAATGGAGGGTGGATGG + Intergenic
1061483410 9:130908489-130908511 GTGGGTGGAAGGAGGGGAGATGG - Intronic
1061517250 9:131096960-131096982 CCAGGGGAAGGGAAGGAAGAGGG - Intronic
1061800629 9:133111826-133111848 CTGGGAGAAGGCATGGAGGATGG + Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062059496 9:134487367-134487389 CAGGGAGAAGGGGGGCAAGAGGG - Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062193083 9:135257605-135257627 CTGGGTGCAGGCAAGGAACATGG + Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062305752 9:135906667-135906689 CTGGGCGCAGGGAGGGACCATGG - Intronic
1062577635 9:137215989-137216011 CCGGGAGAAGGCAGGGATGAGGG - Exonic
1203441330 Un_GL000219v1:11302-11324 CTGGGTGAAGCCATAGAAGAGGG - Intergenic
1203358693 Un_KI270442v1:191237-191259 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
1203512139 Un_KI270741v1:130210-130232 CTGGGTGAAGCCATAGAAGAGGG - Intergenic
1185495289 X:549972-549994 GTGGGTGGATGGATGGAAGAAGG - Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185592516 X:1286935-1286957 CGGGGAGAGGGGAGGGAAGGAGG + Intronic
1185695770 X:2193308-2193330 ATGGGTGAAGGAAGGAAGGAGGG - Intergenic
1185700463 X:2227549-2227571 AAGGGAGAAAGGAGGGAAGAAGG + Intronic
1185737849 X:2506692-2506714 CTGGCTGGAGGGAGGAGAGAAGG - Intergenic
1185848563 X:3464098-3464120 GTGGGTGAAGAGTGGGAGGAGGG - Intergenic
1185930552 X:4198386-4198408 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186147293 X:6637629-6637651 CTAGGGGAAGGGTGGGATGAAGG - Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186469343 X:9809040-9809062 TTGGGGGAAGGGAGGGAAAGGGG - Intronic
1186486058 X:9935238-9935260 GGGGGTGAAGGGAGTGCAGAGGG + Intronic
1186572840 X:10734387-10734409 GAGGGGGAAGGGTGGGAAGAGGG + Intronic
1186598052 X:11006147-11006169 GTGGATGAGAGGAGGGAAGAAGG - Intergenic
1186749245 X:12604806-12604828 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1187172938 X:16869793-16869815 CTGGAGGAGGGAAGGGAAGAGGG + Exonic
1187197905 X:17105743-17105765 GTGGGTGAAAGGAGGGAATAGGG - Intronic
1187323911 X:18268617-18268639 CTCGGTGGGGGGAGGGAGGAGGG + Intronic
1187393071 X:18898205-18898227 TTTGCTGAAGTGAGGGAAGAGGG + Intronic
1187464735 X:19516748-19516770 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
1187556236 X:20354805-20354827 GTGGGTGAAGTGAGGAAGGAGGG + Intergenic
1187570499 X:20496162-20496184 AGGGGTGAAGAGAGGGAAGTGGG - Intergenic
1187595172 X:20763283-20763305 CAAGGTGGAGGGAGGGAGGAGGG - Intergenic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1187653672 X:21442997-21443019 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1187678633 X:21743537-21743559 TTGGCTGAAGGGAAGGGAGAAGG + Intronic
1187712050 X:22064290-22064312 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
1187771816 X:22706874-22706896 AAGAGAGAAGGGAGGGAAGATGG + Intergenic
1188134449 X:26477324-26477346 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1188221882 X:27550673-27550695 AGGGGAGAGGGGAGGGAAGATGG - Intergenic
1188259144 X:28001907-28001929 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1188553514 X:31386226-31386248 TGGGGTGAGGGGAGGGAGGAGGG + Intronic
1188738262 X:33744561-33744583 CAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1189190622 X:39099901-39099923 GAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1189317223 X:40064600-40064622 CTGGGGGAGGGGAGACAAGAGGG + Intronic
1189446372 X:41085212-41085234 CGGGGTGGAGGGAGAGAAGAGGG + Intergenic
1189525409 X:41814591-41814613 TTGGGTGGAGGGAGGGGGGAGGG + Intronic
1189602534 X:42642484-42642506 CTGGGACAAGGGACAGAAGATGG + Intergenic
1189733455 X:44045878-44045900 CGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1189960246 X:46317635-46317657 GTGGGTCATGGGAGGAAAGATGG - Intergenic
1190109047 X:47578194-47578216 TTGGGTGAGGGGAGGGAACCTGG - Intronic
1190203200 X:48381503-48381525 ATGGGAGAAGGGAAGGGAGAAGG - Intergenic
