ID: 1161614088

View in Genome Browser
Species Human (GRCh38)
Location 19:5260512-5260534
Sequence TGGGGCTCCCAGCACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 394}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161614076_1161614088 16 Left 1161614076 19:5260473-5260495 CCCGGCCTGCATGCTCATTTTAG 0: 1
1: 0
2: 1
3: 34
4: 390
Right 1161614088 19:5260512-5260534 TGGGGCTCCCAGCACTCTGGGGG 0: 1
1: 0
2: 2
3: 38
4: 394
1161614074_1161614088 24 Left 1161614074 19:5260465-5260487 CCACCGCGCCCGGCCTGCATGCT 0: 2
1: 22
2: 276
3: 1723
4: 8001
Right 1161614088 19:5260512-5260534 TGGGGCTCCCAGCACTCTGGGGG 0: 1
1: 0
2: 2
3: 38
4: 394
1161614077_1161614088 15 Left 1161614077 19:5260474-5260496 CCGGCCTGCATGCTCATTTTAGA 0: 1
1: 0
2: 4
3: 33
4: 315
Right 1161614088 19:5260512-5260534 TGGGGCTCCCAGCACTCTGGGGG 0: 1
1: 0
2: 2
3: 38
4: 394
1161614079_1161614088 11 Left 1161614079 19:5260478-5260500 CCTGCATGCTCATTTTAGAGGTG 0: 1
1: 0
2: 1
3: 26
4: 234
Right 1161614088 19:5260512-5260534 TGGGGCTCCCAGCACTCTGGGGG 0: 1
1: 0
2: 2
3: 38
4: 394
1161614075_1161614088 21 Left 1161614075 19:5260468-5260490 CCGCGCCCGGCCTGCATGCTCAT 0: 1
1: 0
2: 22
3: 180
4: 1097
Right 1161614088 19:5260512-5260534 TGGGGCTCCCAGCACTCTGGGGG 0: 1
1: 0
2: 2
3: 38
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161614088 Original CRISPR TGGGGCTCCCAGCACTCTGG GGG Intronic
900095061 1:936846-936868 TGGGGCTCCCTCCGCTCTGCTGG - Intronic
900144069 1:1150444-1150466 TGGGGCTCCCAGTCTTCTGCTGG - Intergenic
900203305 1:1420724-1420746 TGGGGGTCCCAGCACTGGGTGGG - Intronic
900422832 1:2562985-2563007 GGGGGCTCCCAGTTCTCTGAGGG + Intronic
900528521 1:3141067-3141089 CTTGGCTCCCAGAACTCTGGGGG + Intronic
900961724 1:5926697-5926719 TGGTGCTTCCATCACTCAGGAGG - Intronic
901220001 1:7578344-7578366 TGGTGCTCCCGGCTCCCTGGAGG - Intronic
901788183 1:11638402-11638424 AGGGACCCCCAGCACTCTGCAGG - Intergenic
901977621 1:13007698-13007720 TGGGACTGGCAGCACTCTTGTGG + Intronic
902004464 1:13221237-13221259 TGGGACTGGCAGCACTCTTGTGG - Intergenic
902023684 1:13366967-13366989 TGGGACTGGCAGCACTCTTGAGG - Intergenic
902331121 1:15731712-15731734 TGGGGCTCCCAGACCTCTCCTGG + Intronic
902956314 1:19926248-19926270 CAGGGCTCCCAGCACTTTGATGG + Intergenic
903445931 1:23423178-23423200 AGAAGCTCCCAGCACTCTGCAGG + Intronic
904120704 1:28195958-28195980 TGGGGCTGCCATTCCTCTGGTGG - Intergenic
904496373 1:30889046-30889068 TGTGTCTCCCAGGCCTCTGGAGG - Intronic
904498541 1:30901166-30901188 TGAGCCTCCCACCACTCTTGAGG - Intronic
904857985 1:33514497-33514519 TGGGGCACCCAGCACTCTGCTGG - Exonic
905290899 1:36921060-36921082 TGGCCCTCCCAGCCCTCTGGAGG - Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
905927918 1:41765128-41765150 GGGGGCTCCCAGAAATTTGGTGG + Intronic
906302659 1:44694755-44694777 TTGGGATCCCAGCACTGAGGAGG - Intronic
906625235 1:47319687-47319709 TGGGAATCCGAGCACTTTGGAGG - Intergenic
906737247 1:48142240-48142262 TGGGGCTCACATCTCTCAGGGGG + Intergenic
907139798 1:52176484-52176506 TGGTTCTCCCAGCACACAGGTGG - Intronic
907297879 1:53467061-53467083 TGGTGCCCCCAGCAACCTGGAGG - Exonic
908417024 1:63923199-63923221 GGGGGAACCCAGCACTCTGTGGG - Intronic
908538299 1:65099146-65099168 TGGTAATCCCAGCACTTTGGAGG - Intergenic
908765358 1:67549708-67549730 TGGGTCTCCCAGCACGCAGCTGG - Intergenic
909027100 1:70494658-70494680 AGGAGCTCCCAGCTCTCTGAAGG - Intergenic
911583825 1:99667358-99667380 TGGGGCTGCCAGGAGTATGGGGG + Intronic
912270021 1:108199819-108199841 TGTGGCGCCCAGCGCTCCGGTGG - Intronic
913364393 1:118020159-118020181 AGTGGCTTCCAGCACTCTGGGGG + Intronic
914986647 1:152462969-152462991 TGGCTCTGCCAGCACTTTGGTGG - Intergenic
915097537 1:153473986-153474008 TGGATCTCACAGCATTCTGGAGG - Intergenic
915673157 1:157507175-157507197 TATGGCTCACAGAACTCTGGAGG - Intergenic
915840798 1:159211470-159211492 TTTGTCTCCCAGAACTCTGGGGG - Intergenic
916123929 1:161552507-161552529 TGGGTCTCACAGGAATCTGGAGG + Intergenic
916905538 1:169279180-169279202 TGGTTCTCCCAGCACCCAGGGGG - Intronic
