ID: 1161613735

View in Genome Browser
Species Human (GRCh38)
Location 19:5258016-5258038
Sequence CCTCGCACGTAGAGGTTGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161613728_1161613735 4 Left 1161613728 19:5257989-5258011 CCTTTGACCTGGACGCGGCGTTC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1161613735 19:5258016-5258038 CCTCGCACGTAGAGGTTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 30
1161613727_1161613735 8 Left 1161613727 19:5257985-5258007 CCTGCCTTTGACCTGGACGCGGC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1161613735 19:5258016-5258038 CCTCGCACGTAGAGGTTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 30
1161613725_1161613735 9 Left 1161613725 19:5257984-5258006 CCCTGCCTTTGACCTGGACGCGG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1161613735 19:5258016-5258038 CCTCGCACGTAGAGGTTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 30
1161613729_1161613735 -3 Left 1161613729 19:5257996-5258018 CCTGGACGCGGCGTTCCCTACCT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1161613735 19:5258016-5258038 CCTCGCACGTAGAGGTTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161613735 Original CRISPR CCTCGCACGTAGAGGTTGGC AGG Exonic
901741992 1:11347795-11347817 CCTGGGACGTAGAGGTTGCAGGG - Intergenic
902214020 1:14923673-14923695 CCCCTCACTTAGAGGATGGCCGG + Intronic
906149421 1:43578899-43578921 CCTCGCACATACAGGTTCGCAGG - Exonic
907175026 1:52512526-52512548 CCTTGCACGAAGTGGTTGGTTGG - Intronic
912362357 1:109105379-109105401 CCTGGCACATAAAGGTTTGCTGG + Intergenic
920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG + Intronic
1067842479 10:49691900-49691922 CCTCACAGGTGGAGGTTGGGGGG + Intronic
1069845977 10:71371832-71371854 CATCGCCCTTGGAGGTTGGCAGG + Intergenic
1077362277 11:2145983-2146005 CCTCCCACCCAGAGCTTGGCCGG + Intronic
1077463740 11:2723640-2723662 CCTCACACCTAGCGGTTGGCTGG + Intronic
1085318267 11:75559120-75559142 CCTGGCACGTGGAGGCTGGCTGG - Intergenic
1088967338 11:114736986-114737008 GCTAGCACTCAGAGGTTGGCAGG - Intergenic
1104026727 12:125032933-125032955 CCTCGGACCTAGAGGGTGCCGGG + Intergenic
1127980350 15:64030358-64030380 CCTTGCACCTAGATGTTGACAGG + Intronic
1141349176 16:83276896-83276918 CATCTTACGTAGATGTTGGCAGG + Intronic
1142347509 16:89563358-89563380 CCCAGCACTTTGAGGTTGGCTGG + Exonic
1155888194 18:31233977-31233999 CCTAGCACGTTCAGGTGGGCTGG - Intergenic
1161613735 19:5258016-5258038 CCTCGCACGTAGAGGTTGGCAGG + Exonic
1167471246 19:49677537-49677559 CCTCCCACGTGGAGGAGGGCTGG + Intronic
928964992 2:36966852-36966874 CCTCGCACGCGGAAGTTCGCGGG + Intergenic
938202014 2:129379871-129379893 CCTCACCTGTAGATGTTGGCTGG - Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
954176942 3:48852220-48852242 CCTGGCATGTAGAGGTGGTCAGG - Intergenic
983128419 4:163983532-163983554 CCCCCCACTTAGAGGTTAGCAGG + Intronic
1006203140 6:32314868-32314890 TCTTGCATGAAGAGGTTGGCTGG + Intronic
1006203862 6:32321908-32321930 TCTTGCATGAAGAGGTTGGCTGG + Intronic
1035305902 7:157931151-157931173 CCACGCACGGATAGGGTGGCTGG + Intronic
1035389503 7:158496118-158496140 CCTCTCATGTGGAGGTGGGCTGG - Intronic
1037806337 8:22059744-22059766 CCAAGCAGGTAGTGGTTGGCTGG + Intronic
1050472634 9:6008266-6008288 CCCCGCAGGTAGAGGGGGGCGGG - Intergenic
1050855816 9:10353512-10353534 TCTCCCATGCAGAGGTTGGCAGG - Intronic
1203780596 EBV:98543-98565 GCTCGCACGCAGACATTGGCTGG + Intergenic
1190267286 X:48835155-48835177 CCGGGCACGGAGAGGTGGGCAGG + Intronic
1197781571 X:130165514-130165536 CCTCGGACTTGGAGGTTGCCTGG + Intronic
1199264849 X:145818099-145818121 CCTCGCAAGGAGAGGTGGCCGGG - Intronic