ID: 1161613709

View in Genome Browser
Species Human (GRCh38)
Location 19:5257938-5257960
Sequence CGGAGGCGGTGAGCCCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161613690_1161613709 29 Left 1161613690 19:5257886-5257908 CCGCGACCGGGGAGGGGCCTTCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1161613709 19:5257938-5257960 CGGAGGCGGTGAGCCCGAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 160
1161613695_1161613709 12 Left 1161613695 19:5257903-5257925 CCTTCCTGCTTGGGTGTGCAGGG 0: 1
1: 0
2: 3
3: 20
4: 243
Right 1161613709 19:5257938-5257960 CGGAGGCGGTGAGCCCGAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 160
1161613698_1161613709 8 Left 1161613698 19:5257907-5257929 CCTGCTTGGGTGTGCAGGGGACG 0: 1
1: 0
2: 1
3: 19
4: 141
Right 1161613709 19:5257938-5257960 CGGAGGCGGTGAGCCCGAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 160
1161613691_1161613709 23 Left 1161613691 19:5257892-5257914 CCGGGGAGGGGCCTTCCTGCTTG 0: 1
1: 0
2: 0
3: 25
4: 258
Right 1161613709 19:5257938-5257960 CGGAGGCGGTGAGCCCGAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161613709 Original CRISPR CGGAGGCGGTGAGCCCGAGG AGG Intronic