917097689 1:171415788-171415810 TGGTAATCCCAGCACTTTGGAGG + Intergenic
917259768 1:173154364-173154386 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
918785449 1:188757601-188757623 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
920176401 1:204104532-204104554 TGAGGTTCTCAGCTCTCTGGGGG + Intronic
920416829 1:205804521-205804543 TGGGGCTGCCTTCTCTCTGGGGG - Intronic
920501779 1:206490216-206490238 TGGGGCTGCCGCCACCCTGGAGG + Intronic
920986443 1:210894805-210894827 TGGGCTTCCCAGCTTTCTGGAGG + Intronic
922974043 1:229768914-229768936 TGGGGATCCCAGACCTCAGGGGG - Intergenic
923975793 1:239260881-239260903 TGGTAATCCCAGCACTTTGGGGG - Intergenic
923980716 1:239319902-239319924 TGGGGCTGCCAGCAGCCTGAGGG - Intergenic
1063167725 10:3479089-3479111 TGGAGCTGCCAGCACTCAGTGGG - Intergenic
1063480808 10:6375008-6375030 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
1065725508 10:28664679-28664701 TGGTAATCCCAGCATTCTGGGGG + Intergenic
1065916829 10:30359890-30359912 TGGGGCAGCTGGCACTCTGGAGG + Intronic
1066153695 10:32651720-32651742 TGGGGCTGACACCTCTCTGGCGG + Intronic
1066367454 10:34791325-34791347 TGCGGCTGCCAGCAGTGTGGTGG - Intronic
1069950207 10:72013439-72013461 TGGGGCTGCCAGCTCTCTGAAGG - Exonic
1070534062 10:77362126-77362148 CGAGGCTCCCAGCAGGCTGGAGG + Intronic
1071434659 10:85635846-85635868 TGGTGCTCCAAGCAGTGTGGGGG + Intronic
1071952544 10:90721574-90721596 TTGTAATCCCAGCACTCTGGTGG - Intergenic
1072261429 10:93678571-93678593 TGGTAATCCCAGCACTTTGGGGG + Intronic
1072346399 10:94511832-94511854 TGAGGCTGCCAGCTTTCTGGGGG + Intronic
1072443568 10:95478681-95478703 TGGGGGTCCCAGAACTGTGTTGG - Intronic
1073137876 10:101229759-101229781 TGGGGTTCCCACCACTCTTTCGG - Exonic
1073684401 10:105736353-105736375 TGGTTCTCCCAGCACACAGGTGG + Intergenic
1074712958 10:116192746-116192768 TGGGGTTTCCAGCACTGTGGAGG - Intronic
1076445742 10:130512654-130512676 TGGGCCACCCAGCAGTCTGTGGG + Intergenic
1076516978 10:131051420-131051442 AGGGGCTCCGAGGACTCTGGTGG + Intergenic
1077250734 11:1559544-1559566 TGGGGCTCCCAGCCAGCTGGAGG - Intronic
1077517014 11:3008145-3008167 TGGGGGTCCCAGCAGGCTGGGGG - Intronic
1077541560 11:3148994-3149016 TGGGGGTCCATGCTCTCTGGAGG - Intronic
1077938756 11:6817971-6817993 TGGGCATCCCTGCACTCTTGGGG + Intergenic
1078090591 11:8262430-8262452 TGGGGATCCCAGCCCCCTTGGGG - Intronic
1078159624 11:8829431-8829453 TGGGGCTCCCCGGAGACTGGCGG - Intronic
1081087636 11:38821751-38821773 TGGTTCTCCCAGCACACTGCTGG - Intergenic
1082629140 11:55520569-55520591 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
1082785361 11:57313555-57313577 TGGGGCTCCAAGACCTCAGGGGG + Exonic
1083233707 11:61338987-61339009 TGGGGCTTCCCACACTCCGGGGG - Intronic
1083634500 11:64113042-64113064 TGAGGCTTGCAGCACTCTGTGGG - Intronic
1085353476 11:75815534-75815556 CGCGGCTCGCAGCACTCGGGAGG + Intronic
1086523997 11:87703558-87703580 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
1087737719 11:101853123-101853145 TGGTTCTCCCAGCACGCAGGTGG + Intronic
1088844966 11:113657242-113657264 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
1089213231 11:116820291-116820313 GGGGGCTCACAGTACACTGGGGG - Intergenic
1089302334 11:117506090-117506112 TGCAGCTCACAGCTCTCTGGGGG + Intronic
1089634588 11:119804135-119804157 TTGGGCACACAGCACTGTGGTGG - Intergenic
1089984521 11:122800728-122800750 TTGTGGTCCCAGCACTCAGGAGG - Intronic
1091761411 12:3089651-3089673 CTGTACTCCCAGCACTCTGGGGG + Intronic
1092776232 12:11947094-11947116 TGGGGCCCACTGCACTATGGGGG + Intergenic
1093519906 12:20036719-20036741 TGTGGGTCCCAGCTCTGTGGTGG + Intergenic
1093629877 12:21395647-21395669 TGGGTCTCCCAGCACGCAGCTGG + Intronic
1095151054 12:38797195-38797217 TGGTTCTCCCAGCACTCAGCTGG + Intronic
1095178236 12:39117764-39117786 TGGGCCTGCCAGCACTTGGGAGG - Intergenic
1095274261 12:40261041-40261063 TGGGCCCCCCAGTCCTCTGGTGG + Intronic
1095657434 12:44686782-44686804 TGGCGCTCCCAGCACGCAGCTGG - Intronic