1190207336 X:48413901-48413923 ATGGGAGAAGGGAAGGGAGAAGG + Intergenic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1190880651 X:54490182-54490204 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1190902745 X:54694491-54694513 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1191137505 X:57082079-57082101 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1191745894 X:64486053-64486075 TGGGGTGAGGGGAGGGAAGAGGG + Intergenic
1191817324 X:65260415-65260437 GAGGGTGTAGGGTGGGAAGAAGG + Intergenic
1191822097 X:65321890-65321912 AGGGGTGTAGGGAGGGAGGAAGG + Intergenic
1192200985 X:69066577-69066599 CTGGTTGAAGGGAGAGTAGGAGG + Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192488036 X:71547802-71547824 TTGGGGGGAGGGGGGGAAGAAGG - Intronic
1192831844 X:74758551-74758573 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1192888989 X:75367896-75367918 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1193304831 X:79936231-79936253 TTTGGGGAAGGGAGGGAAAAGGG - Intergenic
1193336033 X:80290558-80290580 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1193408485 X:81133708-81133730 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1193515463 X:82456448-82456470 GAGGGTGAAGGGTGGGAAGTGGG + Intergenic
1193522005 X:82541807-82541829 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1193696616 X:84714946-84714968 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1193767419 X:85547173-85547195 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1194277718 X:91907774-91907796 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
1194614115 X:96080054-96080076 CGGGGTGGGGGGAGGGGAGAGGG + Intergenic
1194651601 X:96521750-96521772 AGGAGTGAAGGGAGGAAAGAAGG + Intergenic
1194817940 X:98468012-98468034 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195377310 X:104240318-104240340 CTGGGTGAAAGGGGAGAAAATGG + Intergenic
1195501956 X:105612602-105612624 CTGGAAGAAGGCAGGAAAGACGG + Intronic
1195505624 X:105653498-105653520 AAGGAGGAAGGGAGGGAAGAAGG - Intronic
1195637934 X:107139178-107139200 TTGGTAGAAGGGAGGGAAGGTGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196210098 X:112986421-112986443 GGAGGGGAAGGGAGGGAAGAGGG + Intergenic
1196237554 X:113299998-113300020 AGGGGAGAAGGGAGGGGAGACGG - Intergenic
1196237559 X:113300010-113300032 AAGGGAGAAGGGAGGGGAGAAGG - Intergenic
1196338206 X:114564228-114564250 CAGGGTGGAGGGTGGGATGAGGG + Intergenic
1196494606 X:116309754-116309776 AAGGGTGGAGGGAGGGAGGATGG - Intergenic
1196672655 X:118385503-118385525 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1196982029 X:121225112-121225134 GTGGGTGAAGGGAGAGAATCAGG - Intergenic
1197027271 X:121768577-121768599 GAGGCTGAAGGGAGGGAAGAGGG + Intergenic
1197087053 X:122491107-122491129 CAGGGAGAAGGGTGGGAAGTGGG - Intergenic
1197456494 X:126682812-126682834 CGGGGTGAAGGGAAGGAACTTGG - Intergenic
1197505656 X:127300414-127300436 GAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1197640655 X:128964262-128964284 AGGAGTGAGGGGAGGGAAGAGGG + Intergenic
1197720090 X:129739171-129739193 CTGGGTGGATGGAGGGACAAGGG - Exonic
1198033682 X:132780322-132780344 CAGGATGAAGGGAGGCATGAGGG - Intronic
1198160560 X:134003703-134003725 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1198670495 X:139075200-139075222 CTGGGTAATGGGAGAGAATAGGG - Intronic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1199215946 X:145260502-145260524 GTGTGAGAAGGGAGGCAAGAGGG + Intergenic
1199298662 X:146187363-146187385 TGGGGTGGAGGGAGGGAAGGGGG - Intergenic
1199433766 X:147789687-147789709 CTGAGAGAAGGGAGGGGAGTGGG - Intergenic
1199536873 X:148912460-148912482 CAGGGTGGAGGGTGGGAAGAGGG + Intronic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1199791376 X:151158439-151158461 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1200354873 X:155538119-155538141 GTGATTGAGGGGAGGGAAGATGG - Intronic
1200595061 Y:5129842-5129864 GAGGGTGGAGGGTGGGAAGAGGG - Intronic
1200815080 Y:7522722-7522744 GTGGGTGAAGAGTGGGAGGAGGG + Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic
1201256492 Y:12112848-12112870 ACGGATGAAGGGAGGGAAGAAGG - Intergenic
1201421713 Y:13806629-13806651 GAGGGAGAAGGGAGGGAAAATGG - Intergenic
1201691760 Y:16774963-16774985 ATGGGTGTAGGGAGGGAGGGAGG - Intergenic