ID: 1161613737

View in Genome Browser
Species Human (GRCh38)
Location 19:5258036-5258058
Sequence AGGTGAGGAGTAGCGCACGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161613731_1161613737 2 Left 1161613731 19:5258011-5258033 CCCTACCTCGCACGTAGAGGTTG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1161613737 19:5258036-5258058 AGGTGAGGAGTAGCGCACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 67
1161613734_1161613737 -3 Left 1161613734 19:5258016-5258038 CCTCGCACGTAGAGGTTGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1161613737 19:5258036-5258058 AGGTGAGGAGTAGCGCACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 67
1161613728_1161613737 24 Left 1161613728 19:5257989-5258011 CCTTTGACCTGGACGCGGCGTTC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1161613737 19:5258036-5258058 AGGTGAGGAGTAGCGCACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 67
1161613725_1161613737 29 Left 1161613725 19:5257984-5258006 CCCTGCCTTTGACCTGGACGCGG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1161613737 19:5258036-5258058 AGGTGAGGAGTAGCGCACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 67
1161613732_1161613737 1 Left 1161613732 19:5258012-5258034 CCTACCTCGCACGTAGAGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1161613737 19:5258036-5258058 AGGTGAGGAGTAGCGCACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 67
1161613729_1161613737 17 Left 1161613729 19:5257996-5258018 CCTGGACGCGGCGTTCCCTACCT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1161613737 19:5258036-5258058 AGGTGAGGAGTAGCGCACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 67
1161613727_1161613737 28 Left 1161613727 19:5257985-5258007 CCTGCCTTTGACCTGGACGCGGC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1161613737 19:5258036-5258058 AGGTGAGGAGTAGCGCACGCCGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161613737 Original CRISPR AGGTGAGGAGTAGCGCACGC CGG Exonic
901241131 1:7694148-7694170 GGGTGAGGAGTAGGGGAAGCAGG - Intronic
904099562 1:28012962-28012984 AGGTGAGGAGTATTGGAAGCAGG - Intronic
906104216 1:43282377-43282399 AGGAGAAGAGTAGCGTAGGCAGG + Exonic
906197827 1:43939957-43939979 ATGTGAGGAGCAGAGCAGGCTGG - Intergenic
910497401 1:87847060-87847082 AGCTGAGGAGTAAGGCAAGCCGG - Intergenic
924583881 1:245345156-245345178 AAGTGAGGAGATGCTCACGCTGG + Intronic
1063300166 10:4843816-4843838 AGGAGAGGAGAAGGGCATGCGGG - Intronic
1069828148 10:71266668-71266690 AGGTGAGGTGTGGGGCTCGCCGG + Intronic
1070930274 10:80256110-80256132 TGGAGAGGAGTAGAGAACGCAGG + Intergenic
1071435282 10:85643249-85643271 AGGTGAGGAGAAGCCCACCGAGG - Intronic
1075048673 10:119165849-119165871 AGGTGCGGAGCAGGGCAAGCAGG - Intergenic
1076871914 10:133198638-133198660 AGGTGAGGAGAAGCTCTCCCTGG + Exonic
1076876818 10:133220239-133220261 AGGTGAGGAGGGGCTCAGGCGGG + Intronic
1076876838 10:133220303-133220325 AGGTGAGGAGGGGCTCAGGCGGG + Intronic
1076876866 10:133220399-133220421 AGGTGAGGAGGTGCTCAGGCGGG + Intronic
1076876906 10:133220527-133220549 AGGTGAGGAGGGGCTCAGGCGGG + Intronic
1076876916 10:133220559-133220581 AGGTGAGGAGGGGCTCAGGCGGG + Intronic
1076876936 10:133220623-133220645 AGGTGAGGAGGGGCTCAGGCGGG + Intronic
1076876956 10:133220687-133220709 AGGTGAGGAGGGGCTCAGGCGGG + Intronic
1077099472 11:815735-815757 AGGTGAGGAGTGGAGGAGGCCGG + Intergenic
1081915957 11:46730417-46730439 AGGGGAGGAGCACCGCAGGCTGG + Intronic
1083777384 11:64900863-64900885 AGGTGAGGAGGAGCGGGTGCAGG - Exonic