1096498497 12:52051904-52051926 TGGGGGTCACAGCACCGTGGGGG + Intronic
1097133387 12:56830995-56831017 TGGGACTCCTAGCACTTGGGAGG + Intergenic
1097614979 12:61872830-61872852 TGGGTCTCTCTGGACTCTGGAGG - Intronic
1101571524 12:105958203-105958225 AGTGGCTGCCAGCACTTTGGAGG - Intergenic
1101687260 12:107037273-107037295 TGGTAATCCCAGCACTTTGGGGG + Intronic
1102463658 12:113115479-113115501 TTGGGCTCCCAACTGTCTGGAGG + Intronic
1103597890 12:122035200-122035222 TGGAGCCCCCAGGCCTCTGGAGG - Intronic
1103823360 12:123716322-123716344 TTGTAATCCCAGCACTCTGGGGG - Intronic
1103826219 12:123741172-123741194 TGGTAATCCCAGCACTCTGGAGG + Intronic
1104882347 12:132081292-132081314 TGGTGCTCCCTGGCCTCTGGGGG + Intergenic
1104949284 12:132431769-132431791 TGGGGCTGCCCACACGCTGGGGG - Intergenic
1105514536 13:21077707-21077729 CTGGGATCCCAGCACTCAGGAGG - Intergenic
1105638485 13:22239349-22239371 TGGGGCTCACAGGACTGTGGTGG + Intergenic
1106613251 13:31302951-31302973 TGGTTCTCCCAGCACTCAGCTGG + Intronic
1107433084 13:40356927-40356949 TGGGTCTCCCAGCACGCAGCTGG + Intergenic
1108387373 13:49912387-49912409 TTGTAATCCCAGCACTCTGGGGG + Intergenic
1108532511 13:51340990-51341012 TGGGGGTCCCAGTCCTCTGTGGG + Intronic
1110892291 13:80707218-80707240 TGGGGGTCCCAACAGCCTGGGGG - Intergenic
1111429943 13:88136720-88136742 TTGGGCTCCCAGCGCGCTCGGGG + Intergenic
1111778251 13:92690934-92690956 TGGTTCTCCCAGCACTCAGCTGG - Intronic
1111783025 13:92753112-92753134 TGGTTCTCCCAGCACTCAGCTGG + Intronic
1112331745 13:98482480-98482502 GGGGTGTCCCTGCACTCTGGAGG - Intronic
1116021611 14:39468770-39468792 AGGGGATCCCAGCACCCTGAAGG - Intergenic
1116854918 14:49943809-49943831 TGCTGCTCCCAGTACTCTGAAGG + Intergenic
1116900944 14:50362001-50362023 TGGGGGGCCCGGCACTCTAGCGG + Intronic
1117930780 14:60838737-60838759 TGGGCATCCCTGCACTCTCGGGG + Intronic
1119322919 14:73742217-73742239 AGGGGCTCGCAGCCCCCTGGAGG - Intronic
1119673249 14:76535734-76535756 TGGGGCACCTATCACTCAGGGGG + Intergenic
1121449669 14:93999118-93999140 TGGGGCTCCCAGTGCCTTGGGGG - Intergenic
1122206708 14:100151214-100151236 TGGGGGTGCCAGCACTCAGTAGG + Intronic
1122288212 14:100665404-100665426 TGGGGCCCCCAGCACACAGCAGG - Intergenic
1122792752 14:104191276-104191298 TAGGGCTCCCTGCACAGTGGAGG + Intergenic
1124595562 15:31088960-31088982 TGGGGCTCCCAGCACTTTCTTGG + Intronic
1125210428 15:37208547-37208569 TAGGGATCCCAGCACTATGATGG - Intergenic
1125482465 15:40090038-40090060 ATGGGCTCACAGCACCCTGGAGG - Exonic
1126722046 15:51591582-51591604 TGGTTCTCCCAGCACTCAGCTGG + Intronic
1127581632 15:60343917-60343939 TGCTGCTCCCAGGACTCTGGTGG - Intergenic
1127774994 15:62257531-62257553 TGGGGCTCCCACCACCCCTGGGG + Intergenic
1130175084 15:81559776-81559798 TGGTGCTCCCAGGACTGTGCAGG + Intergenic
1130258838 15:82338661-82338683 TGGGGCAGCCGGCACTCTGGAGG + Intergenic
1130269840 15:82440442-82440464 CGGGGCAGCCGGCACTCTGGAGG - Intergenic
1130272867 15:82461446-82461468 GGGGGCTCCCAGGACTACGGAGG - Intergenic
1130462179 15:84167743-84167765 CGGGGCAGCCGGCACTCTGGAGG - Intergenic
1130473799 15:84246665-84246687 TGGGGCAGCCGGCACTCTGGAGG - Intergenic
1130481212 15:84360729-84360751 TGGGGCAGCCGGCACTCTGGAGG - Intergenic
1130490498 15:84427030-84427052 CGGGGCAGCCGGCACTCTGGAGG + Intergenic
1130502086 15:84505800-84505822 CGGGGCAGCCGGCACTCTGGAGG + Intergenic
1130596084 15:85251280-85251302 TGGGGCAGCCGGCACTCTGGAGG - Intergenic
1130714193 15:86315457-86315479 TGGTAATCCCAGCACTTTGGAGG + Intronic
1131189342 15:90301330-90301352 AGGGGCAGCCGGCACTCTGGAGG - Intronic
1131218785 15:90563146-90563168 TTGTGATCCCAGCACTTTGGGGG + Intronic
1131711318 15:95059495-95059517 TGGGGCTGCTACCACTGTGGGGG + Intergenic
1132185138 15:99797318-99797340 AGGGGCAGCCGGCACTCTGGAGG - Intergenic
1132431850 15:101767237-101767259 AGGGGCAGCCGGCACTCTGGAGG + Intergenic
1132515362 16:363479-363501 TTGGGCTCCCAGCACCCTGACGG + Intergenic
1132764047 16:1525495-1525517 GGGGGCTTCCTGCACTGTGGGGG + Intronic
1132807888 16:1783573-1783595 TGCGGCTCCCACTACTCAGGAGG - Intronic
1132878489 16:2150608-2150630 AGGGGCTCCCTCCAGTCTGGGGG + Intronic
1133216777 16:4297314-4297336 TGGAGCCCCCAAGACTCTGGAGG + Intergenic
1134121515 16:11587359-11587381 GGGCGCTCCCGGCCCTCTGGAGG + Exonic
1134511013 16:14846818-14846840 TGGGGAACTCAGCACTCTGACGG - Intronic
1134698656 16:16245314-16245336 TGGGGAACTCAGCACTCTGACGG - Intronic
1134973179 16:18549359-18549381 TGGGGAACTCAGCACTCTGACGG + Intronic
1135277776 16:21128290-21128312 TATGGATCCCAGCACTTTGGAGG + Intronic
1138202041 16:55096318-55096340 TTGGGCCCCCAGCCATCTGGAGG - Intergenic
1138465666 16:57187713-57187735 TATGGCTCCCAGCACTCCGCAGG - Intronic
1139150874 16:64380992-64381014 TGGGCATCCCTGCACTCTTGGGG + Intergenic
1139294020 16:65884452-65884474 TGGGGCTCCCAGGCTTATGGGGG - Intergenic
1140123313 16:72101374-72101396 CGGTGCCACCAGCACTCTGGGGG + Intronic
1140168797 16:72581429-72581451 TGGTTCTCCCAGCACGCAGGTGG + Intergenic
1140512447 16:75517748-75517770 CTGTACTCCCAGCACTCTGGGGG + Intergenic
1141614461 16:85202617-85202639 TGGGGCTGCCAGCATTCATGGGG + Intergenic
1141868693 16:86769478-86769500 AGAGGCTCCCAGCACTCTGGGGG + Intergenic
1142069383 16:88082662-88082684 TGGGCCTCCCCACACCCTGGTGG + Intronic
1142135911 16:88452010-88452032 AGGAGCTCCCAGCAGGCTGGCGG + Intergenic
1142143815 16:88484337-88484359 TGGGGCGCTCAGCCCTCAGGAGG + Intronic
1142526890 17:549113-549135 TGCAGCTCCCAGCACTGTGCTGG + Intronic
1142564926 17:834060-834082 CTGGAATCCCAGCACTCTGGGGG + Intronic
1142752628 17:1998009-1998031 TGGGGCGCCCGGCACCCTGAGGG - Intronic
1143112059 17:4558452-4558474 CGGGGCTCACAGCAGTCTGCAGG + Exonic
1143380877 17:6495685-6495707 GGGTCTTCCCAGCACTCTGGTGG - Intronic
1143385539 17:6527905-6527927 GGGGTCTCCCAGGGCTCTGGAGG + Intronic
1143826907 17:9616623-9616645 TGGTTCTCCCAGCACTCAGCTGG + Intronic
1143903824 17:10194559-10194581 TGGGGTTCCCAGGTCTATGGAGG + Intronic
1144863263 17:18318994-18319016 TGGGGAGCCCTGCACCCTGGAGG + Intronic
1145272441 17:21411983-21412005 GGGGGCTCCCAGCACCCCTGGGG + Intronic
1145310649 17:21699448-21699470 GGGGGCTCCCAGCACCCCTGGGG + Intronic
1146266892 17:31458675-31458697 TGGGCCTCCCAGCACAGAGGTGG + Intronic
1146826543 17:36028295-36028317 TATGACTCCCAGCCCTCTGGGGG - Intergenic
1146923476 17:36728940-36728962 AGGGGCTCCCTGAGCTCTGGGGG + Intergenic
1148092183 17:45029316-45029338 GGAGGCTCCCAGCACGCTGGAGG - Intronic
1148835153 17:50462140-50462162 TGGGGCTCCCCGCTGACTGGAGG + Intronic
1150263372 17:63814943-63814965 TATGAATCCCAGCACTCTGGAGG - Intronic
1151447021 17:74173616-74173638 TGTGGTTCCAGGCACTCTGGAGG - Intergenic
1151456898 17:74231913-74231935 TGGGGCTGCCACCCCTCTGCTGG + Intronic
1151627115 17:75283856-75283878 TTGTAATCCCAGCACTCTGGGGG + Intronic
1152088209 17:78232686-78232708 AGGGGATCCCAGCAGGCTGGAGG + Intronic
1152227109 17:79097618-79097640 TGGGGCTCCGGGGGCTCTGGGGG - Intronic
1152572630 17:81127343-81127365 TGGGGCTCCCTGCACCCCTGGGG - Intronic
1152695459 17:81741685-81741707 TGGGGCGCCCAGGGCTCTGGAGG - Intergenic
1152800842 17:82330025-82330047 TGGGTCTCCCACCGCACTGGGGG - Intronic
1153514376 18:5890970-5890992 TGGCGCCCCCAGCTCTCGGGTGG + Exonic
1153879131 18:9405092-9405114 TGGGACTCACAGAACCCTGGTGG - Intergenic
1155515129 18:26616773-26616795 TTGTAATCCCAGCACTCTGGAGG - Intronic
1155547441 18:26929941-26929963 TGCTGCTCCCAGGACTCAGGTGG - Intronic
1155660306 18:28241078-28241100 TGGTTCTCCCAGCACGCAGGTGG + Intergenic
1156503143 18:37572395-37572417 AGTAGCTGCCAGCACTCTGGTGG + Intergenic
1156521332 18:37724507-37724529 TGGGGCTCCCAGGGCTCTATGGG + Intergenic
1158655271 18:59325048-59325070 TGGGACTCCCAGCACTGCTGAGG + Intergenic
1158963507 18:62605135-62605157 TGGGGCTCCCAGGGGTCTGTGGG - Intergenic
1161046217 19:2136277-2136299 GGGGGCTCCCAGCACGCCGAGGG - Intronic
1161252482 19:3288028-3288050 TGCAGCTCACAGCACACTGGGGG + Intronic
1161302754 19:3550980-3551002 TGGAGCTCACGGCACTCAGGTGG - Exonic
1161577282 19:5061268-5061290 CGAGGCTCCCAGGACTCTGCTGG + Intronic