1092498512 12:9022734-9022756 AGTTGAGGAGTGGCACACGTAGG - Intergenic
1095383070 12:41617543-41617565 AGGTGAGCAGTACCACATGCTGG + Intergenic
1108472883 13:50785132-50785154 AGCTGAGGAGTAACTTACGCAGG + Intronic
1114647036 14:24261587-24261609 AGGTGAGGAGTGGGGCAGGGAGG + Intronic
1114665764 14:24376425-24376447 AGGTAAGGAGTTTCGCAAGCAGG - Exonic
1115029213 14:28774490-28774512 AGGAGAGGAGAAGCGCTCTCGGG + Intronic
1117699217 14:58396320-58396342 GGCTGAGGAGCAGGGCACGCAGG + Exonic
1122691225 14:103532989-103533011 AGGTGAGGAGTGGGTCAGGCTGG + Intronic
1123770054 15:23519897-23519919 ACGTGAGGAGTAGGGTACACAGG + Intergenic
1124725477 15:32152565-32152587 AAGGGAGGAGCAGGGCACGCAGG + Intronic
1128554755 15:68623734-68623756 GGGTGAGGATTACCGCATGCTGG + Intronic
1129679376 15:77649588-77649610 AGCTGAGGGGTAGGGCACTCTGG + Intronic
1132897310 16:2235142-2235164 AGGTGAGGGGTAGGGCAGGCGGG + Exonic
1139459495 16:67110327-67110349 AGGTGAGGAGCTGCGGGCGCAGG - Intronic
1141538398 16:84699713-84699735 AGGTGAGGAGCCGGGCCCGCCGG + Intergenic
1142693501 17:1620943-1620965 AGGTGAGGAGCAGAGCAGCCTGG - Intronic
1142716043 17:1747508-1747530 AGAGGAGGAGGAGCGCACCCTGG - Exonic
1143626078 17:8110759-8110781 AGGTGAGGAGGAGAGGACGCTGG - Intronic
1149868801 17:60165128-60165150 AGGTGGGGAGTAGGGAACACTGG + Intronic
1151417697 17:73977283-73977305 AGGTGAGGAGGAGAGCCAGCTGG + Intergenic
1152718993 17:81913578-81913600 AGGGCAGGAGTGGCACACGCAGG + Intronic
1157203546 18:45679539-45679561 AGGTCAGGAGGAGCCCATGCTGG + Intronic
1161613737 19:5258036-5258058 AGGTGAGGAGTAGCGCACGCCGG + Exonic
1161792477 19:6368629-6368651 CGGTGAGGATGAGCCCACGCTGG + Exonic
1163630119 19:18414069-18414091 AGGTGAGGAGTAGCAGAAGCTGG + Intergenic
925900659 2:8507178-8507200 AGGTGAAGGGTAGCGAAGGCAGG - Intergenic
932298093 2:70643278-70643300 AGGTGAGGAGTAGGTGAGGCGGG + Intronic
947750809 2:232530965-232530987 AAGCGGGGAGTAACGCACGCAGG + Intronic
947751647 2:232535662-232535684 AGGTGTGGGGTAGAGCAGGCAGG + Exonic
1175237919 20:57526144-57526166 AGGAGAGGAGGAGGGCCCGCAGG + Intergenic
1176058174 20:63160047-63160069 AGGTGAGGAGCGGAGCAGGCTGG - Intergenic
1179883679 21:44304399-44304421 AGGGCAGGAGCAGCGCACCCAGG - Intronic
949982257 3:9509080-9509102 AGGGGAGGAGGACCGCCCGCAGG - Intronic
954673875 3:52305057-52305079 AGGTGAGGACTAGCACAGGAGGG + Intergenic
961057268 3:123799738-123799760 AGCCGAGGAGCAGCGCACTCCGG - Intronic
968517197 4:1020405-1020427 ACGTGGGGAGTGGGGCACGCAGG + Intronic
968728236 4:2258160-2258182 AGGTGAGCAGTTGCCCACCCAGG + Intronic
968810003 4:2795538-2795560 GGGTGAGGAGAAGGGCAGGCTGG + Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
991548223 5:67807273-67807295 AGGTGAGGACTAGCACAGACTGG + Intergenic
991918726 5:71632038-71632060 AGGTGAGGAGTTGTGCATGTTGG + Intronic
1001277082 5:170358916-170358938 AGGTGGGGAGTAGTGCAGGCAGG - Intronic
1001539417 5:172526895-172526917 AGGTGAGCAGTAGGGCAGGTGGG + Intergenic
1005220260 6:23578642-23578664 AGGAGAGGAGTAAGCCACGCTGG + Intergenic
1015241071 6:131024204-131024226 AGGTGAGGAGAAGAGAAAGCAGG + Intronic
1020141752 7:5615529-5615551 AGGTGAGCAGCCGGGCACGCAGG + Intergenic
1025020073 7:55473602-55473624 AGCTGAGGAGCAGGGCACGGGGG + Intronic
1032076377 7:128838084-128838106 ATGTGAAGAGCAGCGCAGGCAGG - Intronic
1034512366 7:151546509-151546531 AGGTGAAGAGGAGCACAGGCGGG + Intergenic
1037885451 8:22593864-22593886 AGGTGCGGAGTAGCGCTGGCGGG - Exonic
1041673625 8:60516888-60516910 AGGGGAGGAGCCCCGCACGCTGG - Exonic