1161614088 19:5260512-5260534 TGGGGCTCCCAGCACTCTGGGGG + Intronic
1161628021 19:5338338-5338360 TAGGCCTCCCAGCCCCCTGGGGG - Intronic
1161689153 19:5720810-5720832 TGGGGCTGCCAGGACTCCTGGGG + Intronic
1161853847 19:6752912-6752934 GGGGGCTTCCAGCTCTCTGCAGG + Intronic
1161967448 19:7556317-7556339 TGGTAATCCCAGCACTTTGGAGG - Intronic
1162328405 19:10012011-10012033 TGGGGGTCCCAGCACGGTGAGGG - Intergenic
1162391135 19:10390883-10390905 TGGGCCACCCTGCATTCTGGAGG + Intergenic
1162831057 19:13285011-13285033 TGGGGCTCCCACCAGGGTGGCGG - Intronic
1163003896 19:14385551-14385573 GGCGGTTCCCAGCACTCAGGGGG - Intronic
1163009150 19:14413783-14413805 TGGGGCTGCCAGGATGCTGGTGG + Intronic
1163772353 19:19198748-19198770 TGGGGGCCCCAGCACTCCAGCGG + Intronic
1165847778 19:38829692-38829714 TGGTGGTCCCAGTACTCGGGAGG + Intronic
1165849507 19:38841004-38841026 TGGAGCTCCTAGAACTTTGGGGG - Intronic
1166747072 19:45146494-45146516 CGGGGCCCACAGCACTCGGGAGG + Intronic
1167487352 19:49770456-49770478 TGAAGCTCCCAGCCCTGTGGGGG + Intronic
1167735225 19:51290460-51290482 TTGTCCTCCCAGCATTCTGGAGG + Intergenic
1167744244 19:51341375-51341397 TGGGCCCCCCACCTCTCTGGTGG - Exonic
1168020748 19:53607031-53607053 TCGGGCTCCCTGGGCTCTGGAGG - Intergenic
925208254 2:2025661-2025683 TGGTGCACCCAGCTCCCTGGTGG + Intronic
925257872 2:2505647-2505669 TGGGGTTCCCAGCAGCCTGGGGG + Intergenic
927095689 2:19746177-19746199 CGCAGCTCCCAGCACACTGGAGG + Intergenic
927213730 2:20654073-20654095 TGGGGCTCACAGCCCACTGCAGG + Intergenic
929513710 2:42586647-42586669 TTTGGCTTCCAGCACTTTGGGGG + Intronic
930019704 2:46994156-46994178 TGGCGCTCCCACCCCTCTGCTGG - Intronic
930922768 2:56777336-56777358 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
933606615 2:84390204-84390226 TGGGCATCCCTGCACTCTTGGGG - Intergenic
933718140 2:85377140-85377162 TGGGGACCCCAGCGCCCTGGAGG - Intronic
934900468 2:98155771-98155793 GGGGGTTCCCAGCACTGTGCAGG + Intronic
935493865 2:103754195-103754217 GGTGGCTCACAGCACTTTGGGGG + Intergenic
935601763 2:104929207-104929229 TGGTGATCCCAGCACATTGGAGG - Intergenic
936414248 2:112289860-112289882 TGTGGCTCCAGCCACTCTGGAGG - Intronic
936558418 2:113515678-113515700 TGCAGCTCCAAGCACGCTGGAGG + Intergenic
936944941 2:117921677-117921699 AGGTGCTCCCAGCTCTCTGGAGG + Intronic
937059595 2:118971370-118971392 TGGGGCTCCCATCAGACTGTGGG - Intronic
937978181 2:127593993-127594015 TGTGGCTCCCAGCATGATGGAGG - Intronic
938206530 2:129428897-129428919 TGGGGCAACCAGCACGGTGGAGG - Intergenic
938936389 2:136131346-136131368 TTGTAATCCCAGCACTCTGGGGG + Intergenic
940158473 2:150684426-150684448 TGGGGCAGGCAGCACTCTGAAGG + Intergenic
940770685 2:157836586-157836608 TGGGTATCCAAGCACCCTGGAGG - Intronic
941130956 2:161650557-161650579 TGGGCATCCCGGCACTCTCGGGG + Intronic
941389288 2:164891473-164891495 TGGGTCTCCTAGAAGTCTGGAGG + Intergenic
942879236 2:180839031-180839053 TGGGTCTCCCAGCACGCAGCTGG - Intergenic
943312465 2:186343829-186343851 TCATGCTCCCAGCACTTTGGGGG - Intergenic
945199761 2:207269626-207269648 TGGGGCTCAAAGGAGTCTGGAGG - Intergenic
946502872 2:220268334-220268356 TGTGGCTCTCAGCACTCAGGCGG - Intergenic
946941305 2:224772596-224772618 AGGGGCTGGCAGCACTCAGGCGG - Intronic
947435579 2:230069253-230069275 TTGTGATCCCAGCACTTTGGAGG - Intergenic
947461256 2:230306514-230306536 TGGGCCTCCCAGTGCTCTTGGGG + Intronic
947533203 2:230925634-230925656 CGTGGCTTCCAGCACTTTGGGGG + Intronic
947887222 2:233583207-233583229 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
948072988 2:235142472-235142494 TTGGCCTCCCAGGACCCTGGAGG + Intergenic
948571736 2:238922057-238922079 GGGGGCTTACAGCACTCAGGAGG + Intergenic
948633291 2:239316340-239316362 TGTAAATCCCAGCACTCTGGGGG + Intronic
948771026 2:240251339-240251361 TGGGGCTCCCCACACTCGAGTGG + Intergenic
948890451 2:240904792-240904814 AGGGCCTCCCAGGACTCTGAGGG + Intergenic
948914900 2:241029715-241029737 TGGGGCTCCCCGCTGCCTGGAGG + Intronic
1168880863 20:1204901-1204923 TGGGGTTCCCAGCACGGAGGTGG - Intronic
1169570831 20:6903472-6903494 TTGTAATCCCAGCACTCTGGGGG + Intergenic
1170689576 20:18601548-18601570 TGGGTCTCCCAGCACGCAGCTGG + Intronic
1170922244 20:20690278-20690300 AGGATCTCCCATCACTCTGGTGG - Intronic
1170966145 20:21073389-21073411 TGGTAATCCCAGCACTTTGGGGG - Intergenic
1171013290 20:21520188-21520210 TGGGGTTCCCGCCACTCTGTAGG - Intergenic
1172023512 20:31932738-31932760 CTGTGATCCCAGCACTCTGGAGG + Intronic
1172105489 20:32514909-32514931 AAGGGCGCCCAGCACTCTCGCGG + Intronic
1172427423 20:34864461-34864483 TTGTAATCCCAGCACTCTGGGGG + Intronic
1172513171 20:35514605-35514627 TGGGACTGCCAGCACCCTGAAGG + Exonic
1174057778 20:47810278-47810300 GGAGGTTCCCAGCACTCTTGGGG + Intergenic
1174542953 20:51304059-51304081 TGTGGCTCTCAGCCCTCTGCTGG - Intergenic
1174857863 20:54064154-54064176 TGGGGATCTCAGAACTCTGTGGG - Intronic
1175122716 20:56728692-56728714 TGGGGCTGGCAGTTCTCTGGGGG + Intergenic
1175381900 20:58569363-58569385 TGCGGCTCCCAGCACCCCGACGG - Intergenic
1175984263 20:62756090-62756112 GGGGCATCCCTGCACTCTGGGGG + Intronic
1175986722 20:62767824-62767846 TGGGGCTGTCAGCCCTCAGGGGG - Intergenic
1176052114 20:63125342-63125364 TGGGGCTCCCAGCAGGAGGGAGG + Intergenic
1176358063 21:5969247-5969269 TTGAGCTCCCAGCACTCGGGTGG + Intergenic
1176365811 21:6032182-6032204 TGGGGTACCCAGCACTCAGGAGG - Intergenic
1176382312 21:6119567-6119589 TGTGGCTCCCTGGGCTCTGGTGG + Intronic
1178487412 21:33027709-33027731 GGGGGCTTCCAGCACTGGGGCGG + Exonic
1179741160 21:43418672-43418694 TGTGGCTCCCTGGGCTCTGGTGG - Intronic
1179757705 21:43506363-43506385 TGGGGTACCCAGCACTCAGGAGG + Intergenic
1179765455 21:43569304-43569326 TTGAGCTCCCAGCACTCGGGTGG - Intronic
1179793879 21:43771177-43771199 TGGTGTGCCCAGCAGTCTGGAGG - Intergenic
1179975209 21:44861561-44861583 TGGGGTTGGCAGCACTCAGGAGG - Intronic
1180716191 22:17873909-17873931 GGGGGCTCCCTGCCCCCTGGGGG + Intronic
1181162295 22:20965956-20965978 TCGGGCGCTCTGCACTCTGGGGG + Intronic
1181773626 22:25144425-25144447 CCTGGCTCCCAGCTCTCTGGGGG + Intronic
1182585812 22:31343902-31343924 TGGGACTCCCTACACTCTTGAGG - Intronic
1182969104 22:34555049-34555071 TGGGTCTCCCAGCACGCAGCTGG - Intergenic
1183430567 22:37763155-37763177 TGGGGAGCCCAGCAATGTGGGGG - Intronic
1184021619 22:41825360-41825382 TGGGGCTCCCGGGTCTGTGGTGG + Intronic
1184197107 22:42937285-42937307 TGGGGCTGCCTGTGCTCTGGGGG - Intronic
1184229889 22:43152657-43152679 TGGGGCTGCCAGCAGCCAGGTGG - Intronic
1185072840 22:48666782-48666804 TGTGTCTCCCAGCAGGCTGGAGG - Intronic
1185345996 22:50311040-50311062 TGGCCCTCCCAGCACCCTGTCGG + Exonic
949199293 3:1353979-1354001 TGGGGATTCCTTCACTCTGGAGG + Intronic
950648753 3:14393997-14394019 TGGGCCTCCAAGCATTCCGGTGG - Intergenic
951573942 3:24094832-24094854 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
951915184 3:27793180-27793202 TCAGGCTCCCAGCACCCTGGTGG + Intergenic
951939289 3:28059880-28059902 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
952713669 3:36456554-36456576 TGGGCCTCCCTGCTGTCTGGAGG + Intronic
952775501 3:37042083-37042105 TGGGAATCCCAGCTCTTTGGAGG + Intronic
953851293 3:46467299-46467321 AGGAGCTCACAGCACTATGGGGG + Intronic
954440112 3:50517085-50517107 TGGGGGACCCAGCACCATGGGGG - Intergenic
954671586 3:52294009-52294031 TGGGGGTCCCAGCACTGGGATGG + Intergenic
956173321 3:66450330-66450352 TGAAGCTCCCAGCATTCTGTGGG - Intronic
956279416 3:67540667-67540689 TGGATCTCCCAGCACACTGCTGG + Intronic
957727558 3:84087276-84087298 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
961355022 3:126332195-126332217 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
962113889 3:132481328-132481350 TGGTAATCCCAGCACTTTGGGGG + Intronic
963083834 3:141418461-141418483 TGGGGCATCCAGGGCTCTGGAGG - Intronic
967287903 3:187890838-187890860 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
967827125 3:193885967-193885989 TGGGCCTGCCAGCACTTGGGAGG - Intergenic
968199565 3:196740286-196740308 TGCGGCTCCCAGCACGCAGGTGG - Intronic
968414196 4:415653-415675 TGGTGCTCAGAGCACTCTTGTGG + Intergenic
968713191 4:2135724-2135746 GGGGTCACCCAGCACACTGGGGG + Intronic
969077374 4:4590678-4590700 GTGGGCTCCCAGCAGCCTGGAGG + Intergenic
969460686 4:7327239-7327261 TGGGCCTCCCAGGAGTCAGGAGG + Intronic
969612461 4:8235116-8235138 ATGGGCTCCCAGCAATCTGGGGG + Intronic
969643479 4:8412886-8412908 TGGGGCTCTCAGTGCTGTGGAGG - Intronic
969643564 4:8413199-8413221 TGGGGCTGTCAGTACTATGGAGG - Intronic
969754253 4:9138001-9138023 TGGGGGCCCCAGCAGACTGGAGG + Intergenic
969814148 4:9674277-9674299 TGGGGGCCCCAGCAGACTGGAGG + Intergenic
970227798 4:13878042-13878064 TGGGAGACCCAGCACTCTTGGGG + Intergenic
972311647 4:37888827-37888849 TCGACCTCCTAGCACTCTGGAGG + Intergenic
972659599 4:41102642-41102664 TGTGGCTCATAGCACACTGGTGG - Intronic
975599899 4:76088150-76088172 TGGGGCTCCCTGCACCCTACAGG + Intronic
978149457 4:105415567-105415589 TGGGCATCCCTGCACTCTCGGGG - Intronic
979804931 4:124959817-124959839 TTGTCCTCCCAGCCCTCTGGTGG - Intergenic
980870265 4:138603233-138603255 TTGTAATCCCAGCACTCTGGGGG - Intergenic
985492279 5:186901-186923 TGGGGGTCCCAGTACTGAGGTGG - Exonic
985672986 5:1215844-1215866 TGGAGCTTCCTGCACGCTGGTGG - Intronic
986141488 5:5034580-5034602 TTGTAATCCCAGCACTCTGGAGG + Intergenic
986840269 5:11688312-11688334 TGGTGTCCCCAGCACTCTGTGGG + Intronic
988265296 5:28941743-28941765 AGGGGCTCCCAGTTCTCTGGAGG - Intergenic
989245354 5:39248446-39248468 TGGTGGTGCCAGCACTTTGGGGG + Intronic
991118916 5:62988105-62988127 TAGGGCTCCCAGTACTATGTTGG - Intergenic
993211941 5:84962420-84962442 TGGGCCTCCCTGCACTCTCAGGG - Intergenic
993671389 5:90765031-90765053 TGGGGCTCCAAGCTCCTTGGGGG + Intronic
994298042 5:98114089-98114111 TGGTTCTCCCAGCACACAGGTGG + Intergenic
995606327 5:113859862-113859884 TGGTAATCCCAGCATTCTGGGGG - Intergenic
997524321 5:134542697-134542719 TTGTAATCCCAGCACTCTGGGGG - Intronic
997625013 5:135325632-135325654 TCGGGCACCCAGCACTGTGCTGG + Intronic
997845329 5:137280910-137280932 TGAGGCTTCCAGCACATTGGTGG - Intronic
998729093 5:145053836-145053858 TGGGGATCCCAGCAGTCTTCAGG - Intergenic
998984334 5:147739155-147739177 TGGGTCTCCCAGAACTTTAGAGG + Intronic
1001284112 5:170410090-170410112 AGGGGCTCACAGCACTCTGATGG - Intronic
1001549656 5:172593783-172593805 TGGGGCTGCCAGGACTCAGGAGG + Intergenic
1001573052 5:172743416-172743438 TGGTGCACCCAGCCTTCTGGTGG - Intergenic
1002787914 6:418663-418685 TGGGGTCCCCAGAGCTCTGGGGG + Intergenic
1002839346 6:892774-892796 GGGGGCTCACAGGGCTCTGGTGG - Intergenic
1003167456 6:3693323-3693345 TGGGGCATCCAGGACTGTGGGGG + Intergenic
1004807635 6:19221463-19221485 TGGGTCTCCCAGCACGCAGCTGG + Intergenic
1005263212 6:24083481-24083503 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
1005960138 6:30688090-30688112 TGGGGCTCCCTGCTCTCCCGAGG - Exonic
1005965882 6:30726277-30726299 TTGTAATCCCAGCACTCTGGGGG + Intergenic
1006460162 6:34153400-34153422 TGGGGTTCCCAGCAGTCCTGAGG - Intronic
1006466098 6:34195897-34195919 TGGGGCTCCCATGGCTTTGGTGG - Intergenic
1007418116 6:41703949-41703971 AGGGGCACCCAGCACACTGTGGG - Intronic
1008825206 6:55685296-55685318 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
1008915744 6:56785207-56785229 TGGTTCTCCCAGCACTCAGCTGG - Intronic
1009984927 6:70771244-70771266 TGGTGCTCCCAGCACACAGCTGG - Intronic
1010282218 6:74035327-74035349 TGGGCCTCCTTGCACTGTGGTGG + Intergenic
1012087744 6:94851769-94851791 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
1012133055 6:95519979-95520001 TGGGCATCCCCGCACTCTCGGGG - Intergenic
1012480219 6:99658522-99658544 TGGGGTTCCCAGTACCCTGCTGG + Intergenic
1012969785 6:105716762-105716784 TGGTTCTCCCAGCACGCAGGTGG + Intergenic
1017459749 6:154637824-154637846 TGGTTCCCCCAACACTCTGGAGG + Intergenic
1018530395 6:164756947-164756969 CGGGGCTCTCAGCACCCTTGAGG + Intergenic
1018810297 6:167293894-167293916 TGGGGCACCCAGCACCCTCGTGG + Intronic
1018936439 6:168276835-168276857 TGGAGCCCCCTGCACTCTGCTGG - Intergenic
1018971255 6:168531025-168531047 TGGGGCTCCGTGGACTCAGGAGG - Intronic
1019209172 6:170391103-170391125 TGGGGCTCACACCACGCAGGTGG + Exonic
1019360598 7:602463-602485 TGGGGCTCCCGGGAGCCTGGAGG + Intronic
1022531615 7:31070329-31070351 TGGGGGTCCCCACACTCTAGTGG + Intronic
1023119028 7:36890840-36890862 TGGGGCTCCCTGCACTTTTCTGG + Intronic
1023700135 7:42883953-42883975 TGGGCCTCCCTGTGCTCTGGGGG - Intergenic
1024225861 7:47326537-47326559 TGGGGCTTCCTGCACTCTAAGGG - Intronic
1028848350 7:95508522-95508544 TGGGTTTCCGAGCAGTCTGGAGG + Intronic
1029559362 7:101292279-101292301 TGCTGCTCCCAGGACTGTGGTGG + Intergenic
1029680228 7:102103240-102103262 TGGAGTGCCCACCACTCTGGTGG - Intronic
1030065391 7:105655417-105655439 ACGGGCTCACATCACTCTGGGGG + Intronic
1031617174 7:123895136-123895158 TGGTGCTCCCAGCACTCAGCTGG + Intergenic
1031848206 7:126831198-126831220 TGGTTCTCCCAGCACTCAGCTGG - Intronic
1032415213 7:131730234-131730256 TGGGGCTCTCAGCTCTGTGAGGG + Intergenic
1033443764 7:141402778-141402800 TGGGGCTGCCTGCGCACTGGAGG + Intronic
1033452938 7:141477680-141477702 AGGGGCTTCCAGGGCTCTGGGGG + Exonic
1033623871 7:143088924-143088946 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
1034782397 7:153892569-153892591 GGTGGCTCACAGCACTTTGGGGG - Intronic
1034954683 7:155327140-155327162 TGGGGTTCCCTGCAGTCTTGTGG - Intergenic
1036678733 8:10855051-10855073 TGGGGCACCCAGGACTCTAGGGG - Intergenic
1036694444 8:10965361-10965383 TGGGGCCCCCAGATCCCTGGGGG - Intronic
1040446914 8:47505120-47505142 TGGTTCTCCCAGCACTCAGATGG - Intronic
1041806038 8:61850495-61850517 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
1044084213 8:87923890-87923912 CGGCACTCCCAGCACTTTGGGGG + Intergenic
1045887952 8:107122596-107122618 TGGGCGTCCCGGCACTCTTGGGG + Intergenic
1046954566 8:120049710-120049732 TGGGCCTCCCAGCCCTCCAGTGG + Exonic
1049251836 8:141593396-141593418 TGGGTCTCCCTGCACAATGGGGG - Intergenic
1049598306 8:143494681-143494703 GGGGGCTCCTGGCCCTCTGGGGG - Intronic
1049612703 8:143562809-143562831 TGCGGCTCCCAGCACACGTGGGG - Exonic
1049894447 9:100589-100611 TGCAGCTCCAAGCACGCTGGAGG - Intergenic
1050592673 9:7176211-7176233 TGGGTCTCCCATCATTCTAGTGG + Intergenic
1053735657 9:41100581-41100603 TGCAGCTCCAAGCACGCTGGAGG - Intergenic
1054692723 9:68330819-68330841 TGCAGCTCCAAGCACGCTGGAGG + Intronic
1055281677 9:74681382-74681404 AGGGGCATCCATCACTCTGGAGG - Intronic
1056093522 9:83228301-83228323 TGGGTCTCCCAGCACGCAGCTGG - Intergenic
1056711805 9:88997711-88997733 TGGGTATCCCAGCAATCTGTAGG + Exonic
1057638900 9:96797642-96797664 TGGTGCTCCCAGCACACAGCTGG + Intergenic
1059104695 9:111501369-111501391 AGGGCATCCCTGCACTCTGGGGG + Intergenic
1060591134 9:124817583-124817605 TGGTAATCCCAGCACTTTGGGGG + Intergenic
1061044507 9:128157576-128157598 TTGTAATCCCAGCACTCTGGGGG + Intergenic
1061245748 9:129400672-129400694 TGGCGCTCCCAGCACACAGGAGG + Intergenic
1062038214 9:134392160-134392182 TGGGGCTCCCAGCTTCCTGGTGG + Intronic
1062052270 9:134453786-134453808 TGGGGCCCCAACCACTCGGGAGG - Intergenic
1062184653 9:135211515-135211537 TGGGTATCCCTGCACTCTTGGGG + Intergenic
1062555346 9:137111277-137111299 CTGTGATCCCAGCACTCTGGGGG + Intronic
1062555364 9:137111334-137111356 CTGTGATCCCAGCACTCTGGGGG + Intronic
1185766982 X:2733256-2733278 TGGGGCTCCCAGCAGCAGGGAGG - Intronic
1191728001 X:64301933-64301955 TGGGTCTCCCAGCACGCAGCTGG - Intronic
1192528545 X:71868007-71868029 TGGGGCTCTCAGAATGCTGGAGG - Intergenic
1193286520 X:79721418-79721440 TTGGTCTGCCAGCACTCGGGAGG - Intergenic
1200064280 X:153497238-153497260 TGGGGCTCCCAGGCCTGTCGGGG - Intronic
1200126214 X:153816183-153816205 TGGGGCTCCCAGGCCTGTCGGGG + Intronic
1201917240 Y:19195512-19195534 TTGGAATCCCAGCACTTTGGAGG + Intergenic
1202367732 Y:24178523-24178545 CGGGGCAGCCGGCACTCTGGAGG - Intergenic
1202377101 Y:24247389-24247411 CGGGGCAGCCAGCACTCTGGAGG + Intergenic
1202493679 Y:25422732-25422754 CGGGGCAGCCAGCACTCTGGAGG - Intergenic
1202503051 Y:25491600-25491622 CGGGGCAGCCGGCACTCTGGAGG + Intergenic